ID: 1092719263

View in Genome Browser
Species Human (GRCh38)
Location 12:11424792-11424814
Sequence CCAGCAAATAAATAAAAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1713
Summary {0: 1, 1: 0, 2: 8, 3: 127, 4: 1577}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092719261_1092719263 -1 Left 1092719261 12:11424770-11424792 CCTTGGAAAATATTTTAAAAGTC 0: 1
1: 0
2: 7
3: 103
4: 868
Right 1092719263 12:11424792-11424814 CCAGCAAATAAATAAAAAACAGG 0: 1
1: 0
2: 8
3: 127
4: 1577
1092719258_1092719263 29 Left 1092719258 12:11424740-11424762 CCAAACGCATGGTTTAATTCCTT 0: 1
1: 0
2: 0
3: 6
4: 116
Right 1092719263 12:11424792-11424814 CCAGCAAATAAATAAAAAACAGG 0: 1
1: 0
2: 8
3: 127
4: 1577
1092719260_1092719263 10 Left 1092719260 12:11424759-11424781 CCTTTCACTCTCCTTGGAAAATA 0: 1
1: 0
2: 0
3: 37
4: 306
Right 1092719263 12:11424792-11424814 CCAGCAAATAAATAAAAAACAGG 0: 1
1: 0
2: 8
3: 127
4: 1577

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092719263 Original CRISPR CCAGCAAATAAATAAAAAAC AGG Intronic
900551945 1:3261124-3261146 CAAGAAAAAAAAAAAAAAACAGG + Intronic
900716487 1:4148338-4148360 CAAACAAACAAACAAAAAACTGG + Intergenic
901355711 1:8646548-8646570 CAAACAAACAAAAAAAAAACAGG + Intronic
901370646 1:8794744-8794766 AAAACAAATAAAAAAAAAACTGG + Intronic
901599383 1:10410814-10410836 CCAGCTTATAAATAAAGATCTGG + Intronic
901706746 1:11079342-11079364 CAAACAAACAAAAAAAAAACAGG + Intronic
901826584 1:11865853-11865875 CCAGAAAAAAAAAAAAAAAGAGG - Intergenic
902222699 1:14977069-14977091 CAAACAAACAAACAAAAAACTGG + Intronic
902275973 1:15339630-15339652 CTAGCTGATAAAGAAAAAACAGG - Intronic
902327833 1:15713938-15713960 CCAAAAAAAAAAAAAAAAACAGG - Intronic
902433855 1:16384371-16384393 CCACCAAAAAAAAAAAAAAAAGG + Intronic
903143557 1:21355251-21355273 CAAACAAACAAATAAAAAAAAGG - Intergenic
903345415 1:22681196-22681218 CCAGCTAAAAAAAAAAAAAAAGG - Intergenic
903508351 1:23854079-23854101 TAAATAAATAAATAAAAAACTGG + Intronic
903628938 1:24751531-24751553 CTAGTAAATATATAAAAGACTGG - Intronic
903739197 1:25548670-25548692 CAAATAAATAAATAAATAACAGG - Intronic
903855400 1:26334946-26334968 CAAACAAACAAACAAAAAACAGG + Intronic
904112325 1:28135879-28135901 CCAGCACCTAGATTAAAAACAGG + Intergenic
904187503 1:28716865-28716887 CAATCAAAGAAATAAAAACCAGG - Intronic
904715944 1:32467736-32467758 CCAGGACATAAATAATAAACAGG + Intronic
905102515 1:35537384-35537406 CCAGAAAAAAAAAAAAAAAAAGG - Intronic
905141925 1:35853410-35853432 ACAACAAAAAAACAAAAAACAGG - Intronic
905363414 1:37435606-37435628 CAAACAAACAAACAAAAAACCGG - Intergenic
905739685 1:40359548-40359570 CCAGAAAACAAATAACAAAGTGG - Intronic
905749373 1:40449091-40449113 CAAACAAACAAACAAAAAACCGG + Intergenic
905935361 1:41819130-41819152 TCTGCAAATAAACAAAAAAAAGG - Intronic
906018374 1:42604055-42604077 CCAGCTAATTAAAAAAAAATTGG - Intronic
906352521 1:45075742-45075764 CCAGAAAACAAATAACAAAATGG - Intronic
906467564 1:46096982-46097004 CAAACAAAAAAAAAAAAAACAGG + Intronic
906734651 1:48114223-48114245 AAAGCAAAAAAAAAAAAAACTGG - Intergenic
906906228 1:49895831-49895853 CCAGAAAACAAATAACAAAATGG + Intronic
906973566 1:50545065-50545087 CCAAAAGATAAATAACAAACGGG + Intronic
907035453 1:51212275-51212297 CAAACAAACAAAAAAAAAACAGG + Intergenic
907101288 1:51839022-51839044 CCAACAACTTAGTAAAAAACTGG + Intronic
907569812 1:55472799-55472821 CCAGGAGATAAAGAACAAACAGG + Intergenic
907948210 1:59155197-59155219 CCAGCAAAACAACAAAAAATAGG + Intergenic
907980456 1:59475363-59475385 CAGGCAAATAAAAAAAATACAGG + Intronic
908111967 1:60906844-60906866 CTAGAAAAAAAAAAAAAAACTGG + Intronic
908810027 1:67971922-67971944 CCAGCAAACAAATAACAAAATGG - Intergenic
908865557 1:68545215-68545237 CCAGCACATAAATAAAGGAAGGG + Intergenic
909029155 1:70518615-70518637 CCAGCAGATATATGAAAAAATGG + Intergenic
909104055 1:71386630-71386652 CCAGAAAACAAATAAGAAAATGG + Intergenic
909187986 1:72513953-72513975 CAAACAAACAAATAAAAATCTGG - Intergenic
909291037 1:73883870-73883892 CAAACAACTCAATAAAAAACGGG + Intergenic
909385022 1:75044853-75044875 CCAGAAAACAAATAACAAAATGG + Intergenic
909517440 1:76527890-76527912 TCAGCAGAAAAATAAAATACAGG + Intronic
909616031 1:77608990-77609012 CCAGAAAATAAATAACAAAATGG + Intronic
909812336 1:79945811-79945833 TCAGTCAATAAATAAACAACTGG - Intergenic
909897187 1:81086650-81086672 ACAGGTAATAAATAGAAAACTGG + Intergenic
910276280 1:85452530-85452552 CAAACAAACAAAAAAAAAACTGG + Intronic
910330878 1:86071358-86071380 CCAGAAAACAAATAACAAAATGG + Intronic
910470172 1:87544559-87544581 CCAGAAAACAAATAACAAAATGG - Intergenic
910547590 1:88435517-88435539 CCAGAAAACAAATAACAAAATGG + Intergenic
910560499 1:88584814-88584836 CCAGAAAACAAATAACAAAATGG + Intergenic
910680861 1:89862923-89862945 CCAAAAAATAAATAAAAACAAGG - Intronic
910819104 1:91327133-91327155 CCAGAAAACAAATAACAAAATGG + Intronic
910822414 1:91365965-91365987 CCTGAAAAAAAAAAAAAAACAGG + Intronic
910898421 1:92092836-92092858 TTAGCAAATAACTAAAAGACTGG - Intronic
911020118 1:93377753-93377775 CCAGAAAACAAATAACAAAATGG + Intergenic
911212255 1:95154511-95154533 ACAGCAAGGAAATAAATAACTGG + Intronic
911383661 1:97147369-97147391 CGAACAAACAAACAAAAAACTGG + Intronic
911830433 1:102543984-102544006 GCAGCAAGTAAGAAAAAAACCGG - Intergenic
912127538 1:106557710-106557732 CCAGAAAACAAATAACAAAATGG + Intergenic
912316657 1:108673328-108673350 CCAGAAAACAAATAACAAAATGG + Intergenic
912510132 1:110184100-110184122 CCAACAAAAACAGAAAAAACAGG - Intronic
912601353 1:110936696-110936718 CCAGAAAACAAATAACAAAATGG + Intergenic
912633028 1:111265089-111265111 CCAGAAAATAAATAACAAAATGG - Intergenic
912899021 1:113628054-113628076 CCAGAAAACAAATAACAAAATGG - Intronic
913099817 1:115552650-115552672 CCAGCAAATAAATAAACAATGGG - Intergenic
913146826 1:116000137-116000159 CCAGAAAACAAATAACAAAAGGG - Intronic
913304581 1:117413837-117413859 ACAGCAAAAAAATAAATATCAGG - Intronic
913335688 1:117707398-117707420 CCAGCTAATAAGTACAACACAGG - Intergenic
913416627 1:118616213-118616235 CCAGTAAACAAATAACAAAATGG - Intergenic
913663338 1:121024107-121024129 CCATCAAAAAAAAAAAAAAAAGG + Intergenic
913707200 1:121437175-121437197 ACAGAAAATAAATAACAAAATGG + Intergenic
913998736 1:143674296-143674318 CCAGCAAGTAAATGACAAAAGGG + Intergenic
914199742 1:145474235-145474257 CCAGCAAGTAAATGAAGAAAGGG + Intergenic
914313160 1:146485487-146485509 CCAGCAAGTAAATGAAGAAAGGG + Intergenic
914478860 1:148047370-148047392 CCAGCAAGTAAATGAAGAAAGGG + Intergenic
914501190 1:148247894-148247916 CCAGCAAGTAAATGAAGAAAGGG - Intergenic
914894847 1:151660237-151660259 CCAAAAAAAAAAAAAAAAACTGG - Intronic
914979053 1:152396559-152396581 CAAGCAACTAAATCAAAAATAGG + Intergenic
915177136 1:154025354-154025376 CCAGAAAAAAAAAAAAAAAAAGG - Intronic
915659784 1:157393256-157393278 CCAGAAAACAAATAACAAAAAGG - Intergenic
915753127 1:158230901-158230923 CCAGAAAACAAATAATAAAATGG + Intergenic
915989381 1:160498145-160498167 TCAAAAAATAAAAAAAAAACAGG - Intronic
916322040 1:163515382-163515404 CCAGAAAACAAATAACAAAATGG + Intergenic
916339701 1:163718072-163718094 CCATCAAATATATGAAAAAAAGG + Intergenic
916439338 1:164807482-164807504 ACACCAAATAAATATAAAATGGG - Intronic
916562935 1:165948888-165948910 GAAGCAAATAAATAAATAAATGG + Intergenic
916611971 1:166400161-166400183 CCGGCAAATACATAAACAATTGG - Intergenic
916616161 1:166442812-166442834 CCAGAAAACAAATAACAAAATGG - Intergenic
916679462 1:167090648-167090670 ACAGGAAATAAATAATAAAAAGG + Intergenic
917003106 1:170383097-170383119 CCAGAAAACAAATAACAAAATGG - Intergenic
917012703 1:170491990-170492012 CCAGGAATTACATATAAAACAGG - Intergenic
917190486 1:172413219-172413241 CAAACAAACAAACAAAAAACTGG - Intronic
917242468 1:172963560-172963582 CCAGCAAATATATGAAAAGAAGG + Intergenic
917801249 1:178572624-178572646 TAAGTAAATAAATAAAAATCAGG + Intergenic
917949813 1:180019786-180019808 TCAGCAAAACAATAAAAAAGAGG - Intronic
917992932 1:180401785-180401807 CCAGAAAAAAAAAAAAAAAATGG + Intronic
918028786 1:180782135-180782157 AGAGAAAAAAAATAAAAAACAGG - Intronic
918253306 1:182724152-182724174 CCAGAATATAAATAGAAAGCAGG + Intergenic
918306889 1:183254925-183254947 AAAGCAAATAAATAAATAAATGG - Intronic
918422141 1:184374989-184375011 ACAGCAATTCAATAGAAAACTGG - Intergenic
918535940 1:185574528-185574550 CCATGAAAGAAATAAAAAAAAGG + Intergenic
918609000 1:186465075-186465097 CCAGCAAAAAAATAACCAGCCGG - Intergenic
918618997 1:186581147-186581169 CAAGCACATGAATAAAACACAGG - Intergenic
918660047 1:187076667-187076689 CAAACAAACAAACAAAAAACAGG - Intergenic
918839099 1:189511745-189511767 CAAACAAACAAACAAAAAACAGG + Intergenic
918959428 1:191253874-191253896 CCAGCAGACAAATAACAAAATGG - Intergenic
918973649 1:191451659-191451681 ACAGCAAATAAATTAATAAAAGG + Intergenic
918993807 1:191731564-191731586 TCAGCAAAAAAATAAAAAAAAGG + Intergenic
919068047 1:192717632-192717654 CCAGAAAACAAATAACAAAATGG + Intergenic
919271448 1:195352858-195352880 TTAGCTAATAAATAAAAAAAAGG + Intergenic
919422095 1:197382476-197382498 TCAGTAAATAAATAAATTACTGG - Intronic
919459862 1:197863791-197863813 CAAACAAACAAATAAAAAAATGG + Intergenic
919903103 1:202058359-202058381 TCAAAAAACAAATAAAAAACAGG + Intergenic
919926311 1:202193642-202193664 CCAGGAAAGAAAAAAAAAAAAGG - Intergenic
919995755 1:202748383-202748405 CAAGAAAATAATTAACAAACTGG + Intronic
920034291 1:203055964-203055986 CCAGAAAAAAAAAAAAAAGCTGG - Intronic
920397202 1:205655884-205655906 TCAAAAAATAAATAAAAATCTGG + Intergenic
920945856 1:210527915-210527937 CAAGCAAATAAATAAACAAATGG + Intronic
921000864 1:211041426-211041448 CCACCAAATAAATATAACTCAGG + Intronic
921042933 1:211451230-211451252 CCAGAAAACAAATAACAAAATGG + Intergenic
921077944 1:211714835-211714857 CAAACAAACAAACAAAAAACCGG - Intergenic
921237598 1:213150171-213150193 CCAGAAAAAAAATAACAAAATGG - Intronic
921285737 1:213607723-213607745 ACACAAAATAAATAAAAAAGAGG + Intergenic
921295871 1:213702964-213702986 CCAGGAAACAAATAACAAAATGG - Intergenic
921713087 1:218392365-218392387 CAAACAAACAAACAAAAAACTGG + Intronic
921775251 1:219090633-219090655 CCAGAAAACAAATAACAAAATGG + Intergenic
921917582 1:220629351-220629373 CCACCAAAAAAAAAAAAAAAAGG - Intronic
921984913 1:221302504-221302526 TAAGCAAATAAACACAAAACTGG + Intergenic
921994244 1:221399666-221399688 CCAGAAAACAAATAACAAAATGG + Intergenic
922010826 1:221584676-221584698 CCACTAAATAAATAACAAAGAGG - Intergenic
922113411 1:222585409-222585431 CCCACAAATACATAAAAAATTGG + Intronic
922394214 1:225179249-225179271 CCAGAAAATAAGTAACAAAATGG - Intronic
922600548 1:226848474-226848496 CCAGCAAAAAAAAAAAAAAGAGG + Intergenic
922700258 1:227755197-227755219 AAAGTAAATAAATAAAAACCTGG - Intronic
922955041 1:229592282-229592304 CAAGTAAAAAAAAAAAAAACTGG + Intergenic
923176045 1:231466728-231466750 AAATAAAATAAATAAAAAACAGG - Intergenic
923502012 1:234572897-234572919 CAAACAAACAAACAAAAAACTGG + Intergenic
923810847 1:237313830-237313852 TAAGTCAATAAATAAAAAACAGG - Intronic
924164692 1:241269351-241269373 CCAGCAAGTAAAAATAAACCTGG + Intronic
924369073 1:243328258-243328280 CAAACAAACAAACAAAAAACTGG - Intronic
924584732 1:245352244-245352266 CAAACAAACAAACAAAAAACTGG - Intronic
924669832 1:246112693-246112715 AAAGCAAAAAAATAAAAAATAGG + Intronic
924717669 1:246592708-246592730 TCAGCAGGTAAATAAAATACAGG + Intronic
1063038210 10:2309999-2310021 GCAGAAAATAAATATAAAATAGG + Intergenic
1063158140 10:3398522-3398544 CCAGCAAACACAATAAAAACAGG + Intergenic
1063241890 10:4178677-4178699 ATTCCAAATAAATAAAAAACAGG + Intergenic
1063563592 10:7151481-7151503 CCATCACATACATAAAGAACTGG - Intergenic
1063774689 10:9248801-9248823 CCAGAAAACAAATAACAAAATGG + Intergenic
1064531845 10:16318308-16318330 CAAACAAACAAACAAAAAACAGG + Intergenic
1064696569 10:17972871-17972893 CCAGAAAACAAATAACAAAATGG - Intronic
1064718615 10:18204973-18204995 CCAGAAAAAAAAAAAAAAAAAGG + Intronic
1064894020 10:20213345-20213367 CCAGAAAATATACATAAAACAGG - Intronic
1064930331 10:20618864-20618886 CAAACAAATAAAACAAAAACTGG - Intergenic
1065037880 10:21659035-21659057 CAAGCCAATAAAAAAAAAGCAGG - Intronic
1065273319 10:24059565-24059587 CAAACAAACAAACAAAAAACTGG - Intronic
1065591812 10:27270090-27270112 CCAACAAATACATAAAAATATGG - Intergenic
1066141667 10:32509512-32509534 ACACCAAAAAAAAAAAAAACAGG + Intronic
1066389041 10:34964142-34964164 CAAACAAACAAAAAAAAAACAGG + Intergenic
1066423794 10:35286273-35286295 CCACTAAATAAATAAAAAGAAGG - Intronic
