ID: 1092716466

View in Genome Browser
Species Human (GRCh38)
Location 12:11394138-11394160
Sequence GAACTCTGGAGTGGAGCGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 109}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092716463_1092716466 15 Left 1092716463 12:11394100-11394122 CCAAGACATTAATTTCTTTGCAT 0: 1
1: 1
2: 3
3: 39
4: 410
Right 1092716466 12:11394138-11394160 GAACTCTGGAGTGGAGCGCCAGG 0: 1
1: 0
2: 1
3: 8
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092716466 Original CRISPR GAACTCTGGAGTGGAGCGCC AGG Intronic
900562020 1:3311933-3311955 GAACTCTGGACGGGGGCCCCGGG - Intronic
903156748 1:21450083-21450105 GAAGTCTGGAATGAAGCGGCTGG + Intronic
912953399 1:114135938-114135960 GATTTATGGAGTGGAGCGCTCGG + Intronic
914362742 1:146949604-146949626 GAAGTCTGGAATGAAGCGGCCGG + Intronic
914488932 1:148137507-148137529 GAAGTCTGGAATGAAGCGGCCGG - Intronic
916122791 1:161543869-161543891 GAGCTCTAGAGTGGTGTGCCTGG - Intronic
916132690 1:161625312-161625334 GAGCTCTAGAGTGGTGTGCCTGG - Intronic
917543028 1:175933956-175933978 GAACCATGGAGTGGAGCTCATGG + Intergenic
920908036 1:210189696-210189718 GAACACTGGATTGGGGCTCCAGG - Intergenic
922503179 1:226111186-226111208 GAACTCTAGGCTGGAGCGGCGGG + Intergenic
1062940413 10:1416717-1416739 ATTCTCTGGAGTGGAGCACCTGG - Intronic
1065380016 10:25080571-25080593 GGACTCTGGACTTGAGCTCCTGG - Intergenic
1065901066 10:30208414-30208436 GAACTCTGGCTTGGAGAACCCGG + Intergenic
1066484478 10:35830158-35830180 GAACCCTGGAGAGGAGCCCTGGG - Intergenic
1068438340 10:57019289-57019311 GAACTCTGGGGTGGAGCCTCAGG - Intergenic
1068956958 10:62827065-62827087 GAACTCTGAAGTTCAGCACCTGG - Intronic
1072890867 10:99323263-99323285 GGTCTCTGGAGTGCAGCACCAGG - Intergenic
1078834606 11:15015021-15015043 AAAGTCTGGAGTGGAACCCCAGG + Intronic
1079636378 11:22746691-22746713 GAACTCTAGAGTGGAGAGCAAGG + Intronic
1083196344 11:61090848-61090870 GAGCTTTGGACTGGACCGCCAGG - Intergenic
1089218055 11:116847711-116847733 GGAGTCTGGAGTGGGGCCCCGGG - Intronic
1092088061 12:5781361-5781383 GAACTCAGGGGTGGTGCCCCAGG + Intronic
1092708454 12:11309015-11309037 GAACTCTGGAGTGGAACGCTGGG + Intronic
1092712670 12:11354164-11354186 GAACTCTGGAGTGGAAAGCTGGG + Intronic
1092716466 12:11394138-11394160 GAACTCTGGAGTGGAGCGCCAGG + Intronic
1094751734 12:33417299-33417321 GATCTCGGGAGTGGAGCTGCTGG + Intronic
1095687478 12:45051500-45051522 GGACGCTGGCCTGGAGCGCCCGG + Intergenic
1100024298 12:90109029-90109051 GAAATATTGAGTGGAGCCCCTGG + Intergenic
1100438167 12:94590853-94590875 CAACACTGGAGAGGAGCCCCTGG + Intronic
1103604996 12:122079497-122079519 GGACACTGGAGGGGAGGGCCTGG - Intronic
1104087935 12:125493098-125493120 GAGCTAAGGTGTGGAGCGCCAGG - Intronic
1104100575 12:125604795-125604817 TAACTCTGGAATGTAGTGCCTGG + Intronic
1104304330 12:127595629-127595651 GAACTCTGGATTGCAGCAGCTGG + Intergenic
1104703069 12:130921902-130921924 GGACTCTGAAATGGAGCCCCAGG - Intergenic