1066527026 10:36292478-36292500 CCAGAAAACAAATAACAAAATGG - Intergenic
1067335313 10:45357677-45357699 CCAGAAAATAAATAACAAAATGG + Intergenic
1067883237 10:50065467-50065489 CAAACAAATAAATAAATAAATGG + Intergenic
1068451317 10:57192842-57192864 CCAGAAAACAAATAACAAAATGG - Intergenic
1068978836 10:63039319-63039341 AGAGCAAAAAAAAAAAAAACTGG + Intergenic
1069050793 10:63790745-63790767 CCAGAAAACAAATAACAAAATGG + Intergenic
1069291790 10:66789160-66789182 CAAACAAATAAACAAAAAAAAGG - Intronic
1069404976 10:68089330-68089352 CAAACAAATAAACAAAAAACAGG - Intergenic
1069671855 10:70212819-70212841 CCACCAAAAAAAAAAAAAAAGGG + Intronic
1070387977 10:75943160-75943182 TCAGCAAAAAAAAAAAAAAAAGG + Intronic
1070442246 10:76458168-76458190 ACTGCAAATATATACAAAACAGG - Intronic
1070995416 10:80774861-80774883 CCTGAAAATAAAAAAAAAAAAGG - Intergenic
1071058587 10:81541956-81541978 CCTGCAAATAAATATGAAAAAGG + Intergenic
1071114659 10:82203736-82203758 ACATCACATAAATCAAAAACAGG + Intronic
1071209386 10:83320227-83320249 CCAGAAAAAAAATAACAAAATGG + Intergenic
1071537465 10:86446723-86446745 CAAGCAAAAAAATACAAAATTGG + Intronic
1071554469 10:86591813-86591835 CAAACAAACAAACAAAAAACTGG - Intergenic
1071789890 10:88942433-88942455 CCAGTAACTACATAAAAAAGTGG - Intronic
1072059073 10:91790865-91790887 CCAGAAAACAAATAACAAAATGG + Intergenic
1072282742 10:93883729-93883751 CCAGAAAACAAATAACAAAATGG + Intergenic
1072378642 10:94842523-94842545 CCAGTAAACAAATAACAAAAAGG - Intronic
1072390511 10:94980873-94980895 CCAGAAAACAAATAACAAAGGGG - Intronic
1072667392 10:97403785-97403807 CCAATAAATATATGAAAAACAGG + Intronic
1072938571 10:99736851-99736873 CCCTGAAATAAATGAAAAACTGG - Intronic
1073279318 10:102340571-102340593 ACAGAAAATAATTAAAAAAACGG - Intronic
1073427455 10:103464361-103464383 CGACTAAATAAATAAAAAGCAGG + Intergenic
1073743861 10:106443328-106443350 CAAACAAACAAACAAAAAACAGG + Intergenic
1074332932 10:112537510-112537532 CCATCAGATAAATATAAAAGAGG + Intronic
1074637860 10:115342042-115342064 CCAGAAAACAAATAATAAAATGG - Intronic
1074722108 10:116272535-116272557 CAAGCAAATAAATAAATAAACGG + Intronic
1074804261 10:117031861-117031883 CCAGAAAACAAATAACAAAACGG + Intronic
1074932621 10:118144384-118144406 CCAGAAAATGAATATAAAAACGG + Intergenic
1075144747 10:119873237-119873259 TCAGCAAAAAAAGAAAAAAAAGG - Intronic
1075308124 10:121385842-121385864 CCATCAAAAAAAAAAAAAAAAGG + Intergenic
1075636269 10:124032808-124032830 CCAGAAAAAAAAAAAAAAAATGG + Intronic
1075695822 10:124434422-124434444 TCAATAAATAAATAAAAGACCGG + Intergenic
1076049654 10:127322186-127322208 CCAGGAAAAAAAAAAAAAAAAGG - Intronic
1076094858 10:127723384-127723406 CCAGAAAACAAATAACAAAATGG + Intergenic
1076256936 10:129034272-129034294 CCTGTAAATAAGTAAAAAAAAGG - Intergenic
1077428427 11:2499413-2499435 CCAGAAAACAAATAATAAAATGG + Intronic
1077704386 11:4470444-4470466 CCAGTAAGTAAATAGAACACTGG - Intergenic
1077714991 11:4571689-4571711 CGAGCAAAAAAAAAAAAAAAAGG + Intronic
1078122580 11:8524326-8524348 TAAATAAATAAATAAAAAACGGG + Intronic
1078300140 11:10121064-10121086 CAAACAAACAAACAAAAAACAGG - Intronic
1078305413 11:10179730-10179752 CCAGAAAACAAATAACAAAATGG - Intronic
1078553474 11:12297354-12297376 CCAACAAACCAATAGAAAACTGG - Intronic
1078811237 11:14766667-14766689 CAAACAAACAAAAAAAAAACAGG + Intronic
1078970837 11:16409285-16409307 CCTCCAAAAAAAAAAAAAACAGG + Intronic
1079272048 11:18997473-18997495 CCAGAAAACAAATAACAAAATGG - Intergenic
1079550998 11:21697099-21697121 AAAGCAAAAAAAAAAAAAACAGG + Intergenic
1079561294 11:21823380-21823402 CCAGAAAATAAAAAAAGTACAGG + Intergenic
1079711694 11:23691997-23692019 AAAACAAATAAATAAAAATCTGG - Intergenic
1079751701 11:24207745-24207767 CTTGCAAATAAAGAATAAACTGG + Intergenic
1079793383 11:24767807-24767829 CCAGAAAATAAATCAAAACAAGG + Intronic
1080062909 11:27976287-27976309 CCAGTAAATTAATAACAAAAAGG - Intergenic
1080123491 11:28704340-28704362 TCAGAAATCAAATAAAAAACTGG + Intergenic
1080706986 11:34705152-34705174 CCAGAAAACAAATAACAAAATGG - Intergenic
1080724355 11:34880644-34880666 CCAGGAAAGAAATATACAACTGG + Intronic
1081144138 11:39540504-39540526 CTAGAAAATAATTAACAAACTGG - Intergenic
1081212316 11:40352050-40352072 CCAGAAAACAAATAACAAAATGG - Intronic
1081252216 11:40850156-40850178 CCAGCAAGGGAAAAAAAAACTGG - Intronic
1081270897 11:41080825-41080847 ACAATAAATAAATAAATAACAGG - Intronic
1081555354 11:44155349-44155371 CCAGGAAACAAATAACAAAATGG - Intronic
1081898272 11:46605881-46605903 CAAACAAACAAACAAAAAACTGG - Intronic
1082213248 11:49532721-49532743 CCAGAAAATAATTAACAAAATGG - Intergenic
1082247788 11:49944740-49944762 ATAGCAAAAAAATAAAAAAATGG + Intergenic
1082801513 11:57418330-57418352 CCTCCAAATAAAAAAAAAAAAGG + Intronic
1082907500 11:58326227-58326249 CAAACAAACAAAAAAAAAACAGG - Intergenic
1082970424 11:59014965-59014987 CCAGCAAACAAATACCAAAATGG + Intronic
1083512488 11:63224461-63224483 CCAGAAAATAAATAACACAATGG - Intronic
1083649441 11:64192885-64192907 CCAGCAAAGAAAAAATAAGCAGG - Intronic
1083984120 11:66199612-66199634 CCAGAAAACAAATAACAAAATGG + Intronic
1084129323 11:67120495-67120517 CCAAAAATTAAATAAAAGACCGG - Intronic
1084480451 11:69416802-69416824 CAAGCAAAAAAAAAAAAAAAAGG - Intergenic
1085019364 11:73195582-73195604 CCAGCAAAGAAAGAGAGAACTGG - Intergenic
1085153039 11:74267493-74267515 CCAGCAGATAAATAGCAAAGAGG + Intronic
1085263474 11:75222489-75222511 ACAGGAAATAAATAAAAATTAGG - Intergenic
1086249500 11:84796301-84796323 ACAGCAAAAAGATAAAAAGCAGG - Intronic
1086277126 11:85144453-85144475 CCAGAAAACAAATAACAAAATGG - Intronic
1086549436 11:88038898-88038920 ATAGCAAATAAATAAATAAATGG - Intergenic
1086636358 11:89091822-89091844 CCAGAAAATAATTAACAAAATGG + Intergenic
1086685526 11:89729711-89729733 CAAACAAATAAAAAAAAGACTGG + Intergenic
1086833608 11:91595989-91596011 CAAACAAATAAACAAAGAACAGG - Intergenic
1086880268 11:92145868-92145890 CAAACAAACAAACAAAAAACTGG - Intergenic
1087370906 11:97282311-97282333 CCAGAAAACAAATAACAAACTGG + Intergenic
1087380269 11:97396963-97396985 CCAGAAAACAAATAACAAAATGG - Intergenic
1087394909 11:97585087-97585109 ACAGCAAATAAGTAAAAGAAAGG - Intergenic
1087402191 11:97681965-97681987 CCAGAAAACAAATAACAAAATGG - Intergenic
1087492167 11:98842440-98842462 CCAGAAAACAAATAACAAAATGG - Intergenic
1087522281 11:99254857-99254879 CCTGAAAATAATTAAAAAGCAGG + Intronic
1087598148 11:100280713-100280735 CCAGAAAACAAATAATAAAATGG - Intronic
1087793334 11:102430246-102430268 CAAGCAAAAAACTCAAAAACTGG + Intronic
1087924817 11:103907429-103907451 CCATCAAAGGAATAAAAAGCTGG - Exonic
1087950600 11:104216380-104216402 CCAGAAAACAAATAACAAAATGG - Intergenic
1088330868 11:108650012-108650034 CCAGCAAACAAATAAGAAAATGG + Intergenic
1088353382 11:108914831-108914853 CCATTAAAAAAAAAAAAAACTGG + Intronic
1088361784 11:108998732-108998754 CCAGAAAATAAGTAACAAAATGG - Intergenic
1088459531 11:110068175-110068197 TAAATAAATAAATAAAAAACAGG - Intergenic
1088459572 11:110068500-110068522 CAAACAAACAAACAAAAAACAGG - Intergenic
1088680201 11:112234931-112234953 TCAGCAAATAAATTGCAAACTGG + Intronic
1088874194 11:113920365-113920387 CAAACAAACAAACAAAAAACTGG - Intronic
1088937987 11:114423576-114423598 CCAGGAAACAAATAACAAAATGG - Intronic
1088944255 11:114493348-114493370 CCAGAAAACAAATAACAAAATGG - Intergenic
1089159964 11:116429728-116429750 CAAACAAACAAACAAAAAACTGG + Intergenic
1089333455 11:117706283-117706305 CGAACAAACAAATAAAAACCTGG - Intronic
1089374925 11:117987415-117987437 CCAAAAAATAAATAAAAAACAGG + Intronic
1089937552 11:122380101-122380123 CCAGAAAACAAATAACGAACTGG + Intergenic
1090178632 11:124673899-124673921 CCAGCAACTAGAAAAACAACCGG + Exonic
1090206170 11:124885577-124885599 CCGACAAAAAAAAAAAAAACAGG - Intronic
1090316969 11:125800477-125800499 CCAGAAAAAAAATAACAAAATGG - Intergenic
1090480087 11:127060212-127060234 CCATCAAATCAAGAAAACACAGG - Intergenic
1090515466 11:127421552-127421574 TCAGAAAATAAATAACAAACTGG - Intergenic
1090566560 11:127998978-127999000 ACAGTAAATAAATAAATAAATGG - Intergenic
1090725723 11:129525763-129525785 CAAGAAAAAAAAAAAAAAACAGG + Intergenic
1090783931 11:130031710-130031732 CCACCAAGTAAATAAAAGAGGGG - Intergenic
1090890982 11:130922285-130922307 CCATCAAAAAAAAAAAAAAAAGG - Intergenic
1091462687 12:657127-657149 CCATGAAAGAAATAATAAACTGG + Intronic
1091682683 12:2538263-2538285 TCAGAAAGTAAATATAAAACAGG - Intronic
1091695405 12:2624992-2625014 TCTGCAAATAAATAATAATCAGG - Intronic
1092319418 12:7455824-7455846 CCAGCAAATAATTAACAAAATGG + Intronic
1092719263 12:11424792-11424814 CCAGCAAATAAATAAAAAACAGG + Intronic
1092992890 12:13920232-13920254 CAAGAAAAAAAAAAAAAAACGGG + Intronic
1093035135 12:14325665-14325687 CAAACAAATAAATAACAAAGGGG - Intergenic
1093093162 12:14943374-14943396 ACAACAAAAAAAAAAAAAACAGG - Intronic
1093259293 12:16915506-16915528 CCAGAAAACAAATAAGAAAATGG - Intergenic
1093313570 12:17621115-17621137 TGAGAAAATAAATAAAAAATAGG - Intergenic
1093617436 12:21243553-21243575 CCAGAAAACAAATAACAAAATGG + Intergenic
1093620287 12:21280191-21280213 CCAGAAAACAAATAACAAAATGG + Intronic
1093729353 12:22549893-22549915 CAAACAAATAAACAAAAAAAGGG - Intergenic
1093734235 12:22601838-22601860 CCAGAAAATAAATTAAAAAATGG + Intergenic
1093877554 12:24368362-24368384 TAACCAAATCAATAAAAAACAGG - Intergenic
1093932071 12:24964042-24964064 CCAGAAAACAAATAACAAAATGG + Intergenic
1093973669 12:25398063-25398085 CCAGAAAACAAACAAAAAAACGG - Intergenic
1094161932 12:27399883-27399905 CCACCAAAATAATAAAAAATTGG - Intronic
1094328177 12:29262754-29262776 CCAGAAACTAAATAACAAAATGG + Intronic
1094436522 12:30426223-30426245 ACAGCAAATAAATGAAAATTAGG - Intergenic
1094543646 12:31383938-31383960 CCTGCAAATAAATTAAATGCTGG - Exonic
1094559472 12:31537577-31537599 CCAGAAAATAAGTAACAAAATGG + Intronic
1095004628 12:36793651-36793673 CCAGCAAATATCAAAAAAAGAGG - Intergenic
1095020965 12:37058123-37058145 CCTGCAAATAAAACAAAAAGAGG - Intergenic
1095181475 12:39151668-39151690 CCAGAAAACAAATAACAAAATGG - Intergenic
1095336730 12:41037803-41037825 CAGGCAAATAAATAGAACACAGG - Intronic
1095565486 12:43618583-43618605 CAATCAAAGAAATAGAAAACAGG - Intergenic
1095788780 12:46141542-46141564 CCAGAAAATAAATAACAAAATGG - Intergenic
1095860463 12:46910935-46910957 CCAGAAAACAAATAACAAAATGG + Intergenic
1096358044 12:50959116-50959138 TCAGGAAAAAAATAAAAAAGAGG - Intronic
1096729696 12:53598496-53598518 CCAACAAATAATTCAGAAACAGG + Intronic
1097061145 12:56284896-56284918 CCAAAAAAAAAAAAAAAAACAGG + Intronic
1097146763 12:56946258-56946280 CCAGAAAACAAATAACAAAATGG - Intergenic
1097403257 12:59156176-59156198 CAAACAAACAAACAAAAAACAGG + Intergenic
1097608609 12:61787811-61787833 CCAGAAAATAATTAACAAAATGG + Intronic
1097782322 12:63722535-63722557 CCCTCAAATAAATTAAAAACAGG + Intergenic
1097853374 12:64436259-64436281 CCTGTAAATAAATAAAAAATAGG - Intronic
1097874622 12:64631873-64631895 TCTAAAAATAAATAAAAAACAGG - Intronic
1097898923 12:64854111-64854133 CCAGAAAACAAATAACAAAATGG - Intronic
1097996929 12:65898112-65898134 CCTCCAACTAAATAACAAACAGG + Intronic
1098436711 12:70475859-70475881 CAAACAAACAAACAAAAAACTGG + Intergenic
1098695754 12:73552230-73552252 CCTGACATTAAATAAAAAACAGG - Intergenic
1098784679 12:74737192-74737214 CCATCAAAAAAATAAAGAAGAGG + Intergenic
1098793107 12:74852074-74852096 TAAGCAAATAAATAATAAACGGG - Intergenic
1099079259 12:78155748-78155770 CCAACAAACATATAAAAAAAAGG - Intronic
1099523529 12:83692515-83692537 CCTGAAAACAAATAAAAAAATGG + Intergenic
1099600603 12:84731850-84731872 CTAGGAAATAAATAGAAAATGGG + Intergenic
1099763942 12:86958488-86958510 CCAGAAAACAAATAACAAAATGG - Intergenic
1099781881 12:87205465-87205487 CCAGAAAACAAATAACAAAATGG + Intergenic
1099880789 12:88465031-88465053 CAAACAAACAAACAAAAAACAGG - Intergenic
1099911861 12:88843986-88844008 CCAGCAAACAAATAACAAAATGG + Intergenic
1099944248 12:89225741-89225763 CTACCAAAAAAAAAAAAAACTGG + Intergenic
1099958298 12:89372706-89372728 CAAACAAACAAACAAAAAACAGG + Intergenic
1099984237 12:89644697-89644719 CCAGCAAAAAGAAAAAAAAATGG + Intronic
1100236824 12:92669943-92669965 CACACAAATAAATAAAACACAGG + Intergenic
1100360548 12:93875433-93875455 CCAGAAAACAAATAACAAAGTGG - Intronic
1100425426 12:94480660-94480682 ACAGCAAATACAGAAAAAAGAGG + Intergenic
1100838102 12:98586220-98586242 CAAACAAACAAACAAAAAACAGG + Intergenic
1100905134 12:99288865-99288887 CCAGAAAACAAATAACAAAATGG + Intronic
1101468202 12:104969695-104969717 ACATGAAATAGATAAAAAACAGG + Intergenic
1102259045 12:111432343-111432365 CCAGCAAAAAAGTTAAAAATGGG - Intronic
1102318262 12:111907866-111907888 CCAGAAAATAAATAACAAAGTGG + Intergenic
1102669261 12:114603012-114603034 CCATCAAAAAAAAAAAAAAAAGG + Intergenic
1102842102 12:116135902-116135924 CCACCAAAAAAAAAAAAAAAAGG - Intronic
1103142043 12:118557116-118557138 CCTCCAAATAAATAAATAACAGG - Intergenic
1103360830 12:120352674-120352696 CAAGTAAATAAATAAATAAATGG + Intronic
1103860404 12:124007837-124007859 TCAGCAAACAAACAAAAAAAGGG - Intronic
1104104745 12:125648527-125648549 ACAGAAAAAAAAAAAAAAACAGG - Intronic
1104316332 12:127705815-127705837 CCTGCAAATACAAACAAAACAGG + Intergenic
1105333514 13:19440784-19440806 CAAACAAACAAACAAAAAACAGG + Intronic
1105377536 13:19859385-19859407 CAAACAAACAAACAAAAAACGGG - Intronic
1105385793 13:19928305-19928327 CCTACAAATCAATAAAAAAAAGG - Intergenic
1106012253 13:25836160-25836182 CAAACAAACAAACAAAAAACAGG - Intronic
1106709217 13:32312885-32312907 CAAACAAACAAACAAAAAACAGG + Intronic
1107287509 13:38812329-38812351 CCAGAAAACAAATAACAAAATGG - Intronic
1107330612 13:39295896-39295918 TCAGAAAAAAAAAAAAAAACAGG + Intergenic
1107532830 13:41300725-41300747 AAAGCAAAAAAATAAAAAAGAGG + Intergenic
1107750684 13:43562483-43562505 CCAGAAAACAAATAACAAAATGG + Intronic
1107842799 13:44476967-44476989 CAAACAAACAAACAAAAAACAGG - Intronic
1108228308 13:48313360-48313382 CCAAAAAAAAAATAGAAAACTGG - Intronic
1108255711 13:48608998-48609020 CCAGAAAACAAATAACAAAATGG - Intergenic
1108324597 13:49317742-49317764 CAAGCAATGAAAGAAAAAACAGG + Intronic
1108328818 13:49363609-49363631 CCAGAAAACAAATAACAAAATGG + Intronic
1108377586 13:49827922-49827944 CAAGCACATAGATAAATAACAGG + Intergenic
1109016627 13:57023360-57023382 CCAGAAAATAAATAGCAAAATGG + Intergenic
1109031643 13:57198045-57198067 CCAGAAAACAAATAACAAAATGG - Intergenic
1109068316 13:57730275-57730297 CAAGCAAATAAATGAACAAAAGG - Intergenic
1109100482 13:58178493-58178515 CCAGAAAACAAATAAGAAAATGG - Intergenic
1109336462 13:61001124-61001146 CCAGAAAATAAATAACAAAATGG - Intergenic
1109668762 13:65575318-65575340 GCAGAAAATAAACAAAAACCAGG + Intergenic
1109863882 13:68236287-68236309 CCAGCTAGTGAATAAAAAAAAGG + Intergenic
1110043469 13:70796990-70797012 CAAGCAAACAAACAAAAAACAGG - Intergenic
1110142268 13:72145049-72145071 CCAGAAAAAAAAAGAAAAACTGG + Intergenic
1110448151 13:75611337-75611359 CAAACAAAAAAAAAAAAAACAGG - Intergenic
1110448492 13:75615760-75615782 CCAGAAAACAAATAATAAAATGG - Intergenic
1110466425 13:75807132-75807154 CAAACAAACAAACAAAAAACAGG + Intronic
1110711435 13:78655336-78655358 CAAACAAACAAAAAAAAAACAGG + Intronic
1110813330 13:79834746-79834768 CTAGAAAAAAAAAAAAAAACAGG - Intergenic
1110853720 13:80274640-80274662 CCAGCAGAGTAATAAAAAAGTGG - Intergenic
1110919927 13:81070357-81070379 CAAGACAATAAATAAATAACTGG + Intergenic
1110938251 13:81318909-81318931 CCAGCATTTAAAAAAAAAAATGG - Intergenic
1111159442 13:84374528-84374550 ACAGCTAATCAAGAAAAAACAGG + Intergenic
1111226317 13:85276580-85276602 AAAACAAATAAACAAAAAACCGG + Intergenic
1111240161 13:85463339-85463361 CCAAAAAATAAAAAAAATACTGG + Intergenic
1111257424 13:85689558-85689580 GCAGCAAAAAAAAAAAAAAATGG - Intergenic
1111289223 13:86141461-86141483 CAACAAAATAAATAACAAACTGG - Intergenic
1111373080 13:87342682-87342704 CAAACAAACAAACAAAAAACAGG + Intergenic
1111376884 13:87391940-87391962 ACAGAAAATAAATTATAAACTGG + Intergenic
1111493199 13:89012177-89012199 CCAGAAAATAATTAAAAACGAGG + Intergenic
1111650609 13:91086417-91086439 CCAGCAGATAAAATAAAACCTGG + Intergenic
1111841785 13:93458368-93458390 CAAGCAAATAAATACAAAAATGG - Intronic
1111981600 13:95021984-95022006 CCTGGAGATAAATTAAAAACAGG + Intronic
1111988204 13:95087223-95087245 ACAACAAACAAACAAAAAACTGG + Intronic
1112138709 13:96613788-96613810 CTAGCAAATTAATAAAAAGAGGG + Intronic
1112460363 13:99598664-99598686 CCACCAAAAAAAAAAAAAAAAGG - Intergenic
1112727672 13:102323459-102323481 CCAATAAATACATAAAAGACTGG + Intronic
1112828777 13:103422953-103422975 CAAACAAACAAACAAAAAACGGG - Intergenic
1113141640 13:107158758-107158780 TCAGCAATCAAAAAAAAAACTGG - Intergenic
1113477921 13:110598531-110598553 CCCGCAAATAAATACATAAGAGG + Intergenic
1113491084 13:110692560-110692582 ACAGCAAAAAAAAAAAAAAAAGG - Intronic
1113658987 13:112091277-112091299 CCAAAAAAAAAAAAAAAAACTGG + Intergenic
1113825975 13:113254021-113254043 TCAGCAAGTAGGTAAAAAACTGG - Intronic
1114008341 14:18338670-18338692 ACAGGAAAGAAAAAAAAAACAGG - Intergenic
1114433654 14:22685464-22685486 CCAGAAAACAAATAATAAAATGG + Intergenic
1114582821 14:23779094-23779116 CCATCAAAGAAATAAAAACTAGG - Intergenic
1114758832 14:25289044-25289066 TAAATAAATAAATAAAAAACAGG - Intergenic
1114837993 14:26226669-26226691 ACTGTAAATAAATAGAAAACTGG + Intergenic
1114991318 14:28293739-28293761 CCAGCTAATAACTCAAGAACAGG - Intergenic
1115225230 14:31095417-31095439 CCAAAAAACAAACAAAAAACGGG - Intronic
1115620108 14:35132780-35132802 CCATCAAAAAAAAAAAAAAAAGG + Intronic
1115673107 14:35638584-35638606 CAAGAAAATAAATAATAAAGTGG + Intronic
1115711131 14:36052211-36052233 TCTGCAAATAAGTAAAAATCAGG + Intergenic
1115828450 14:37305769-37305791 CCAGGAAAAAAATATATAACTGG - Intronic
1115861427 14:37690333-37690355 CCAGAAAACAAATAACAAAATGG + Intronic
1115862751 14:37707125-37707147 CATGCAAATAAATGAAAAACAGG - Intronic
1116045998 14:39743118-39743140 CCAGAAAACAAATAACAAAATGG - Intergenic
1116085645 14:40234454-40234476 CCAGAAAATAAATAACAAAATGG - Intergenic
1116086876 14:40252260-40252282 CCAGAAAACAAATAACAAAATGG - Intergenic
1116121596 14:40727878-40727900 CCAGAAAACAAATAAAAAAATGG - Intergenic
1116196006 14:41725860-41725882 AAAGCAAATAAATATAAAATTGG - Intronic
1116220675 14:42083305-42083327 CCAGTAAACAAATAACAAAATGG - Intergenic
1116257618 14:42577143-42577165 ACAACAAAAAAAAAAAAAACCGG + Intergenic
1116481426 14:45395445-45395467 CCAGAAAACAAATAATAAAATGG + Intergenic
1116529599 14:45952954-45952976 CTTCCAAATAAATAAAAAAGTGG - Intergenic
1116826586 14:49678519-49678541 TAAGTAAATAAATAAATAACAGG + Intronic
1116860341 14:49990465-49990487 CAAACAAACAAACAAAAAACAGG + Intronic
1116889355 14:50252383-50252405 CCAGAAAACAAATAACAAAATGG + Intronic
1116930457 14:50685609-50685631 CCAGAAAACAAATAAGAAAATGG - Intergenic
1117036564 14:51735699-51735721 CAAGTAAAAAAATAGAAAACTGG + Intergenic
1117074301 14:52086608-52086630 ACATAAAATAAATAAAAAAGAGG - Intergenic
1117159091 14:52970954-52970976 CCAGAAAACAAATAACAAAATGG - Intergenic
1117482827 14:56166011-56166033 CCACAAAATAAATAACAAAATGG - Intronic
1117585794 14:57201881-57201903 TCTGCAAATAAATAAATAAGGGG + Exonic
1117795174 14:59386125-59386147 CCAGAAAACAAATAACAAAAAGG - Intergenic
1117917910 14:60697630-60697652 GCAACAAATAAATAAATAAATGG - Intergenic
1117929749 14:60828780-60828802 CCAGCAAATAATTGAACCACAGG - Intronic
1117937569 14:60924233-60924255 CAAACAAACAAACAAAAAACAGG - Intronic
1118050825 14:62025607-62025629 CCATGAAATAAATAATAAATTGG - Intronic
1118099106 14:62575244-62575266 CCAGAAAACAAATAACAAAATGG + Intergenic
1118373478 14:65157267-65157289 CCAGCTAAAAAAAAAAAAAAAGG - Intergenic
1118430961 14:65718097-65718119 CCAGAAAACAAATAACAAAATGG - Intronic
1118926183 14:70191669-70191691 CAAGCAAACAAATAAAATTCTGG - Intergenic
1119363064 14:74067930-74067952 CAAACAAACAAACAAAAAACAGG + Intronic
1119693270 14:76693154-76693176 ACAGCAAAAAAATCAAAAATAGG - Intergenic
1119865790 14:77972771-77972793 CAAACAAACAAACAAAAAACAGG + Intergenic
1119939171 14:78622403-78622425 CAAACAAACAAACAAAAAACAGG - Intronic
1119977830 14:79045137-79045159 CAAACAAATAAACAGAAAACGGG - Intronic
1120134489 14:80849719-80849741 CCAACAACTAAAGAAAAAATAGG + Intronic
1120141548 14:80935183-80935205 CAAACAAACAAATGAAAAACAGG + Intronic
1120340468 14:83214822-83214844 CCAGAAAACAAATAATAAAATGG - Intergenic
1120418305 14:84248672-84248694 CAAACAAATAAATAAAAATAAGG - Intergenic
1120473007 14:84950517-84950539 TATGCAAATAAAAAAAAAACAGG + Intergenic
1120781766 14:88492051-88492073 CAAACAAACAAACAAAAAACAGG + Intronic
1121057026 14:90864516-90864538 TTAGCAATTAAATAAAAGACTGG + Exonic
1121400398 14:93671469-93671491 ACAGTAAAAAAACAAAAAACAGG + Intronic
1121745669 14:96288804-96288826 CCAGAAAAAAAAAAAAAAACAGG + Intronic
1121799370 14:96760964-96760986 AAAGCAAACAAACAAAAAACAGG - Intergenic
1122084840 14:99292440-99292462 CCACCAAAAAAAAAAAAAATAGG + Intergenic
1122313169 14:100810173-100810195 CCATTAAAAAAAAAAAAAACAGG - Intergenic
1122619072 14:103043257-103043279 ACACCAAATAAATAAACAAAAGG + Intronic
1123001264 14:105295780-105295802 CCAGAAAAAAAAAAAAAAGCTGG + Intronic
1123191300 14:106574917-106574939 CAAGCAAATAAATAAATCACTGG - Intergenic
1123471682 15:20559613-20559635 CCACCAAACAAAAAGAAAACGGG - Intergenic
1123646323 15:22440740-22440762 CCACCAAACAAAAAGAAAACGGG + Intergenic
1123731985 15:23154598-23154620 CCACCAAACAAAAAGAAAACGGG - Intergenic
1123750121 15:23351980-23352002 CCACCAAACAAAAAGAAAACGGG - Intergenic
1124097179 15:26659537-26659559 TAAGTAAATAAATAAATAACAGG + Intronic
1124282489 15:28375898-28375920 CCACCAAACAAAAAGAAAACGGG - Intergenic
1124300214 15:28535707-28535729 CCACCAAACAAAAAGAAAACGGG + Intergenic
1124401777 15:29354815-29354837 ACTGCAAAAAAAGAAAAAACTGG + Intronic
1124469501 15:29970329-29970351 GCAGCAAAGAAATAAAAAAATGG - Intergenic
1124702336 15:31926981-31927003 AAAGCAAACAAATAAAAAAATGG - Intergenic
1124712386 15:32025918-32025940 CCTACAAATAAATAAGAAAAAGG + Intergenic
1124923170 15:34046339-34046361 GCAGGAAAAAAAAAAAAAACGGG + Intronic
1125036120 15:35125855-35125877 CAAGTAAAAAAAAAAAAAACTGG - Intergenic
1125075899 15:35617949-35617971 CAAGCAAATAATTTAAAAAATGG + Intergenic
1125821113 15:42632460-42632482 CCAGAAAACAAATAACAAAATGG - Intronic
1125962997 15:43848074-43848096 CAAACAAACAAAAAAAAAACTGG + Intronic
1126184909 15:45822404-45822426 CCAGAAAACAAATAACAAAATGG + Intergenic
1126247119 15:46520314-46520336 CCAGAAAACAAATAACAAAATGG + Intergenic
1126488821 15:49213715-49213737 CCAGAAAATAAATAACAAAATGG - Intronic
1126575013 15:50187965-50187987 CCACCAAAAAAAAAAAAAAAAGG + Intronic
1126603665 15:50454302-50454324 CCAGCAAGAAAATAAAAATGAGG - Intronic
1126874597 15:53026825-53026847 GCAGAAAATAAATAACAAAATGG - Intergenic
1126990457 15:54369345-54369367 TCAGCAAGTAAATAAACAAAAGG - Intronic
1127035400 15:54910777-54910799 CCAGAAAACAAATAACAAAATGG + Intergenic
1127132888 15:55885804-55885826 CCAGAAAACAAATAACAAAATGG + Intronic
1127268807 15:57382570-57382592 CCAGCAAAGAGATAAGTAACAGG - Intronic
1127799308 15:62463898-62463920 CAAACAAACAAATAAAAACCAGG + Intronic
1127910144 15:63410174-63410196 CAAACAAACAAACAAAAAACAGG - Intergenic
1128131759 15:65232753-65232775 CAAATAAATAAATAAAAAATGGG + Intergenic
1128148749 15:65347969-65347991 CAAACAAACAAACAAAAAACAGG + Intronic
1128633242 15:69285867-69285889 CCAGCAAATTAATCAAACCCAGG + Intergenic
1128647889 15:69390314-69390336 TAAATAAATAAATAAAAAACAGG - Intronic
1129280517 15:74481264-74481286 CCAATAAATAAATAAATAAATGG + Intergenic
1129546573 15:76402150-76402172 CAAACAAACAAACAAAAAACAGG + Intronic
1129642663 15:77396375-77396397 CCAGGAAACAAATAAAAATATGG + Intronic
1129736142 15:77965737-77965759 CCAGAAAACAAATAACAAAATGG + Intergenic
1129902624 15:79163248-79163270 CCAACAAACAAATAAGAAAGTGG - Intergenic
1130003401 15:80068125-80068147 CAAACAAAAAAAAAAAAAACAGG - Intronic
1130040331 15:80401007-80401029 AAAACAAATAAACAAAAAACCGG + Intronic
1130076180 15:80692573-80692595 TAAGCAAATAAATAAAAGCCTGG - Intronic
1130383472 15:83391872-83391894 CCAGCTGATAAATATAAGACAGG - Intergenic
1130419371 15:83728386-83728408 CCAGAAAACAAATAACAAAATGG - Intronic
1130643737 15:85704694-85704716 CTATCAAATAAATAAATAAAAGG + Intronic
1130876168 15:88016663-88016685 CCAGCTAATAAATAAATGACAGG - Intronic
1130962032 15:88666547-88666569 CCAGAAAATAAATAACAAAATGG + Intergenic
1131130420 15:89895873-89895895 CAAACAAACAAACAAAAAACTGG - Exonic
1131201934 15:90405738-90405760 CCAGAAAAAAAAAAAAAACCTGG - Intronic
1131302463 15:91211506-91211528 CCAACAAAAAAAAAAAAAAAAGG - Intronic
1131488546 15:92842270-92842292 CAAACAAACAAACAAAAAACGGG - Intergenic
1131514272 15:93066686-93066708 CTACCAAAAATATAAAAAACCGG - Intronic
1131602071 15:93859949-93859971 CCAGAAAAAAAAAAAAAAAAGGG - Intergenic
1131698564 15:94907587-94907609 CCAACAAATATATGAAAAAATGG - Intergenic
1131722892 15:95189850-95189872 CCATCAAATATACAAAGAACTGG - Intergenic