1105411284 13:20173883-20173905 GAACTGTGGAGGGGAGCTCGGGG - Intergenic
1108920817 13:55672135-55672157 GACCTCAGGAGTGGAGCGAGTGG + Intergenic
1110405356 13:75144673-75144695 GAGCTCTGGAGTGGAGACCAAGG + Intergenic
1112355119 13:98667990-98668012 GAACTTTGTAGTGGAGAGACCGG - Intergenic
1112577363 13:100647365-100647387 GAGCTATGGAGCTGAGCGCCTGG - Intronic
1113076467 13:106472345-106472367 GCACTCTGGAGGGGAGAGGCAGG - Intergenic
1114769111 14:25408575-25408597 AAACTCTGCAGTGGCGGGCCGGG - Intergenic
1115753520 14:36513464-36513486 GGACACTGGTCTGGAGCGCCCGG + Exonic
1117493273 14:56274056-56274078 GACATCTGGTGTGGAGCTCCTGG - Intronic
1119624171 14:76157036-76157058 GAACTCTGAAGTGAGGGGCCAGG - Intronic
1119879419 14:78088658-78088680 GAACTCTGGAGTGTGGCATCAGG - Intergenic
1122775120 14:104113621-104113643 GGCCTCTGGACTGGAGCCCCAGG + Exonic
1122850368 14:104524929-104524951 GCACCCTGGAGAGGAGTGCCTGG - Intronic
1123684209 15:22786214-22786236 GATCTCTGCAGCGGCGCGCCGGG + Intronic
1124710587 15:32006771-32006793 GAACCCTGGAGTGGAGGTCCTGG - Intergenic
1125300050 15:38245488-38245510 GAAGACTGGAGTGGAGCCCAAGG + Intergenic
1125834179 15:42736211-42736233 GCGCTCCGCAGTGGAGCGCCAGG - Intronic
1126232036 15:46338596-46338618 GTACTCTGGAGTGGAGAGGTGGG - Intergenic
1127558702 15:60114497-60114519 AAACTCAGGAGTGGAGCTGCTGG - Intergenic
1138127128 16:54448081-54448103 TAAGTCTGGAGTGGGGCACCTGG + Intergenic
1142012720 16:87724811-87724833 GATATCTGGAGTGGAGCTGCTGG - Intronic
1142390451 16:89796334-89796356 GCACCCGGGAGTGGAGCCCCGGG + Intronic
1142933901 17:3311250-3311272 GAACTCTGCACTGGTGGGCCTGG - Intergenic
1144154447 17:12485468-12485490 GAACACTGGAGTTCAGAGCCAGG + Intergenic
1146492067 17:33290713-33290735 GAACTGAGCAGTGGTGCGCCAGG - Intronic
1147219139 17:38918475-38918497 GAACTCAGAAATGGAGCACCAGG - Intronic
1148440294 17:47708654-47708676 GACCTCAGAACTGGAGCGCCAGG - Intronic
1148561402 17:48608847-48608869 TGACCCTGGAGTGGGGCGCCAGG + Intronic
1148874714 17:50680166-50680188 GATCTCTGGCGTGGTGCACCTGG + Intronic
1153929097 18:9862903-9862925 GAACTGTGCAGTGCATCGCCTGG + Intergenic
1155053596 18:22167743-22167765 AAACTCTGGAATGGAGAGGCTGG - Intergenic
1160512543 18:79460760-79460782 GCACCCTGGCGTGGAGCCCCCGG + Intronic
1162123376 19:8485961-8485983 GGGCTCTGGCGTGGAGCGCATGG + Exonic
1163004439 19:14388750-14388772 GAACCCTGGATTGCAGCGACAGG - Exonic
1163063023 19:14773984-14774006 GAACCCTGGATTGCAGCGACAGG + Exonic
1165112754 19:33511848-33511870 GAACAATGGAGTGGAGAGACGGG + Intronic
1168257953 19:55177245-55177267 GCACTCTGGAGTGAAGTGTCTGG - Intronic
926150692 2:10424170-10424192 GAAGTCTGGAGTGCAGCCCTCGG + Intronic
933080386 2:77977595-77977617 TATCTCTGGGGTGGAGCCCCAGG + Intergenic
937719023 2:125070625-125070647 GAACTCAGGAGAGAAGCCCCTGG + Intergenic
940369954 2:152889997-152890019 GAACTCTGGATTAGAGAGCAGGG + Intergenic
1170774731 20:19365320-19365342 GAACTCTGGAGGTGGGCCCCAGG + Intronic