1131733267 15:95304479-95304501 CTAGAAAATAAATAAATAAAGGG + Intergenic
1131762712 15:95641787-95641809 CCTTAAAACAAATAAAAAACAGG - Intergenic
1131830270 15:96350209-96350231 TCAGGAAATAAAGAAAATACAGG - Intergenic
1132776142 16:1595304-1595326 CAAACAAATAAATAAAATAAAGG + Intronic
1132901846 16:2260486-2260508 ACAGAACACAAATAAAAAACCGG + Intronic
1133137005 16:3719063-3719085 CAAACAAACAAACAAAAAACAGG + Intergenic
1133144803 16:3776710-3776732 CCATTAAAAAAATAAAAAGCTGG + Intronic
1133948948 16:10373689-10373711 CTAGCAAAAAAAAAAAAAAAAGG - Intronic
1133962819 16:10509500-10509522 CAAACAAACAAACAAAAAACAGG + Intergenic
1134167672 16:11943336-11943358 CAAACAAACAAACAAAAAACAGG + Intronic
1134503174 16:14784942-14784964 CAAACAAACAAACAAAAAACAGG - Intronic
1134577391 16:15343956-15343978 CAAACAAACAAACAAAAAACAGG + Intergenic
1134660214 16:15978387-15978409 CAAACAAATAAACAAAAAACAGG + Intronic
1134664496 16:16008928-16008950 ACAACAAAAAAAAAAAAAACAGG - Intronic
1135298884 16:21307742-21307764 CCAAAAGATAAATAACAAACTGG - Intergenic
1135706650 16:24680709-24680731 CCATCAAAAAAAAAAAAAAAAGG + Intergenic
1135749491 16:25045535-25045557 CCAATAAATAAACAAAAATCAGG - Intergenic
1135969338 16:27060913-27060935 CAAACAAACAAACAAAAAACAGG - Intergenic
1136346159 16:29677512-29677534 CCATCAAAAAAAAAAAAAAAAGG + Intronic
1137257437 16:46787905-46787927 CCAGAAAAAAAAAAAAAAAAAGG + Intronic
1137554573 16:49462355-49462377 CCAACAAAAAAAAAAAAAAAGGG + Intergenic
1137682456 16:50361939-50361961 GCAGCACATAAATAAAAATTGGG + Intronic
1137991615 16:53162782-53162804 CCACCAAAAAAAAAAAAAAAAGG - Intronic
1138020733 16:53478544-53478566 CTAGCAAAAAAAAAAAAAAAAGG - Intronic
1138085529 16:54130365-54130387 CCCACAAATCAATAAAAAAAAGG - Intergenic
1138405726 16:56792195-56792217 CAAACAAAAAAACAAAAAACTGG + Intronic
1138574614 16:57899655-57899677 CAAACAAATAAATAAATAAGGGG + Intronic
1138739026 16:59286086-59286108 CCAACAAGTAGATAAAAAAATGG + Intergenic
1138820853 16:60257706-60257728 CAAACAAAGAAACAAAAAACAGG - Intergenic
1138824889 16:60307154-60307176 TTAGCAAATATATAAAAATCTGG + Intergenic
1138850597 16:60624699-60624721 CCAGAAAACAAATTAAAAAGTGG + Intergenic
1139056790 16:63195382-63195404 TCAGTGGATAAATAAAAAACTGG - Intergenic
1139398947 16:66664782-66664804 ACAGAAAATAAATAACAAAATGG + Intronic
1139857453 16:69992092-69992114 CAAACAAACAAACAAAAAACGGG + Intergenic
1140073717 16:71676706-71676728 CCAGAATAAAAATAAAAAATAGG + Intronic
1140078751 16:71724509-71724531 CTTGCAAATAAATCATAAACCGG - Exonic
1140203940 16:72918205-72918227 CAAGCAAATAAGTCAAAAGCAGG + Intronic
1140543604 16:75784332-75784354 GAAGCAAATAAATAAATAAATGG - Intergenic
1140646395 16:77036007-77036029 CCAGAAAAAAAATAACAAAATGG - Intergenic
1141038142 16:80646388-80646410 CCAGAAAACAAATAACAAAATGG + Intronic
1141113185 16:81287082-81287104 CAAACAAACAAACAAAAAACTGG + Intronic
1141327805 16:83078766-83078788 CAAACAAACAAACAAAAAACTGG - Intronic
1141499744 16:84435826-84435848 CAAAAAAAAAAATAAAAAACAGG + Intronic
1141765674 16:86058245-86058267 CCAGCAAATATATGAAACAGTGG + Intergenic
1142938152 17:3355844-3355866 CCAGAAAACAAATAACAAAAAGG - Intergenic
1143006951 17:3843242-3843264 CCAACAAAAAAAAAAAAAAAAGG - Intronic
1143677159 17:8442758-8442780 AAAGTAAATAAATAAAAACCTGG - Intronic
1144406394 17:14956625-14956647 CAAACAAACAAACAAAAAACTGG - Intergenic
1145015761 17:19397181-19397203 CAAACAAACAAACAAAAAACAGG - Intergenic
1145054027 17:19686407-19686429 CCATAAAATAAATAATAAAATGG + Intronic
1145069427 17:19790609-19790631 CCAGAAAACAAATAACAAAATGG + Intronic
1145854622 17:28142193-28142215 CCAGAAAAAAAAGAAAAAAGCGG - Intronic
1146615301 17:34351821-34351843 CCAGAAAACAAATAACAAAATGG + Intergenic
1146806527 17:35869189-35869211 CAAACAAATAAATAAATAAAGGG - Intergenic
1146975748 17:37110065-37110087 CCAGCAAAAAGAAAAAAAAAAGG + Intronic
1147336840 17:39731224-39731246 CAAACAAACAAACAAAAAACTGG - Intergenic
1147368561 17:39975442-39975464 CCATCAAAAAAAAAAAAAATTGG + Intronic
1147983014 17:44286536-44286558 CAAACAAACAAACAAAAAACCGG + Intergenic
1148285477 17:46386861-46386883 CCAGTAATTAAATATAAAAGTGG + Intergenic
1148295373 17:46497325-46497347 CCAGAAAACAAATAATAAAAAGG - Intergenic
1148307640 17:46604461-46604483 CCAGTAATTAAATATAAAAGTGG + Intronic
1148443753 17:47725612-47725634 CCATCAAATGATTAAAAAATAGG - Intergenic
1148585882 17:48779635-48779657 CAACCAAACAAACAAAAAACTGG + Intronic
1149111032 17:53030978-53031000 CCAGAAAACAAATAACAAAATGG - Intergenic
1149169292 17:53791302-53791324 CAAACAAACAAACAAAAAACAGG + Intergenic
1149200581 17:54181420-54181442 CCAATGAATAAATAAAAATCAGG + Intergenic
1149487315 17:57052870-57052892 CCACCAAAAAAAAAAAAAAAAGG + Intergenic
1149856774 17:60089370-60089392 CCTGCAAAAAAAAAAACAACGGG - Intergenic
1149982421 17:61321916-61321938 CAAACAAACAAACAAAAAACGGG - Intronic
1150186620 17:63188585-63188607 CCAAAAAAAAAAAAAAAAACTGG + Intronic
1150253939 17:63729040-63729062 GAAGTAAATAAATAAAAAGCAGG - Intronic
1150407225 17:64912612-64912634 CCAGAAAACAAATAATAAAAAGG + Intronic
1150504723 17:65686861-65686883 CTAGCAAATAAAAAAAAAACTGG - Intronic
1150527013 17:65934498-65934520 CCAGAAAATAAATTACAAAATGG + Intronic
1150621120 17:66808319-66808341 CCAGCAAAAAAAAAAAAAACAGG - Exonic
1150678198 17:67263049-67263071 CAAACAAACAAACAAAAAACAGG - Intergenic
1150862859 17:68819035-68819057 CCAGGAAAAAAAAAAAAAAAAGG - Intergenic
1151539135 17:74755953-74755975 CCTCCAAAAAAAAAAAAAACAGG - Intronic
1151900091 17:77006632-77006654 CAAACAAATAAATAAATAAAGGG - Intergenic
1152322926 17:79618399-79618421 CCAGAAAACAAATTAAAAATAGG + Intergenic
1152607165 17:81297639-81297661 CAAAAAAATAAATAAAAGACTGG + Intergenic
1152653483 17:81508143-81508165 TCAGCTAATAAAAAAAAAATTGG + Intergenic
1152909602 17:82993078-82993100 CCAGAAAACAAATAACAAAATGG + Intronic
1153269989 18:3311079-3311101 CGAACAAACAAAAAAAAAACAGG - Intergenic
1153388644 18:4529896-4529918 CCAGTAAACAAATAACAAAATGG - Intergenic
1153454761 18:5268569-5268591 CCAGAAAACAAATAACAAAATGG + Intergenic
1153556280 18:6316975-6316997 CCAGTAAATAAATAAAATACTGG + Intronic
1153698460 18:7668067-7668089 CCACCATAAAAATAAAAAACGGG - Intronic
1153714708 18:7836127-7836149 CCAGAAAACAAATAACAAAATGG - Intronic
1154055613 18:11010602-11010624 CAAACAAACAAACAAAAAACAGG - Intronic
1154097766 18:11434235-11434257 CCAACCAATAAATAAAAATCTGG + Intergenic
1154363489 18:13685292-13685314 CCACCAAAAAAAAAAAAAAATGG - Intronic
1155027082 18:21950983-21951005 ACAGAAAACAAATAATAAACTGG - Intergenic
1155065131 18:22262773-22262795 CCGGCAAATATGGAAAAAACAGG - Intergenic
1155099776 18:22599133-22599155 ACTGCAAATAATGAAAAAACTGG - Intergenic
1155290172 18:24332568-24332590 ACAGCAAAAAAAAAAAAAAAAGG + Intronic
1155325024 18:24656528-24656550 ACAACAAATAAATAAATAAAGGG - Intergenic
1155597578 18:27505277-27505299 CCAGAAAACAAATAACAAAATGG + Intergenic
1155620264 18:27770109-27770131 AAAACAAATAAATAAAAACCAGG - Intergenic
1155681974 18:28499107-28499129 ACAGAAAATAAATAACAAAATGG - Intergenic
1155737328 18:29239935-29239957 ACTGCAAAAAAATAAAAAAATGG + Intergenic
1155776664 18:29771765-29771787 CAAACAAACAAAGAAAAAACAGG + Intergenic
1155824975 18:30429746-30429768 CCAGAAAACAAATAACAAAATGG + Intergenic
1156025764 18:32653043-32653065 CCAGAAAACAAATAACAAAATGG - Intergenic
1156148687 18:34218385-34218407 CCAACGGAAAAATAAAAAACTGG + Intronic
1156181072 18:34605112-34605134 CCAGCAAAAAAAAAAAAATCTGG + Intronic
1156320875 18:36020662-36020684 TCTGCAAAAAAATAAAAAATTGG + Intronic
1156732273 18:40208303-40208325 ACAGAAAATAGATATAAAACAGG + Intergenic
1157215800 18:45782500-45782522 CCAGCAAATAACTACCAATCAGG - Intergenic
1157986615 18:52445906-52445928 CAAACAAACAAACAAAAAACTGG - Intronic
1158283370 18:55851896-55851918 CAGGCAAAAAAATAAAAAAGTGG - Intergenic
1158390039 18:57037483-57037505 CAAACAAACAAACAAAAAACTGG - Intergenic
1158431578 18:57392358-57392380 CCAGAAAACAAATAACAAAATGG + Intergenic
1158434342 18:57424879-57424901 CAAACAAACAAACAAAAAACAGG + Intergenic
1158523692 18:58193845-58193867 CCAGGAAATAAATTTAAAAAGGG - Intronic
1158653113 18:59305368-59305390 CAAACAAACAAACAAAAAACAGG + Intronic
1158704548 18:59780194-59780216 CCAGAAAAAAAAAAAAAAAGTGG + Intergenic
1158947723 18:62462222-62462244 TCAGAAAAAAAATAAAAAAAAGG - Intergenic
1159125994 18:64225374-64225396 TCTGCAAATGAATAAAAAACTGG + Intergenic
1159528504 18:69625814-69625836 CAAACAAACAAACAAAAAACTGG - Intronic
1159736360 18:72103281-72103303 CAAACAAACAAACAAAAAACCGG + Intergenic
1159744496 18:72214173-72214195 ACAGCAAAAAAAAAAAAAAGTGG - Intergenic
1159896253 18:73999268-73999290 CCAGAAAACAAATAACAAAATGG - Intergenic
1160935242 19:1591694-1591716 CCAGGAAAAAAAAAAAAAAGAGG + Intronic
1161814733 19:6493081-6493103 CAAACAAACAAACAAAAAACAGG + Intergenic
1162541370 19:11298432-11298454 CCCGCAAAAAAAAAAAAAATAGG - Intronic
1162666484 19:12217613-12217635 CCAGAAAACAAATAACAAAATGG - Intergenic
1162692438 19:12444926-12444948 CCAGAAAACAAATAACAAAATGG - Intronic
1163121905 19:15223391-15223413 CCAGAAAAAAAAAAAAAAAACGG + Intergenic
1163333517 19:16656909-16656931 ACAACAAAAAAACAAAAAACAGG + Intronic
1163574958 19:18105372-18105394 CAAACAAACAAACAAAAAACTGG + Intronic
1163680763 19:18680965-18680987 CAAACAAACAAACAAAAAACAGG - Intergenic
1163955848 19:20638870-20638892 TCAGAAAAAAAATAAGAAACAGG + Intronic
1164119208 19:22250581-22250603 CAAACAAACAAACAAAAAACAGG - Intergenic
1164299841 19:23952193-23952215 CCATCAGATACATAAGAAACTGG + Intergenic
1164547098 19:29175858-29175880 CCAGAAAACAAATAACAAAATGG + Intergenic
1164846286 19:31435650-31435672 CCTGCATATCAATTAAAAACAGG - Intergenic
1165083667 19:33327557-33327579 CAAGCAAAAAAAAAAAAAATGGG - Intergenic
1165171923 19:33899170-33899192 CAAGAGAATAAATAGAAAACAGG - Intergenic
1165707877 19:37989209-37989231 CAAACAAACAAACAAAAAACAGG - Intronic
1165756335 19:38295383-38295405 CAAAAAAATAAATAAAAAACAGG + Intronic
1165844797 19:38811323-38811345 ACAATAAATAAATAAACAACAGG + Intronic
1165964097 19:39559962-39559984 CAAACAAAGAAAAAAAAAACAGG + Intergenic
1166838370 19:45681511-45681533 CAAACAAACAAACAAAAAACGGG + Intronic
1167260071 19:48453334-48453356 CAAACAAACAAACAAAAAACTGG - Exonic
1167438670 19:49495605-49495627 CAAACAAACAAACAAAAAACGGG - Intergenic
1167460586 19:49622589-49622611 CCAAAAAAGAAAAAAAAAACAGG + Intronic
1167492455 19:49800443-49800465 CAAACAAACAAACAAAAAACAGG - Intronic
1167837206 19:52083692-52083714 TAAGCAAACAAGTAAAAAACAGG - Intronic
1167957635 19:53079656-53079678 GCAGCAAAAAAAAAAAAAAAGGG + Intronic
1168079239 19:53997419-53997441 CCAGAAAAAAAAAACAAAACAGG - Intronic
1168334283 19:55588277-55588299 CAAACAAACAAACAAAAAACCGG - Intergenic
1168349061 19:55665637-55665659 ACAACAAAAAAACAAAAAACAGG - Intronic
1168467499 19:56615555-56615577 ACAGAAAAAAAAAAAAAAACAGG - Intronic
1168609698 19:57789314-57789336 GCTACAAATAAATAATAAACAGG - Intronic
925206822 2:2014193-2014215 TCAGGAAAAAAAAAAAAAACAGG - Intronic
925249371 2:2418991-2419013 CCAGAAAACAAATAACAAAATGG - Intergenic
925529780 2:4846297-4846319 CCAGCAAACAAACCAAAAAAAGG + Intergenic
925530409 2:4853980-4854002 CCAGCAAAGAATTAGAAAATTGG + Intergenic
925534481 2:4901499-4901521 CTACCAAAGAAAAAAAAAACCGG + Intergenic
925816319 2:7754434-7754456 CAAGTAAATGATTAAAAAACTGG + Intergenic
926268620 2:11347478-11347500 CCAATAAATAAATAAATAACAGG - Intronic
926338258 2:11881070-11881092 CCTGCAAAAAAAAAAAAAACAGG - Intergenic
926379530 2:12272022-12272044 ACAAAAAATAAATAAAAAACTGG - Intergenic
926452531 2:13023391-13023413 TGAGCAAATATATAAAAAAAAGG + Intergenic
926514134 2:13819969-13819991 CAAGCAAACAAACAGAAAACAGG - Intergenic
926531080 2:14046372-14046394 TCAGCATATAAATAGAAAAAGGG - Intergenic
926939269 2:18118005-18118027 CAACCAAAAAAATAAAAAAATGG - Intronic
927022533 2:19032141-19032163 CGAGAAAATAAAAAAAATACTGG - Intergenic
927343231 2:22006595-22006617 CCAGGAAATCAATAAACAAAAGG + Intergenic
927538950 2:23889912-23889934 CCATCTAAAAAACAAAAAACAGG + Intronic
927568185 2:24133142-24133164 CAGGCAAGTTAATAAAAAACTGG + Intronic
927618613 2:24627100-24627122 ACAGCAAAAAACAAAAAAACAGG - Intronic
928264426 2:29799522-29799544 CAAACAAACAAACAAAAAACAGG + Intronic
928464351 2:31507466-31507488 CAACCAAATAAATAATAAATTGG + Intergenic
928518773 2:32067755-32067777 CTAGCAAAAAAAAAAAAAAGAGG - Intronic
928803128 2:35118142-35118164 CCAGAAAACAAATAACAAAGTGG + Intergenic
928814080 2:35268658-35268680 CCAGAAAACAAATTGAAAACAGG - Intergenic
928831370 2:35489236-35489258 CTAAAAAATAAATAAATAACTGG + Intergenic
928851777 2:35757047-35757069 CCAGAAAACAAATAACAAAATGG - Intergenic
928863736 2:35893190-35893212 CCAGAAAACAAATAACAAAATGG - Intergenic
929494558 2:42429138-42429160 CAAACAAACAAAAAAAAAACAGG + Intergenic
929541069 2:42822546-42822568 CCAGAAAACAAATAACAAAATGG - Intergenic
929641426 2:43583876-43583898 CTACCAAAAATATAAAAAACAGG + Intronic
929737938 2:44570732-44570754 AAAGCAAACGAATAAAAAACAGG + Intronic
929781542 2:44960486-44960508 CTAGCATTTAATTAAAAAACAGG + Intergenic
930141800 2:47958431-47958453 CCAGAAAACAAATAACAAAACGG + Intergenic
930545728 2:52765397-52765419 CCAGGACATATATATAAAACTGG + Intergenic
930561923 2:52970166-52970188 CAAACAAACAAACAAAAAACAGG + Intergenic
930653564 2:53986339-53986361 CCATCAAAAAAAAAAAAAAGAGG - Intronic
931251126 2:60531305-60531327 CCAGAAAATAAATTAAATACTGG + Intronic
931263775 2:60642408-60642430 CCAGGAAATAAAAGGAAAACTGG - Intergenic
931395282 2:61882805-61882827 CCAGAAAAAAAAAAAAAAGCTGG - Intronic
931406629 2:61985504-61985526 CCAGAAAACAAATAACAAAGTGG - Intronic
931410451 2:62025230-62025252 CAAACAAATAAAAAAAAACCAGG + Intronic
931457127 2:62419210-62419232 CCAGAAAATAAATAACAAAGTGG + Intergenic
932112728 2:69015268-69015290 TTAGCAAAAAAAAAAAAAACAGG + Intronic
932242701 2:70170057-70170079 CTTGTCAATAAATAAAAAACAGG - Intronic
932505274 2:72223679-72223701 CAAACAAACAAACAAAAAACAGG - Intronic
932762004 2:74444061-74444083 CAAACAAACAAACAAAAAACAGG + Intergenic
933128203 2:78637347-78637369 ACAGCCAATAAATAACCAACAGG - Intergenic
933341434 2:81031247-81031269 CCAGAAAACAAATAACAAAATGG - Intergenic
933424932 2:82098723-82098745 CCAGAAAATAAACAAAAATAAGG - Intergenic
933583423 2:84152970-84152992 CCAGCAAATAAATGTGAAAGTGG - Intergenic
933601231 2:84332833-84332855 CCACAAAATAAATAACAAAATGG + Intergenic
934942676 2:98513903-98513925 CCAGCAAATAAGAGAACAACGGG - Intronic
934943953 2:98522763-98522785 CCAGAAAGAAAAAAAAAAACAGG + Intronic
935256669 2:101315624-101315646 TAAACAAATAAACAAAAAACAGG - Intergenic
935437646 2:103053730-103053752 CTAGAAAATAAATAACAAAATGG - Intergenic
935532830 2:104255663-104255685 CCAGAAAATAAATAACAAAATGG + Intergenic
935633647 2:105232830-105232852 CAAACAAACAAAAAAAAAACCGG + Intergenic
935962166 2:108436412-108436434 CCATCAAAAAAAAAAAAAAAAGG + Intergenic
935970532 2:108526977-108526999 ACAGCAAAAAAAAAAAAAAAAGG + Intergenic
936103444 2:109603777-109603799 CTAGCAAATAAAGACAAGACAGG + Intronic
936418061 2:112337620-112337642 CAAAAAAATAAATAAAAAACAGG - Exonic
936510972 2:113146520-113146542 CCAGAAAACAAATAACAAAATGG - Intergenic
937145094 2:119637692-119637714 CTGGAAAATTAATAAAAAACAGG + Intronic
937199411 2:120189080-120189102 CAAGAAAAAAAAAAAAAAACTGG + Intergenic
937384191 2:121412285-121412307 CCAGCAAATGCATTAAAAAAGGG - Intronic
937512717 2:122614289-122614311 CCAGAAAACAAATAACAAAATGG + Intergenic
937829226 2:126401717-126401739 CCAGCAATTAAAAAAAAAAAAGG + Intergenic
937910808 2:127074693-127074715 CAAACAAACAAACAAAAAACAGG - Intronic
938032643 2:128008682-128008704 CCACCAAAAAAAAAACAAACAGG - Intronic
938053016 2:128192263-128192285 CCAAAAAAAAAAAAAAAAACTGG - Exonic
938417074 2:131112420-131112442 CTAGCAAATTAATCAAACACAGG + Intronic
938743544 2:134255095-134255117 CCAGCCAATAAATATGACACTGG + Intronic
938798169 2:134735896-134735918 CCAGCAAATTAAAAAAACATTGG - Intergenic
938874181 2:135516098-135516120 CCAAAAAAAAAAGAAAAAACAGG - Intronic
939065816 2:137482183-137482205 CCACCAAAAAAAAAAAAAAAAGG + Intronic
939410050 2:141813591-141813613 CAAACAAACAAACAAAAAACAGG + Intronic
939558353 2:143704004-143704026 CCAGGAAAAAAAAAAAAAAAAGG + Intronic
939648132 2:144727129-144727151 CAACCAAATAAAATAAAAACAGG + Intergenic
939707620 2:145475253-145475275 CCAGAAAACAAATAACAAAATGG - Intergenic
939930225 2:148225101-148225123 CCAGAAAACAAATAACAAAATGG - Intronic
940078140 2:149767251-149767273 GCAGCAAATAAATAAAATGAAGG - Intergenic
940141291 2:150493702-150493724 CCACCAAAAGAATAATAAACTGG - Intronic
940393852 2:153164834-153164856 CCATCAAAAAATTAAAATACAGG - Intergenic
940445880 2:153777026-153777048 CAAACAAACAAACAAAAAACAGG - Intergenic
940707329 2:157121940-157121962 CAAACAACTCAATAAAAAACAGG + Intergenic
940778428 2:157907993-157908015 CCATCAAAAAAAAAAAAAAAAGG + Intronic
941174063 2:162175622-162175644 AAAGGAAATAAATACAAAACAGG + Intronic
941291603 2:163682514-163682536 CCAGAAAATAATTACAGAACAGG + Intronic
941438299 2:165500038-165500060 TCACCAAAAAAAAAAAAAACAGG + Intronic
941518483 2:166509400-166509422 CAAGCAAATGAACAAAAAACAGG - Intergenic
941840316 2:170075910-170075932 ACAGAAAAAAAAAAAAAAACAGG + Intronic
942001305 2:171650373-171650395 CCAGAAAACAAATAACAAAATGG - Intergenic
942560603 2:177214413-177214435 CAAGCAAATTAATTTAAAACAGG - Intronic
942581114 2:177417946-177417968 CCAGGTGTTAAATAAAAAACAGG - Intronic
942769363 2:179497677-179497699 CCAGAAAACACATAAAAAAATGG + Intronic
942882249 2:180874694-180874716 CCAGAAAACAAATAACAAAATGG + Intergenic
942972043 2:181968727-181968749 CCAGAAAACAAATAATAAAATGG - Intronic
943009197 2:182426075-182426097 CCAGCAGTTAAAGAAACAACAGG - Intronic
943190366 2:184670373-184670395 CCAGAAAAAAAATAAAATAAAGG - Intronic
943219993 2:185091775-185091797 GCAAAAAATAAATAAAAAATCGG + Intergenic
943393090 2:187295521-187295543 CCAGCAAATAAACACAGAACTGG - Intergenic
943485245 2:188471398-188471420 CCAGAAAACAAATAATAAAACGG - Intronic
943561764 2:189472486-189472508 CCAGAAAACAAACAAAAAATAGG - Intronic
943609877 2:190019493-190019515 CCAGCCAATACATAATACACTGG - Intronic
943801767 2:192068970-192068992 CCAGAAGAAAAAAAAAAAACAGG - Intronic
943843859 2:192615396-192615418 CCAGGAAAAAAAAAAAAAAAAGG + Intergenic
943913356 2:193596170-193596192 CCAGAAAACAAATAACAAAATGG + Intergenic
943923527 2:193740883-193740905 CCAGAAAATAAATAACAAAATGG + Intergenic
944134153 2:196379894-196379916 CCAGCAAAAAAAAAAAAAAAAGG + Intronic
944751767 2:202716413-202716435 CCAGAAAACAAATAACAAAATGG - Intronic
944955539 2:204803813-204803835 CCAGAAAACAAATAACAAAATGG + Intronic
944990268 2:205227715-205227737 CCAGAAAACAAATAACAAAATGG - Intronic
945334399 2:208574606-208574628 CCAGAAAACAAATAATAAAATGG + Intronic
945373632 2:209052352-209052374 CAACCCAATAAATAAAATACTGG + Intergenic
945454123 2:210029461-210029483 CAAACAAACAAACAAAAAACAGG + Intronic
945499530 2:210553910-210553932 ACAGCCAATAAATAAAATAGTGG - Intronic
945626870 2:212219951-212219973 CCCGCAAAAAAAAAAAAAAGTGG + Intronic
945652228 2:212576944-212576966 CCAGAAAACAAATAACAAAATGG + Intergenic
945810052 2:214537900-214537922 CCACCAAAAAAAAAAAAAAAAGG - Intronic
946513798 2:220389322-220389344 CCAGAAAACAAATAACAAAATGG - Intergenic
947008919 2:225544320-225544342 CCAGAAAATGAATAACAAAATGG - Intronic
947130798 2:226922647-226922669 CCAGAAAACAAATAACAAAATGG - Intronic
947717538 2:232349429-232349451 CCAGGAAATACAGAAAAAATGGG + Intergenic
948558037 2:238830446-238830468 ATAGCAAATAAATAAATAAATGG + Intergenic
948774916 2:240280257-240280279 CCAGGAAACAAATAACAAAATGG + Intergenic
1168743752 20:218310-218332 CAAACAAACAAAAAAAAAACAGG - Intergenic
1168899716 20:1352702-1352724 CCAGAAAACAAATAACAAAATGG - Intronic
1169025762 20:2369961-2369983 CAAGCAAACAAATAAAAAACTGG + Intergenic
1169498690 20:6138722-6138744 CAAACAAACAAACAAAAAACTGG + Intergenic
1169624145 20:7543315-7543337 GCAGAAAATAAATAACAAAATGG + Intergenic
1169988960 20:11477645-11477667 CCAGAAAACAAATAACAAAGTGG + Intergenic
1170159916 20:13300396-13300418 CCAATAAATAAATATAAAAGGGG + Exonic
1170236291 20:14108365-14108387 CCAGAAAACAAATAACAAAATGG + Intronic
1170427567 20:16250448-16250470 CCTACAAATAAATAGAAAAATGG - Intergenic
1170903468 20:20488773-20488795 CCAGTAAATAAGTAAATAAATGG - Intronic
1171119327 20:22555039-22555061 CAAGCAAACAAACAAAAAAACGG + Intergenic
1171140501 20:22736951-22736973 CAAGCAAATAAAAAAAAAGCAGG + Intergenic
1171839334 20:30191522-30191544 CAGGCAAAAAAATAAAATACTGG + Intergenic
1172219168 20:33260867-33260889 CAAGCAAAAAAAAAAAAAAGAGG - Intergenic
1172508863 20:35485476-35485498 CAAGCAAACAAACAAAAATCTGG - Intronic
1172720432 20:36995788-36995810 CAAACAAACAAACAAAAAACAGG + Intergenic
1172825799 20:37784384-37784406 CCAGAAAACAAATAACAAAATGG - Intronic
1172928664 20:38565044-38565066 CCAGTAAATAAATAATCAAAAGG - Intronic
1173099194 20:40068206-40068228 CCAGAAAACAAATAACAAAATGG + Intergenic
1173196509 20:40918171-40918193 CCATCAAAAAAAAAAAAAAAAGG + Intergenic
1173308453 20:41874016-41874038 CCAGGAAATATATTAGAAACTGG + Intergenic
1173595350 20:44255599-44255621 CCAGCAAATAAGTGTAAAGCTGG + Intronic
1173641614 20:44606802-44606824 CCATCAAATAAATAAATAAATGG + Intronic
1173959350 20:47059069-47059091 ACAGGAAACAAATAAATAACAGG + Intronic
1174229203 20:49030462-49030484 TTAGCAAAAAAAAAAAAAACTGG + Intronic
1174584434 20:51596679-51596701 CCATGAAATAAAGAAAAAATAGG + Exonic
1174636781 20:52007853-52007875 CAAACAAACAAACAAAAAACAGG + Intergenic
1174823933 20:53751839-53751861 ACAGGAAGTAAATAAAAAATGGG + Intergenic
1174847458 20:53956657-53956679 ACAGCAAAAAAAAAAAAAAGTGG + Intronic
1174885503 20:54329688-54329710 CATGCAAATATATAAACAACAGG + Intergenic
1175007136 20:55696615-55696637 CCAGCAAACAACTATAAATCTGG + Intergenic
1175012803 20:55756726-55756748 CCAGAAAAAAAAAAAAAAAAAGG + Intergenic
1175590607 20:60188472-60188494 CAAGAAAATAAATAATAAAATGG - Intergenic
1175646379 20:60676440-60676462 GGAGCAAAGAAATGAAAAACTGG + Intergenic
1176651144 21:9548267-9548289 ATAGCAAATAAAGAAAAAAAAGG - Intergenic
1176931233 21:14812769-14812791 GCAGAAAAGAAAAAAAAAACAGG + Intergenic
1176976703 21:15328973-15328995 TCAGCTAATAATGAAAAAACAGG + Intergenic
1177070116 21:16494110-16494132 CCATCAAAAAAAAAAAAAAAAGG + Intergenic
1177347144 21:19888410-19888432 GCAGGAAGTAATTAAAAAACTGG + Intergenic
1177438168 21:21083282-21083304 CCAGCAAAGTAATAATAAAATGG - Intronic
1177494416 21:21871206-21871228 CCAGAAAACAAATAACAAAATGG - Intergenic
1177553960 21:22665806-22665828 CCAGCAAATAAACAAATGAAGGG + Intergenic
1177577083 21:22971999-22972021 CAGGCAAATAAAATAAAAACTGG - Intergenic
1177591681 21:23178635-23178657 CCAGTAAATAATTTAAAAGCAGG - Intergenic
1177771551 21:25521723-25521745 CCAGAAAACAAATAACAAAATGG + Intergenic
1177801020 21:25828847-25828869 CCAGTAAAAAAAAAAAAAAAAGG + Intergenic
1177970338 21:27780815-27780837 CCAGAAAATAAATAACAAAATGG + Intergenic
1178289539 21:31355169-31355191 CCACCAAAAAAAAAAAAAAAAGG + Intronic
1178295931 21:31409881-31409903 CCCCCAAATAAAAAAAAAAAAGG - Intronic
1178637929 21:34321590-34321612 TCAGCAAATGAATAAAAAAGGGG - Intergenic
1178732674 21:35119025-35119047 CCAGCATATGAATAAAATAAAGG + Intronic
1178896058 21:36558604-36558626 GCACCAAAAAAATAAAAAACAGG - Intronic
1179359302 21:40690477-40690499 CTAGAAAATAAATACAACACAGG - Intronic
1179674449 21:42972544-42972566 CCAATAAATAAATAAATAAATGG - Intergenic
1180034641 21:45238621-45238643 CCAGAAAACAAATAATAAAAGGG + Intergenic
1180432846 22:15269487-15269509 ACAGGAAAGAAAAAAAAAACAGG - Intergenic
1180563410 22:16641286-16641308 CCAGAAAACAAATAACAAAATGG + Intergenic
1181134515 22:20755145-20755167 CTACCGAATAAATAAAAAATGGG - Intronic
1181445239 22:22967248-22967270 CCAGAAAACAAATAACAAAATGG - Intergenic
1181451890 22:23028324-23028346 TAAATAAATAAATAAAAAACAGG - Intergenic
1181736065 22:24882369-24882391 TCAAAAAATAAATAAAAAACAGG - Intronic
1182315295 22:29442129-29442151 ACTGCAAAAAAACAAAAAACAGG + Exonic
1183439293 22:37814257-37814279 AAAACAAATAAATAAAAAACTGG - Intronic
1183450546 22:37892346-37892368 CCAAAAAATAAATAAAATCCTGG - Intergenic
1183531718 22:38358855-38358877 CCAGAAAACAAATAACAAAATGG - Intronic
1183779427 22:39989212-39989234 CAAACAAACAAACAAAAAACAGG + Intergenic
1183930640 22:41234190-41234212 CCAGCAAATATAGAAACAGCAGG + Intronic
1184000214 22:41667805-41667827 CAAACAAATAAATAAATAAATGG - Intergenic
1184080952 22:42219854-42219876 TCAATAAATAAATAAAAAAGAGG + Intronic
1184542895 22:45141369-45141391 CAAACAAATAAATAAATAAATGG + Intergenic
949434752 3:4017049-4017071 TAAACAAACAAATAAAAAACAGG - Intronic
949441035 3:4080545-4080567 TCAGAAAATGAATAAAAACCTGG - Intronic
949528967 3:4934987-4935009 AAATAAAATAAATAAAAAACCGG + Intergenic
949730449 3:7106337-7106359 CCAGAAAATAAGAAAAAAAAAGG - Intronic
949730630 3:7108491-7108513 GCAGCAAAAAAAAAAAAAAATGG - Intronic
949760184 3:7462064-7462086 CCATCAAATAAAGAAGAAAAAGG - Intronic