1176189554 20:63801853-63801875 GAACTCTTGGGTGGAGCTGCCGG - Intronic
1181807897 22:25386114-25386136 CAGCTCTGCAGTGGAGCACCAGG - Intronic
1183325259 22:37188017-37188039 GAAATGTGGAGGGGAGAGCCTGG + Intronic
1184477394 22:44729054-44729076 GAACTCTGGGCGGGAGCTCCTGG + Intronic
1184680754 22:46071227-46071249 GCGCGCTGGAGGGGAGCGCCCGG + Intronic
953298740 3:41750456-41750478 GAAATATGGAGTGGAGGTCCAGG - Intronic
961391895 3:126557365-126557387 GATGTCTGGAGAGGAGCCCCTGG + Intronic
962919349 3:139936275-139936297 GAGCTCTGGGGTGGGGGGCCGGG + Intronic
965684202 3:171284109-171284131 AAACTCTGGAGGGGGGCGGCAGG + Intronic
967103647 3:186237730-186237752 GGACTCTGGAGTGAAGAGCTAGG + Intronic
982528851 4:156512146-156512168 GAACTCTGTAGAGGTGCACCTGG + Intergenic
983736103 4:171062940-171062962 GAAGTCTGAAGTGGAGCCCGAGG - Intergenic
984953689 4:185025095-185025117 GAACTCAGGAGTGGAGCAGTAGG - Intergenic
985535950 5:465878-465900 GAATCCTGGAGTGGAGCGGCAGG + Intronic
985818313 5:2143041-2143063 CAGCTCTGGACTGGAGCCCCTGG + Intergenic
988987807 5:36637870-36637892 GAACTCTGGGGTGGGGGGCAGGG - Intronic
995440208 5:112183107-112183129 GAACTCTGGAGTGTACCGGGGGG - Intronic
997582461 5:135026469-135026491 GAGCTCTGGACTGGAGCCGCTGG + Intergenic
998146359 5:139731271-139731293 GAAGTCTGGACTGAAGTGCCAGG + Intergenic
1008894985 6:56542691-56542713 GAACTCCGGAAGGGAGCTCCGGG + Intronic
1021305340 7:19024927-19024949 GAAATTTGGGGTGGAGAGCCTGG + Intronic
1021664968 7:22968140-22968162 GTAGTCTGTAGTGGAGCGGCTGG - Intronic
1022559121 7:31331238-31331260 GAACACAGGTGTGGAGGGCCAGG - Intergenic
1022721052 7:32942465-32942487 GAACTCAGAGGTGGAGCGCGGGG + Intergenic
1023724050 7:43123831-43123853 GACTTCTGGAGAGGAGGGCCTGG - Intronic
1024880703 7:54082424-54082446 GAACACAGAAGTGGAGGGCCTGG + Intergenic
1034467687 7:151239455-151239477 CAACCCTGAAGAGGAGCGCCGGG - Exonic
1036294676 8:7526397-7526419 GAATTCTGGTGTGGAGCTCCTGG - Intergenic
1036327886 8:7794594-7794616 GAATTCTGGTGTGGAGCTCCTGG + Intergenic
1040551357 8:48439928-48439950 GAACTCTGCAGTGGAGCCGCGGG - Intergenic
1049574002 8:143382217-143382239 AACCTCTGGGATGGAGCGCCTGG - Intronic
1052362258 9:27573545-27573567 GAACTCAGGAGTCGCGCGCTAGG - Intronic
1054144191 9:61550288-61550310 GAGCTCTGGTGTGGAGTGCAGGG - Intergenic
1056676246 9:88679135-88679157 GAATTCTGGAATGGAGGGCATGG - Intergenic
1056873760 9:90308004-90308026 TAACTCGTGAGTGGAGAGCCAGG - Intergenic
1186446907 X:9637882-9637904 GAACTCAGTAGTGGAACACCTGG + Intronic
1189155016 X:38748247-38748269 GAACTGAGGAGGGGAGCTCCTGG + Intergenic
1189677858 X:43481210-43481232 GAACTCTGGAGTGAACTGCTTGG - Intergenic
1190936772 X:55004862-55004884 GAACTCTCGAGTGTGGGGCCAGG + Intronic
1192429484 X:71102583-71102605 GAGCACTGGAGTGGCTCGCCAGG + Exonic
1193654884 X:84187561-84187583 CAACTCTGGCGTGGCCCGCCAGG + Intronic
1195975121 X:110518444-110518466 GAACTCTGAACTGGAGAACCAGG - Intergenic
1199978058 X:152905851-152905873 GGACTCTGGAGGGGAGTCCCTGG - Intergenic