949964099 3:9340657-9340679 CCAGCAAGTAAAAAAACTACTGG - Intronic
950375133 3:12565273-12565295 CAACCAAATAAATACAAAAGAGG - Intronic
950375333 3:12567037-12567059 CCAGGAGAAAAATAAAGAACAGG - Intronic
950444227 3:13026861-13026883 CAAACAAAAAAAAAAAAAACTGG - Intronic
950862996 3:16166971-16166993 TCAGGACATAAATAAAAAATTGG + Intergenic
950970800 3:17185365-17185387 CCACCAACAAAATAAAAAAAGGG + Intronic
951028658 3:17857809-17857831 CCAGAAAACAAATAACAAAAGGG - Intronic
951207692 3:19941851-19941873 CCATCAAAAAAAAAAAAAAAAGG + Intronic
951259683 3:20493060-20493082 CCAGAAAACAAATAAGAAAATGG - Intergenic
951310049 3:21114688-21114710 CCAGAAAACAAATAACAAAATGG - Intergenic
951560027 3:23956984-23957006 CCATCTAAAAAAAAAAAAACTGG - Intronic
951732767 3:25828893-25828915 CCAGAAGATAACTAAGAAACTGG + Intergenic
951913535 3:27776007-27776029 TAAGCAAATAAATAAATAAAGGG + Intergenic
951972989 3:28469326-28469348 CCAGAAAACAAATAACAAAATGG + Intronic
952132405 3:30380908-30380930 CCAGAAAACAAATAAAAAATTGG - Intergenic
952566613 3:34666676-34666698 TCACCAAATAAATAAAAATTAGG - Intergenic
952657860 3:35807933-35807955 CCAGGCAATAAATAGAAACCCGG - Intergenic
952726034 3:36585495-36585517 CCAGAAAACAAATAACAAAATGG + Intergenic
952825467 3:37520945-37520967 CCAGCAACCAAACAAAACACTGG - Intronic
952861174 3:37813533-37813555 CAAGTCAATAAATAAAGAACAGG - Intronic
953173345 3:40527006-40527028 CAAACAAACAAACAAAAAACAGG - Intronic
953217448 3:40933084-40933106 CCAGAAAACAAATAACAAAATGG + Intergenic
953309214 3:41860751-41860773 CCAGAAAACAAATAACAAAATGG - Intronic
953519786 3:43630856-43630878 CAAAGAAATAAAGAAAAAACTGG - Intronic
953712275 3:45284238-45284260 CAAACAAACAAACAAAAAACCGG - Intergenic
953940424 3:47090260-47090282 CAAACAAACAAATAAAAGACTGG + Intronic
954011443 3:47643050-47643072 CAAGCAAACAAATAAATAACTGG + Intronic
954062993 3:48084572-48084594 CCTGCAAAAAAAAAAAAAAGGGG - Intronic
954334114 3:49906212-49906234 CCAGGAAATGAATAAACACCCGG + Intronic
954518171 3:51198578-51198600 CCAAAAAAAAAAAAAAAAACAGG + Intronic
955129648 3:56152893-56152915 GCAACTAATAAATAAAACACTGG + Intronic
955339984 3:58117787-58117809 CAAGAAAAAAAAAAAAAAACTGG - Intronic
955851241 3:63222508-63222530 CAAACAAACAAACAAAAAACTGG - Intergenic
956112813 3:65887386-65887408 CCAGAAAAAAAAAAAAAAAAGGG + Intronic
956126058 3:66011835-66011857 CCAAAAAAAAAAAAAAAAACTGG + Intronic
956133278 3:66074541-66074563 TCAATAAATAAATAAATAACAGG + Intergenic
956223211 3:66925968-66925990 CCAGAAAACAAATAACAAAATGG + Intergenic
956549722 3:70444529-70444551 CCAGAAAACAAATAACAAAATGG + Intergenic
956710026 3:72030786-72030808 CCAGCAAATTAAAAAAAAAAAGG - Intergenic
956816803 3:72915337-72915359 CCCGCAAAAAAAAAAAAAAAAGG - Intronic
957087711 3:75698144-75698166 CTAGCAAAAAAAAAAAAAAAAGG + Intergenic
957287323 3:78233017-78233039 CCAGAAAACAAATAACAAAATGG + Intergenic
957321121 3:78631636-78631658 CCAGCAATTAAATAATAGAAAGG - Intronic
957471641 3:80666726-80666748 CAAACAAACAAACAAAAAACTGG + Intergenic
957485518 3:80857567-80857589 AGAGGAAATAAATAAGAAACTGG - Intergenic
957527468 3:81395606-81395628 CCACCATAAAAATAAAAGACTGG + Intergenic
957622136 3:82607102-82607124 CCAGAAAACAAATAACAAAATGG + Intergenic
957628935 3:82693407-82693429 CCATCAAATAAATAAACCAAAGG - Intergenic
957662123 3:83171771-83171793 TCAGCAAACAAATAAAAACATGG - Intergenic
957810191 3:85212305-85212327 CCAGAAAACAAATAACAAAATGG - Intronic
957828177 3:85478551-85478573 CCAGAAAATAAAATAAAAAATGG + Intronic
958084813 3:88793576-88793598 CCAGAAAACAAATAAAAAAATGG - Intergenic
958140564 3:89557186-89557208 CAAGCAAAAAAAAAAAAAAATGG + Intergenic
958568180 3:95842978-95843000 CAAGGAAATATATAAAACACTGG + Intergenic
958609654 3:96408959-96408981 CTATTAAATAAATAATAAACTGG + Intergenic
958615256 3:96485688-96485710 TCAGCAAATATAAAAAAAAAGGG - Intergenic
958647962 3:96897330-96897352 CTTGCAAATAAATAAGAAAATGG - Intronic
958648088 3:96899045-96899067 CAAACAAACAAAAAAAAAACAGG + Intronic
958683073 3:97355637-97355659 CCAGAAAACAAATAACAAAGTGG + Intronic
958760375 3:98299379-98299401 CCAGAAAACAAATAACAAAATGG + Intergenic
959118270 3:102203743-102203765 CCAGAAAACAAATAACAAAATGG - Intronic
959152627 3:102625573-102625595 TCACTAAATAAATAAAAAGCAGG - Intergenic
959165023 3:102765848-102765870 GCAGCAAATTAACAAAATACAGG - Intergenic
959459149 3:106603592-106603614 CAAGCAAATAAAAAAAAATCAGG - Intergenic
959494495 3:107034026-107034048 CAAGCAAATAAATAAATAAATGG + Intergenic
959547199 3:107610887-107610909 CCAGAAAACAAATAACAAAATGG - Intronic
959567181 3:107844369-107844391 CCAGCAGACACCTAAAAAACAGG + Intergenic
959797908 3:110454819-110454841 CCAGAAAACAAATAACAAAATGG - Intergenic
959817697 3:110694148-110694170 CCAGAAAAAAAAAAAAAAAAGGG + Intergenic
959868318 3:111297674-111297696 CCAGAAAACAAATAACAAAATGG - Intronic
960067443 3:113388499-113388521 CCAGAAAACAAATAACAAAATGG + Intronic
960095217 3:113683005-113683027 CCAGAAAACAAATAACAAAATGG - Intronic
960272633 3:115691146-115691168 CCAGCAAATAAAGAGAACAATGG + Intronic
960471520 3:118072541-118072563 CCAGAAAACAAATAACAAAATGG - Intergenic
960499137 3:118414280-118414302 CCAGAAAATAAATAACAAAATGG + Intergenic
960536813 3:118824222-118824244 CAAACAAACAAACAAAAAACTGG - Intergenic
960817031 3:121684269-121684291 ACAGCAAAAAAAAAAAAAAAGGG + Intronic
960861805 3:122163066-122163088 CCAGAAAACAAATAAGAAAATGG - Intergenic
961398104 3:126612022-126612044 CAAACAAATAAACAAAAAAATGG - Intronic
961926046 3:130481807-130481829 CCAACAAACAAATGAAAAAAAGG - Intronic
961952577 3:130765266-130765288 CCAGAAAACAAATAACAAAATGG + Intergenic
962252263 3:133842627-133842649 AAAACAAATAAACAAAAAACAGG + Intronic
962465761 3:135657132-135657154 CCAGAAAATAAATTTAAAAATGG + Intergenic
962479962 3:135789256-135789278 CAAGCAAAAAAACAAAAACCAGG - Intergenic
962700453 3:137993559-137993581 ATAGCAAATAAAAAAACAACTGG - Intergenic
962771314 3:138613010-138613032 CCAGGAAAAAAAAAAAAAAAAGG - Intronic
963002687 3:140697051-140697073 CTAGCAAAATAATAGAAAACTGG - Intronic
963139360 3:141934854-141934876 CAAACAAACAAAAAAAAAACCGG - Intergenic
963179724 3:142341394-142341416 CCAGAAAACAAATAACAAAGTGG + Intronic
963515543 3:146303677-146303699 CCAGAAAACAAATAACAAAATGG + Intergenic
963690370 3:148492890-148492912 CCACCAAAATAATAATAAACAGG - Intergenic
963725712 3:148918832-148918854 CTAGCCAATAACAAAAAAACAGG + Intergenic
963754619 3:149221469-149221491 CCACCAAATAAAAAATATACAGG + Intronic
963947200 3:151159631-151159653 CCATGAAAAAAATAAGAAACAGG - Intronic
963976797 3:151489205-151489227 CCAACAAATATATGAAAAAAAGG + Intergenic
963996317 3:151713505-151713527 CCAGAAAACAAATAACAAAATGG + Intergenic
964022000 3:152023673-152023695 CCAGAAAACAAATAACAAAATGG + Intergenic
964136789 3:153353387-153353409 CAAGCAAGCAAACAAAAAACAGG + Intergenic
964208825 3:154205542-154205564 CCAGAAAACAAATAACAAAAGGG - Intronic
964554681 3:157923346-157923368 CCTACATATAAATAAAAATCTGG - Intergenic
964636522 3:158863542-158863564 TCAGCCACTAAATAAAAAACTGG + Intergenic
964751016 3:160053944-160053966 CCCCCAAAAAAAAAAAAAACTGG + Intergenic
964800929 3:160556477-160556499 CCAATAAACAAATAAAAAATAGG - Intronic
964882451 3:161439156-161439178 ACAGCAACAAAAAAAAAAACAGG + Intergenic
964964846 3:162479511-162479533 CCAGAAAACAAATAACAAAATGG - Intergenic
964972816 3:162582175-162582197 CAAGCAAAAAAAAAAAAAATGGG + Intergenic
964973749 3:162593805-162593827 TCAACAAACAAATAATAAACAGG - Intergenic
964986635 3:162749472-162749494 CCAGAAAACAAATAACAAAATGG - Intergenic
965005806 3:163020684-163020706 CCTGTAAATAAATAATAATCTGG - Intergenic
965014408 3:163138920-163138942 CCAGAAAACAAATAACAAAATGG - Intergenic
965149625 3:164953179-164953201 CCAAGAAATAAATAAATAACTGG - Intergenic
965156220 3:165060352-165060374 GCAACAAATAAATAACAAAAGGG + Intronic
965349105 3:167591926-167591948 CCAGAAAACAAATAACAAAATGG - Intronic
965677577 3:171213957-171213979 CCAAAAAATAAATAAATAAAAGG + Intronic
965988952 3:174792058-174792080 CAAACAAACAAACAAAAAACAGG + Intronic
966348795 3:179007370-179007392 CCAGAAAACAAATAACAAACTGG + Intergenic
966396522 3:179509650-179509672 CCAGAAAAAAAAAAAAAAAGAGG - Intergenic
966453382 3:180087900-180087922 CCAGAAAATAAATAACAAAATGG - Intergenic
966491584 3:180533148-180533170 CCAGAAAACAAATAACAAAATGG + Intergenic
966505241 3:180693192-180693214 ACAGGAAATAAAGAAAAAAGGGG + Intronic
966550764 3:181201556-181201578 CAAACAAACAAACAAAAAACAGG - Intergenic
966708480 3:182945605-182945627 CAAACAAACAAACAAAAAACTGG + Intronic
966957811 3:184902121-184902143 CCACCAATTAAAAAAAAAAAAGG - Intronic
967655745 3:192046139-192046161 CCAGAAAACAAATAACAAAATGG + Intergenic
967721001 3:192816475-192816497 CCAGCAACTAAAGAAAAATTAGG - Intronic
968119706 3:196117148-196117170 CCAACAAAAAAAAAAAAAAGTGG - Intergenic
968281142 3:197477646-197477668 CAAACAAACAAACAAAAAACAGG - Intergenic
968444763 4:646051-646073 GCAGAAAATAAATAAATGACAGG - Intronic
970260477 4:14219082-14219104 GCAACAAATAAAGAAAAAATTGG - Intergenic
970379023 4:15487683-15487705 CCAGAAAACAAATAAGAAAATGG - Intronic
970402321 4:15729288-15729310 CAAGCAAACAAACAAAAAATTGG + Intronic
970866852 4:20769071-20769093 CCAAAAAAAAAAAAAAAAACTGG + Intronic
970867785 4:20779117-20779139 TCAGCAAATAAATACCAAACAGG + Intronic
971082066 4:23224581-23224603 CCAAAAAAAAAAAAAAAAACTGG + Intergenic
971195217 4:24466882-24466904 CCAGCAAAAAAAAAAAAAAGAGG + Intergenic
971246722 4:24935926-24935948 CCAGCAAAGAGACAAAAAAGAGG + Intronic
971320138 4:25598958-25598980 CCACCAAAAAAAAAAAAAACAGG - Intergenic
971703015 4:30005234-30005256 ACAGCAAAAAAATATAAAAAAGG - Intergenic
971725407 4:30305477-30305499 CCAGCAAAGAAATAAAATAATGG + Intergenic
971908048 4:32754383-32754405 CAAACCAATAAATAAAATACTGG + Intergenic
971994648 4:33949753-33949775 ACAACAAACAAAAAAAAAACTGG - Intergenic
972009653 4:34160886-34160908 CCAGAAAACAAATAATAAAATGG + Intergenic
972089598 4:35264661-35264683 CAAACAAACAAACAAAAAACTGG + Intergenic
972114005 4:35604992-35605014 ACAGCAAATAAAAAAAGAAAAGG - Intergenic
972133727 4:35865431-35865453 CCAGAAAAAAAAAAAAAAAAAGG + Intergenic
972237219 4:37148475-37148497 CCAGAAAACAAATAACAAAATGG - Intergenic
972270550 4:37507310-37507332 CCAGAAAAGAAATAACAAAATGG - Intronic
972283503 4:37625972-37625994 CCAACAAATATATGAAAAAAAGG + Intronic
972330382 4:38058602-38058624 CCAGAATATAAATGTAAAACAGG - Intronic
972435351 4:39028503-39028525 CAAACAACTAAATAAAATACAGG - Intronic
972545343 4:40075017-40075039 AAAGTAAATAAATAAAAAATAGG + Intronic
972674435 4:41245870-41245892 CCCGAAAATAATTATAAAACTGG + Intergenic
972904815 4:43732013-43732035 CCAGAAAACAAATAAGAAAATGG + Intergenic
972928221 4:44039113-44039135 GGAGCAAATGAATAAAAATCTGG - Intergenic
972948746 4:44291856-44291878 CCAACAAATGTATGAAAAACAGG + Intronic
973096549 4:46208620-46208642 CAAATAAATAAATAAAAATCAGG + Intergenic
973287632 4:48437568-48437590 CCAGAAAACAAATAACAAAATGG - Intergenic
973339498 4:48989158-48989180 CCAACAAATCAATAGAAAAGGGG + Intronic
973664488 4:53143827-53143849 CCAGCAAATGAATAGAAATGTGG + Intronic
973666683 4:53166828-53166850 CCACCAAAAAAAAAAAAAAAAGG + Intronic
974148692 4:57978011-57978033 CCAGTAAATATTTAAAAAGCAGG - Intergenic
974245178 4:59305243-59305265 CCATCAAATACATAAAAAGATGG + Intergenic
974306145 4:60142786-60142808 CAAGCAAACAAATAAAATAAAGG + Intergenic
974359504 4:60858354-60858376 CAAATAAATAAATAAACAACAGG + Intergenic
974557915 4:63475981-63476003 GCAGCAAAAAAAAAAAAAATGGG - Intergenic
974582764 4:63827084-63827106 AAAGCAAACAAATAAAAAAAAGG + Intergenic
974769895 4:66399167-66399189 CCAGAAAATAGATAACAAAATGG - Intergenic
974786678 4:66626681-66626703 TCTGCAAATAAAGACAAAACAGG - Intergenic
975194768 4:71510746-71510768 CCAGAAAATAATTAACAAAATGG - Intronic
975215622 4:71750892-71750914 CAAACAAACAAAAAAAAAACGGG + Intronic
975554690 4:75650023-75650045 TAAGTAAATAAATAAAAAAGTGG + Intronic
975787747 4:77910603-77910625 CCAGAAAGTAAAGAAAAAGCTGG + Intronic
975815681 4:78214495-78214517 CCAGCTAAAAAATTAAAAATGGG - Intronic
976012639 4:80509856-80509878 CCAGAAAAAAAAAAAAAATCTGG - Intronic
976041311 4:80888093-80888115 CCAGAAAACAAATAACAAAATGG + Intronic
976062396 4:81144168-81144190 GCAGCCAATAAATAAAGAAGGGG - Intronic
976274666 4:83264051-83264073 CTAGCAAATAAGTAAAATCCAGG + Exonic
976370069 4:84277697-84277719 GCAGCAAATAAATGACAGACAGG + Intergenic
976371564 4:84294590-84294612 GTAGCAATTAAATAAAAATCAGG - Intergenic
976451592 4:85196928-85196950 CCAGAAAACAAATAAGAAAACGG - Intergenic
976562471 4:86517991-86518013 CCAAAAAACAAACAAAAAACAGG - Intronic
976618707 4:87105756-87105778 CCAGGAAAAGAACAAAAAACAGG - Intronic
976630275 4:87229418-87229440 CCACCAAAAAAAAAAAAAAAAGG - Intronic
977138476 4:93336837-93336859 CAAACAAAGAAATAGAAAACTGG - Intronic
977431518 4:96936731-96936753 CAAACAAACAAACAAAAAACTGG - Intergenic
977521924 4:98095279-98095301 CCAGAAAACAAATAACAAAATGG + Intronic
977561096 4:98534839-98534861 CAAACAAACAAACAAAAAACAGG - Intronic
978047049 4:104143055-104143077 CCAGAAAACAAATAACAAAATGG - Intergenic
978113988 4:104997088-104997110 CAAGCAAAAAAAAAAAAAAAAGG - Intergenic
978510032 4:109507277-109507299 CCATCAAAAAAAAAAAAAAAAGG - Intronic
978554542 4:109964867-109964889 CCAGCAAGTAATAAAAAACCTGG - Intronic
979105324 4:116679138-116679160 ACACCAAAGAAATTAAAAACTGG - Intergenic
979185532 4:117786906-117786928 CCAACAAACACATAAAAAAGTGG - Intergenic
979201053 4:117978561-117978583 CCACCAAAAAAAAAAAAAAAAGG + Intergenic
979213065 4:118130220-118130242 CCAGAAAACAAATAACAAAGTGG - Intronic
979757163 4:124355240-124355262 CCAGAAAACAAATAACAAAAGGG + Intergenic
979973953 4:127172724-127172746 CCAGCAAAAAAAAAAAAATACGG + Intergenic
980164007 4:129202430-129202452 CTAACAAATAAATAACAAGCTGG + Intergenic
980268694 4:130554776-130554798 CCAGAAAACAAATAACAAAGTGG + Intergenic
980321150 4:131278353-131278375 CCATCAAATAAAGAATATACGGG - Intergenic
980374149 4:131920905-131920927 CAAACAAACAAACAAAAAACAGG + Intergenic
980581128 4:134752725-134752747 CCAACAACTAAATAAAAAGATGG + Intergenic
980621885 4:135318328-135318350 CCAGAAAACAAATAACAAAATGG - Intergenic
980708447 4:136531538-136531560 CAAACAAACAAACAAAAAACCGG - Intergenic
980850188 4:138372268-138372290 CCAGAAAATAAATAACAAAATGG + Intergenic
981052630 4:140325562-140325584 ATAGCAAATAAATATAAAAGAGG + Intronic
981154728 4:141421174-141421196 CCATAAAACAAATAACAAACTGG - Intergenic
981518026 4:145631682-145631704 CCAGAAAACAAATAACAAAATGG - Intronic
981558369 4:146020624-146020646 CCAGAAAATAAACAACAAAATGG - Intergenic
981598119 4:146450100-146450122 CAAACAAACAAACAAAAAACAGG + Intronic
981716716 4:147759405-147759427 CCATTAAAAAATTAAAAAACAGG + Intronic
981993080 4:150946913-150946935 GCAGCAAAAAAAAAAAAAATAGG + Intronic
982164399 4:152602023-152602045 CAAACAAACAAACAAAAAACAGG + Intergenic
982239056 4:153280383-153280405 CCAGCAAAAAAAAAAAAAAAAGG - Intronic
982281449 4:153687246-153687268 CAAGCAAATACCTTAAAAACTGG + Intergenic
982751722 4:159169962-159169984 CCTGCAAAAAAATTAAAAATAGG - Intronic
983248058 4:165311314-165311336 ACAGCAATTACATGAAAAACAGG - Intronic
983436491 4:167722028-167722050 CCAGAACATAAATAAAACTCAGG - Intergenic
983594231 4:169448554-169448576 CCAGAAAACAAATAACAAAATGG + Intronic
983606065 4:169585557-169585579 CCAGAAAATAAATAACATATAGG + Intronic
984062966 4:175014740-175014762 CAAACAAACAAACAAAAAACTGG + Intergenic
984146151 4:176063999-176064021 CCAGTTAAGAAACAAAAAACCGG - Intergenic
984313467 4:178095271-178095293 AAAGCAAATAAAACAAAAACTGG + Intergenic
984388752 4:179100050-179100072 AAAGCAAATAAATAAAAGAATGG + Intergenic
985230553 4:187811341-187811363 CAAACAAATAAATAAACAAAAGG - Intergenic
986092257 5:4521907-4521929 AAAACAAACAAATAAAAAACAGG - Intergenic
986577396 5:9226673-9226695 CCATCAATTAGATAAATAACTGG - Intronic
986885016 5:12223640-12223662 CCAGTAAACAAATAGCAAACTGG - Intergenic
986889203 5:12279919-12279941 CCAGAGAATAAATACAAGACAGG - Intergenic
987207398 5:15641500-15641522 CCACCAAAAAAAAAAAAAAATGG - Intronic
987558122 5:19481831-19481853 CCATAAAAGGAATAAAAAACAGG + Intronic
987739297 5:21884874-21884896 CAAGCAAACAAGCAAAAAACAGG - Intronic
987904152 5:24053601-24053623 CCAGAAAACAAATAACAAAATGG + Intronic
987961549 5:24816030-24816052 ACATGAAATAAATAATAAACAGG + Intergenic
988039492 5:25871286-25871308 ACAGAAAATAAATAACAAAATGG - Intergenic
988040604 5:25884488-25884510 TCAGAAAATAAATATAAAACTGG - Intergenic
988093950 5:26578527-26578549 CCAGTTGATAAATAAACAACAGG + Intergenic
988608074 5:32699006-32699028 CCAGAAAACTAATAACAAACTGG - Intronic
988645112 5:33086332-33086354 ACAGTAAATAAATAAAGAATGGG + Intergenic
988910300 5:35833975-35833997 CCTGCAAAAAAAAAAAAAACGGG + Intergenic
988956023 5:36320644-36320666 CCAGAAAACAAATAACAAAATGG - Intergenic
989074591 5:37550770-37550792 CCAGAAAACAAATAACAAAATGG - Intronic
989147978 5:38267496-38267518 TGAGCAGATAAATAAAAAAATGG + Intronic
989148787 5:38276700-38276722 AGAGTAAATAAATAAAAATCAGG + Intronic
989283430 5:39671173-39671195 TCACCAAATAAATATAAAACAGG - Intergenic
989440705 5:41469697-41469719 CCATCAATTAAATAATAAATGGG + Intronic
989466105 5:41757689-41757711 CCAGCAAATTCATAAAACATTGG + Intronic
989518003 5:42365628-42365650 CTTGCAAATAAATAAGAAATTGG - Intergenic
989629550 5:43467194-43467216 CCAAAAAATAAATAACAAAATGG + Intronic
989948874 5:50273513-50273535 AAAACAAATAAACAAAAAACTGG - Intergenic
989970464 5:50518727-50518749 ACAGAAAATAAATAACAAAATGG - Intergenic
990159865 5:52925496-52925518 AGAACAAATAAATGAAAAACTGG - Intronic
990183556 5:53189211-53189233 CAAACAAACAAACAAAAAACAGG - Intergenic
990213998 5:53510843-53510865 CCAGAAAACAAATAACAAAATGG - Intergenic
990405664 5:55488077-55488099 CAAACAAATAAATAAATAATTGG + Intronic
990433317 5:55760048-55760070 CCAGTAAAAAAAAAAAAAAATGG - Intronic
990491370 5:56306208-56306230 CCAACAAATAAATCAAGAATGGG + Intergenic
990513346 5:56509502-56509524 CCACTAAGTAAATAAAAAGCAGG - Intergenic
990610494 5:57452149-57452171 CCAGCAAAAAAAGAAAAAATTGG - Intergenic
991089826 5:62683568-62683590 CCAGAAAAAAAAAAAAAAAATGG + Intergenic
991353471 5:65744471-65744493 TCAGCAAAAAAAAAAAAAAAAGG - Intronic
991514945 5:67424969-67424991 CAAACAAACAAACAAAAAACTGG + Intergenic
991548718 5:67812895-67812917 CCAGCAAACATATAGAAAAATGG + Intergenic
992309778 5:75484354-75484376 CCAGAAAACAAATAACAAAATGG + Intronic
992571497 5:78063815-78063837 ACATCAAATAAAAAATAAACAGG + Intronic
992579201 5:78153584-78153606 CCAGAAAACAAATAACAAAATGG - Intronic
992705614 5:79388936-79388958 CCTGGAAATAAAGAAAAACCTGG + Intronic
992934743 5:81690209-81690231 CCAGAAAACAAATAACAAAATGG + Intronic
993268886 5:85767392-85767414 CAAACAAACAAACAAAAAACAGG - Intergenic
993439443 5:87937330-87937352 CCAAAAAATAAATAAATAAAAGG - Intergenic
993484336 5:88463859-88463881 CCAGCAAACATATTAAAAAATGG - Intergenic
993772597 5:91949059-91949081 CCATCAAAAAAAAAAAAAATAGG + Intergenic
993994465 5:94705503-94705525 CCACCAAAAAAAAAAAAAAAAGG + Exonic
994020620 5:95020388-95020410 ACAGCAAATAAATATAAGTCCGG - Intronic
994042821 5:95276966-95276988 CAAACAAACAAACAAAAAACAGG + Intronic
994217618 5:97156755-97156777 CCAGAAAACAAATAACAAAATGG - Intronic
994261502 5:97664781-97664803 CAAACAAGTAAATAAAAAACTGG - Intergenic
994304222 5:98182314-98182336 CAATTAAATAAAAAAAAAACAGG + Intergenic
994360888 5:98846836-98846858 CCATGAAATAAATAATAAACTGG + Intergenic
994428470 5:99625513-99625535 CCAGAAAACAAATAAAAACATGG - Intergenic
994509165 5:100682170-100682192 CCAGAAAATAATTAACAAAATGG - Intergenic
994549398 5:101211139-101211161 CCAGGAAAAAAAAAAAATACAGG - Intergenic
994654172 5:102569111-102569133 CCAGAAAACAAATAATAAAATGG - Intergenic
994893331 5:105668084-105668106 CCAGAAAACAAATAACAAAATGG - Intergenic
995157544 5:108932853-108932875 CCATCAAAAAAAAAAAAAAGTGG - Intronic
995225863 5:109700278-109700300 CCAAAAAAAAAAAAAAAAACCGG - Intronic
995265567 5:110155243-110155265 CCAGAAAGTAAATAACAAAATGG + Intergenic
995461044 5:112403333-112403355 TCAGCAAAAAAAAAAAAAAAAGG + Intronic
995502112 5:112818824-112818846 CCAAAAAAAAAACAAAAAACCGG - Intronic
995878585 5:116818613-116818635 CAAACAAATAAATAAATAAATGG + Intergenic
995922251 5:117328389-117328411 CCAGATAATAAATGAAAACCTGG + Intergenic
995981119 5:118105396-118105418 CAAACAAACAAACAAAAAACAGG + Intergenic
996166142 5:120226400-120226422 CCAGAAAACAAATAACAAAATGG - Intergenic
996259535 5:121448618-121448640 CCAGAAAACAAATAACAAAATGG + Intergenic
996271575 5:121611320-121611342 TGAGCAAATAAATAAATAAGTGG + Intergenic
996283279 5:121758533-121758555 GCAGGAAAAAAAAAAAAAACAGG + Intergenic
996288552 5:121824716-121824738 ACAACAAAAAAAAAAAAAACGGG - Intergenic
996347295 5:122500881-122500903 TCAGAAAAAAAAAAAAAAACGGG + Intergenic
996353521 5:122572061-122572083 TGAGCAAATGATTAAAAAACTGG - Intergenic
996467628 5:123821880-123821902 CCAGCAAATTGAGAAGAAACTGG - Intergenic
996474371 5:123899525-123899547 TTAGCAAATAAATAAAAACCAGG + Intergenic
996651940 5:125888737-125888759 CCACCAAAAAAATTAATAACAGG + Intergenic
996659642 5:125986452-125986474 CCAGAAAATAAATAACAACATGG - Intergenic
996927769 5:128848516-128848538 CCAGAAAACAAATAACAAAATGG + Intronic
996982608 5:129517820-129517842 CCAGAAAACAAATAACAAAATGG - Intronic
997036614 5:130200607-130200629 CTAGCAAAAAAAAAAAAAAAAGG + Intergenic
997482154 5:134193875-134193897 ACAGCAAATACAAAACAAACTGG + Intronic
997495267 5:134318475-134318497 ACAACAAACAAACAAAAAACTGG - Intronic
998188498 5:140001695-140001717 CCACCAAAAAAAAAAAAAAATGG + Intronic
998695524 5:144633862-144633884 CCAGAAAACAAATAAATAAATGG + Intergenic
998716965 5:144895158-144895180 CCAGAAAACAAATAACAAAATGG + Intergenic
999355471 5:150926192-150926214 CCAGAAAATAAATTATAAAATGG - Intergenic
999597230 5:153218384-153218406 AAAAAAAATAAATAAAAAACAGG + Intergenic
999769635 5:154765557-154765579 CCTACAAAAAATTAAAAAACTGG - Intronic
999919302 5:156301122-156301144 CTAGAAAATAAATAACAAAATGG - Intronic
1000054386 5:157591902-157591924 CAAACAAACAAACAAAAAACAGG - Intergenic
1000455208 5:161440199-161440221 CCAGAAAATAAATAACAAAATGG + Intronic
1000467523 5:161598183-161598205 TCAGCAAATGAATAAAGAAAAGG + Intronic
1000545155 5:162590813-162590835 ATAGCAAATAAATAAAAAACTGG - Intergenic
1000904390 5:166946376-166946398 CAAACAAACAAACAAAAAACTGG + Intergenic
1001260425 5:170223826-170223848 CAAACAAACAAACAAAAAACAGG - Intergenic
1001347183 5:170914710-170914732 TCAAAAAATAAATAAATAACTGG - Intronic
1001398822 5:171434808-171434830 CCATCAAAAAAAAAAAAAAAAGG - Intronic
1001463171 5:171936497-171936519 CCAAAAAAAAAAAAAAAAACAGG + Intronic
1001887003 5:175301701-175301723 CAAACAAACAAACAAAAAACAGG + Intergenic
1002755276 6:153481-153503 ACAGCAAACAAACAAAAAACAGG + Intergenic
1002988891 6:2219239-2219261 CCAGAAGATAAATAAAAATTTGG + Intronic
1003277115 6:4662367-4662389 CAAGTAAATAAATAAATAAATGG + Intergenic
1003571448 6:7258906-7258928 TGAGTAAATAAATAAATAACAGG - Intergenic
1003616959 6:7663513-7663535 CCATCAAAAAAAAAAAAAAAGGG + Intergenic
1003780500 6:9419634-9419656 GCAGCAACTAAAAAAAAAAAAGG + Intergenic
1003845380 6:10168551-10168573 CAAACAAATAAATAAAAAATAGG - Intronic
1004035630 6:11920334-11920356 CAAACAAATAAACAAAAAATAGG - Intergenic
1004500281 6:16203402-16203424 ACACCAAATAACTAAAAAATGGG + Intergenic
1004724194 6:18295387-18295409 CAAACAAACAAACAAAAAACAGG - Intergenic
1004766767 6:18737625-18737647 CAAACAAACAAACAAAAAACCGG + Intergenic
1005097599 6:22134696-22134718 AGATCAAATAAATAAATAACTGG + Intergenic
1005110349 6:22274611-22274633 ACAGAAAATCATTAAAAAACGGG - Intergenic
1005114435 6:22319757-22319779 CAAACAAACAAACAAAAAACAGG - Intergenic
1005156851 6:22817474-22817496 CCAGAAAACAAATAACAAAATGG - Intergenic
1005360550 6:25027522-25027544 CCAGGAAATAAATACATAACCGG + Intronic
1005735612 6:28742867-28742889 CCAGTTAAAAAAAAAAAAACCGG - Intergenic
1006002664 6:30977746-30977768 CCAATAAATAAATAAATAAGAGG + Intergenic
1006462489 6:34170163-34170185 CCAGAAAACAAATAACAAAATGG - Intergenic
1006568143 6:34977516-34977538 CAAGCAAATAATTAAAATACAGG - Intronic
1006585126 6:35105122-35105144 CAGGCAAAAGAATAAAAAACAGG + Intergenic
1006591648 6:35162386-35162408 CCAACAATTAAATAGAGAACTGG + Intergenic
1006652206 6:35560850-35560872 ACAACAAACAAATAAAAAATGGG + Intergenic
1007001323 6:38316337-38316359 CCAGGAAACAAATAATAAAATGG - Intronic
1007294439 6:40811278-40811300 CCACCATATATTTAAAAAACAGG - Intergenic
1007380058 6:41483810-41483832 CAAGAAAAAAAATAAAAAATTGG + Intergenic
1007864156 6:44949607-44949629 CCTGCAAAAAAAAAAAAAATGGG + Intronic
1007868749 6:45007734-45007756 GCAGCAAAAAAAAAAAAAAGTGG - Intronic
1008144053 6:47868098-47868120 ACAGAAACTAAATAAAAAAAAGG + Intergenic
1008314845 6:50027033-50027055 CAAACAAACAAAAAAAAAACAGG + Intergenic
1008517086 6:52328332-52328354 CCACCAAACAAATAAAAATCTGG + Intergenic
1008529702 6:52445062-52445084 ACACCAAAAAAAAAAAAAACTGG - Intronic
1008731446 6:54487407-54487429 CTGGCAAAAAAAAAAAAAACAGG - Intergenic
1008773994 6:55012220-55012242 CAAACAACTAAAAAAAAAACTGG - Intergenic
1008935700 6:56989769-56989791 CCAGCAATTCAATAGAAAATAGG - Intronic
1009245672 6:61234080-61234102 CCAGAAAACAAATAATAAAATGG + Intergenic
1009375223 6:62960153-62960175 CCAGAAAACAAATAACAAAATGG - Intergenic
1009410946 6:63364255-63364277 CAAACAAACAAAAAAAAAACGGG + Intergenic
1009452271 6:63815715-63815737 ATAGATAATAAATAAAAAACTGG + Intronic
1009735773 6:67674550-67674572 CAACCAAACAAACAAAAAACTGG - Intergenic
1009748339 6:67849131-67849153 CCAGAAAACAAATAAAATAATGG + Intergenic
1009770959 6:68142376-68142398 CCAGAAAACAAATAACAAAATGG - Intergenic
1009802051 6:68551009-68551031 CCAGGAAACAAATAACAAAATGG + Intergenic
1009893895 6:69722798-69722820 CCAGAATATAAATAACAAAATGG + Intronic
1009978243 6:70697257-70697279 CCAGAAAACAAATAACAAAATGG - Intronic
1010061922 6:71633238-71633260 CCAGGAAACAAATAACAAAATGG - Intergenic
1010119237 6:72354238-72354260 CAAACAAATAAATAAAACCCAGG + Intronic
1010223209 6:73465463-73465485 TAAATAAATAAATAAAAAACAGG - Intronic
1010299279 6:74241263-74241285 CCAGAAAACAAATAACAAAATGG - Intergenic
1010532364 6:76984256-76984278 CAAACAAACAAACAAAAAACTGG - Intergenic
1010564712 6:77396137-77396159 CCAGAAAATAATAGAAAAACTGG - Intergenic
1010644908 6:78375135-78375157 CCAGTAAACAAATAACAAAATGG + Intergenic
1010772717 6:79850105-79850127 CCAGAAAACAAATAACAAAATGG + Intergenic
1011008034 6:82670118-82670140 CCAGTAAAGAAAAAAAAAAGTGG - Intergenic
1011341938 6:86325672-86325694 CAAACAAACAAACAAAAAACAGG - Intergenic
1011958868 6:93060673-93060695 CCAGGAAAAAAAAAAAGAACCGG + Intergenic
1012068945 6:94587053-94587075 CAAACACATAAATAAAAAATGGG + Intergenic
1012224806 6:96691654-96691676 CCAGAAAACAAATAATAAAATGG + Intergenic
1012483449 6:99693445-99693467 CCAGAAAACAAATAACAAAATGG + Intergenic
1012485618 6:99719389-99719411 CCAGAAAATAACTAACAAAATGG - Intergenic
1012567561 6:100678150-100678172 ACAACAATTAAATAATAAACCGG + Intronic
1012679168 6:102156534-102156556 CCAGAAAATAAATAACAGAATGG + Intergenic
1012806893 6:103906104-103906126 CCAGAAAACAAATAACAAAATGG - Intergenic
1013371983 6:109478686-109478708 CTAAGAAATAAATAAAATACAGG + Intronic
1013504727 6:110788138-110788160 ACAACAAAAAAACAAAAAACAGG - Intronic
1013722084 6:113042526-113042548 CAAGAAAAAAAATAAAAAAGTGG + Intergenic
1013965986 6:115956021-115956043 CCAGCAAATAAAATAAACATAGG + Intronic
1014035095 6:116757750-116757772 CCACCAAAAAAAAAAAAAAAAGG + Intronic
1014106522 6:117570226-117570248 GCAGCACATAAAAAAAAAAAAGG + Intronic
1014118670 6:117697273-117697295 CCAGAAAACAAATAACAAAATGG + Intronic
1014186704 6:118443150-118443172 CCAGAAAACAAATAACAAAATGG - Intergenic
1014234997 6:118943715-118943737 CCAGAAAACAAATAACAAAATGG + Intergenic
1014633018 6:123810720-123810742 CAAACAAACAAACAAAAAACAGG - Intronic
1014692665 6:124580615-124580637 CCAGAAAACAAATAACAAAATGG + Intronic
1014763318 6:125382159-125382181 GCAGCTAGTAAGTAAAAAACTGG - Intergenic
1014865022 6:126518879-126518901 CCAGAAAACAAATAATAAAATGG - Intergenic
1014868171 6:126557769-126557791 CAAGCAAACAAATACAAAAATGG - Intergenic
1014900755 6:126961534-126961556 TCAGCATATAAAAAAAAAACAGG + Intergenic
1015280349 6:131426863-131426885 ACAGCAAACAAATAAATTACAGG + Intergenic
1015358735 6:132310955-132310977 CAAACAAACAAACAAAAAACGGG - Intronic
1015460963 6:133490272-133490294 CCAGCAAACAAATAACAAAATGG + Intronic
1015866542 6:137732939-137732961 CAAACAAACAAACAAAAAACAGG + Intergenic
1015871081 6:137776941-137776963 ACAGCATATAAACAACAAACGGG + Intergenic
1016031772 6:139345082-139345104 CAACCCAATAAATAAAATACTGG + Intergenic
1016061840 6:139638559-139638581 TCAGCAAATAAGAAAAACACTGG - Intergenic
1016075567 6:139791435-139791457 AAACCAAAGAAATAAAAAACCGG - Intergenic
1016173307 6:141046778-141046800 CCAACAAATATATGAAAAAATGG - Intergenic
1016241718 6:141939171-141939193 CCAGGAAATAAGTAAAAAGCAGG + Intergenic
1016373570 6:143398255-143398277 TCAGCTAAGAAATAAAAAAAAGG + Intergenic
1016567787 6:145475886-145475908 CCAGAAAACAAATAACAAAGTGG + Intergenic
1016612217 6:146003053-146003075 CCAGAAAACAAATAACAAAATGG + Intergenic
1016623468 6:146139842-146139864 CCAGAAAACAAATAACAAAATGG - Intronic
1016643267 6:146375898-146375920 CCAGAAAACAAATAACAAAATGG - Intronic
1016784375 6:147994007-147994029 CCAGCAAGTAACCAAAAAAAAGG - Intergenic
1016884732 6:148948853-148948875 GCAGCCAGTAAATAAAAAACAGG + Intronic
1017064138 6:150513076-150513098 TCAGAAAAAAAAAAAAAAACAGG - Intergenic
1017161513 6:151369917-151369939 CAAACAAACAAACAAAAAACAGG + Intronic
1017613929 6:156223814-156223836 CCAGAAAACAAATAATAAAATGG + Intergenic
1017924384 6:158898151-158898173 CCAGAAAACAAATAACAAAATGG - Intronic
1018456007 6:163952737-163952759 GCAGAAAAAAAAAAAAAAACAGG - Intergenic
1018500828 6:164409620-164409642 CCAGAAAAGAAAAAAAAAATTGG + Intergenic
1019044622 6:169134327-169134349 CCAGAAAACAAATAATAAAATGG + Intergenic
1019112405 6:169726304-169726326 CTAGCAACTAAAAAAAAAAATGG + Intergenic
1019773875 7:2900852-2900874 CAAACAAAAAAAAAAAAAACAGG - Intergenic
1019793595 7:3033466-3033488 CCAGCAAATTAATACAAAGGGGG + Intronic
1019795573 7:3045616-3045638 CAAGACAATAAATAAAAAATGGG + Intergenic
1020377615 7:7505721-7505743 CCATAAAATAAATAAAAGTCAGG + Intronic
1020422760 7:8027573-8027595 CCAGAAAACAAATAATAAAATGG + Intronic
1020782479 7:12534623-12534645 CATGCAAATAAATAAGAAATAGG + Intergenic
1020852106 7:13367444-13367466 CCAGAAAACAAATAACAAAATGG - Intergenic
1020864900 7:13547196-13547218 CCAGGAAACAAATAACAAAATGG + Intergenic
1021035080 7:15787829-15787851 CCAGAAAACAAATAACAAAATGG + Intergenic
1021203396 7:17752161-17752183 CCAGAAAACAAATAACAAAATGG - Intergenic
1021353952 7:19630596-19630618 CCAGAAAACAAATAACAAAATGG + Intergenic
1021426445 7:20504838-20504860 CAAGAAAATAAATAAAAATATGG + Intergenic
1021641221 7:22738150-22738172 CCAGAAAACAAATAACAAAATGG + Intergenic
1022030661 7:26488963-26488985 TCAGCTAAGAAATTAAAAACAGG - Intergenic
1022061381 7:26799171-26799193 CCAGAAAATAAGTAACAAAATGG + Intronic
1022236176 7:28462937-28462959 CCAGCAACAAAAGAAAAAATAGG - Intronic
1022270384 7:28801500-28801522 ACAGCAAAGAAATGAAAATCTGG - Intronic
1022296781 7:29063041-29063063 CCAGGAAAGAAATAATACACAGG + Intronic
1022455502 7:30554879-30554901 CAAACAAACAAAGAAAAAACAGG - Intergenic
1022541746 7:31143667-31143689 CCAGAAAACAAATAACAAAATGG - Intergenic
1022575541 7:31493475-31493497 CAAGCAAATAAATAAGAAGAGGG - Intergenic
1022844818 7:34199547-34199569 CCAGAAAAAAAAAAAAAAAAGGG - Intergenic
1022940919 7:35238637-35238659 CCCTCAAATAAATTAAAAACAGG + Intronic
1022961699 7:35432384-35432406 CCAGCAAATAACACCAAAACAGG + Intergenic
1023159998 7:37287949-37287971 CAAACAAATAAACAAAAAAAAGG - Intronic
1023198681 7:37669490-37669512 CAAACAAACAAACAAAAAACAGG + Intergenic
1023860886 7:44217159-44217181 ACTGCAAATAAAAGAAAAACAGG - Exonic
1023887136 7:44367330-44367352 CAATCAAACAAACAAAAAACAGG + Intergenic
1023957001 7:44894490-44894512 CAAACAAACAAACAAAAAACTGG + Intergenic
1024170535 7:46780529-46780551 CCAGAAAACAAATAACAAAATGG + Intergenic
1024498549 7:50074382-50074404 CCAGAAAACAAATAATAAAATGG + Intronic
1024583083 7:50816372-50816394 CAAGAAAATAAAAAAAAAATAGG + Intergenic
1024601630 7:50986722-50986744 CAAACAAACAAACAAAAAACTGG - Intergenic
1024749966 7:52454209-52454231 CCAGGAAATGAACAAAAAAGAGG + Intergenic
1024831534 7:53464922-53464944 CTAGGAAATAAAAAAAATACAGG - Intergenic
1024889866 7:54187336-54187358 CCAGAAAATAAAAAAAAAACAGG + Intergenic
1024898605 7:54291381-54291403 CCAGAAAATAAATATGGAACTGG + Intergenic
1024908796 7:54421169-54421191 CCAGGAAATACGTAAAAAACAGG - Intergenic
1025764896 7:64434730-64434752 CAAACAAACAAACAAAAAACAGG - Intergenic
1025949881 7:66136215-66136237 CAAACCAATAAAAAAAAAACGGG - Intronic
1026147705 7:67761746-67761768 ACAACAAAAAAAAAAAAAACAGG + Intergenic
1026418673 7:70210093-70210115 CCAGCAAATGACTATAAAATTGG - Intronic
1026519008 7:71098952-71098974 CAAGCAAAAACATAAAAAACTGG + Intergenic
1026763932 7:73147793-73147815 CAAACAAACAAACAAAAAACAGG - Intergenic
1026925927 7:74193609-74193631 CAAGGAAAAAAAAAAAAAACTGG - Intronic
1027040401 7:74957566-74957588 CAAACAAACAAACAAAAAACAGG - Intergenic
1027083236 7:75244791-75244813 CAAACAAACAAACAAAAAACAGG + Intergenic
1027141198 7:75658922-75658944 CAAACAAACAAAGAAAAAACAGG + Intronic
1027245635 7:76365399-76365421 CCAAAAAACAAAAAAAAAACTGG - Intergenic
1027481055 7:78697272-78697294 CCACCATACAAATAAACAACAGG - Intronic
1027502917 7:78977851-78977873 CATGCAAACCAATAAAAAACAGG + Intronic
1027561484 7:79737138-79737160 CCACCAAAAAAAAAAAAAAAAGG - Intergenic
1027566098 7:79796742-79796764 CAAGCAAACAAACAAAAAACAGG + Intergenic
1027605125 7:80290504-80290526 CCAGAAAACAAATAACAAAATGG + Intergenic
1027808497 7:82861062-82861084 CCAGAAAATAAACAACAAAATGG + Intronic
1027960289 7:84937917-84937939 CCAGAAAATAATTAACAAAATGG + Intergenic
1028036007 7:85983192-85983214 TCAGCAAAAATACAAAAAACGGG + Intergenic
1028150470 7:87365903-87365925 AAAACAAATAAATAAACAACAGG - Intronic
1028152671 7:87392359-87392381 CCAGGAAAGAAATAAGAAGCAGG + Intronic
1028161239 7:87487254-87487276 CCAGAAAACAAATAATAAAATGG + Intergenic
1028181648 7:87731371-87731393 CCAGAAAACAAATTAAAAAATGG + Intronic
1028308157 7:89292662-89292684 CCAGAAAACAAATTAAAAAATGG + Intronic
1028328139 7:89552275-89552297 TCAGCAAATAAGTAAAAGAGAGG - Intergenic
1028339262 7:89697566-89697588 CCAGAAAACAAATAACAAAATGG + Intergenic
1028365463 7:90024520-90024542 CCAGAAAACAAATAACAAAATGG + Intergenic
1028564052 7:92207872-92207894 CAAACAAATAAATAAATAAATGG + Intronic
1028832526 7:95343111-95343133 CAGGCATATAAATAACAAACTGG - Intergenic
1028929257 7:96394920-96394942 CCAGAAAACAAATAACAAAATGG - Intergenic
1028950332 7:96628271-96628293 CCAGAAAACAAATAACAAAATGG - Intronic
1028960110 7:96739082-96739104 CCAACAAATAAATTTAAAATGGG - Intergenic
1029042426 7:97591461-97591483 CCAGAAAACAAATAACAAATTGG - Intergenic
1029046432 7:97634175-97634197 CAAACAAACAAACAAAAAACTGG + Intergenic
1029653293 7:101908444-101908466 CAAACAAACAAACAAAAAACAGG - Intronic
1029716332 7:102329186-102329208 CAAACAAACAAACAAAAAACAGG + Intergenic
1029722967 7:102382392-102382414 CAAACAAACAAACAAAAAACAGG + Intronic
1029910426 7:104140509-104140531 CCAGAAACAAAACAAAAAACTGG - Intronic
1029924195 7:104298361-104298383 CAAACAAACAAACAAAAAACTGG - Intergenic
1030408069 7:109140324-109140346 CCAGAAAACAAATAACAAAATGG - Intergenic
1030478990 7:110078179-110078201 CCAGTAATCAAATAAAAAAATGG - Intergenic
1030852223 7:114503017-114503039 CTAGAAAATCAATAAACAACAGG + Intronic
1030860038 7:114614358-114614380 CCAACAATTAAATAGAAAAAAGG - Intronic
1030864350 7:114680564-114680586 CCAGTAAATAAATGAATCACTGG + Intronic
1031042463 7:116852743-116852765 CAAACAAACAAACAAAAAACAGG + Intronic
1031127028 7:117786434-117786456 CAAACAAACAAACAAAAAACAGG + Intronic
1031238460 7:119208413-119208435 GCAGCAAATAAATAATCAACAGG + Intergenic
1031260237 7:119508418-119508440 CCAGAAAACAAATAAAAAAATGG + Intergenic
1031280436 7:119793543-119793565 CCAGAAAACAAATAACAAAATGG - Intergenic
1031334224 7:120506909-120506931 TCAGAAAATAAATAAATAAAAGG - Intronic
1031349088 7:120706265-120706287 CCAAAAAATAAATAAATAAGGGG + Intronic
1031438462 7:121762658-121762680 CAAACAAACAAACAAAAAACAGG + Intergenic
1031521823 7:122776586-122776608 CAAACAAACAAACAAAAAACAGG + Intronic
1031545567 7:123048182-123048204 CCAGAAAACAAATAACAAAATGG - Intergenic
1032026755 7:128448974-128448996 TCAACAAATAAATATAAAACAGG + Intergenic
1032137279 7:129291513-129291535 CCTGCAAAAAAAAAAAAAAAAGG - Intronic
1032273206 7:130430644-130430666 CAAACAAACAAACAAAAAACAGG + Intronic
1032327308 7:130942017-130942039 ACAGAAAATCAATAAAAGACTGG + Intergenic
1033327043 7:140388470-140388492 CCAGAAAAAAAAAAAAATACTGG + Intronic
1033489002 7:141822995-141823017 CCAGAAAACAAATAACAAAATGG - Intergenic
1033500151 7:141939542-141939564 CCAGAAAACAAATAACAAAATGG + Intronic
1033577721 7:142702084-142702106 CAAACAAACAAACAAAAAACTGG + Intergenic
1033624431 7:143094862-143094884 CAAACAAAAAAATCAAAAACAGG + Intergenic
1033774336 7:144590591-144590613 CCAGGAAAAAAATGCAAAACTGG + Intronic
1033826316 7:145194493-145194515 CAAACAAACAAACAAAAAACGGG - Intergenic
1033887458 7:145966300-145966322 CCAGAAAATAAATAACAAAGTGG + Intergenic
1033912511 7:146282124-146282146 CCAGCTATCAAATAAAAGACTGG - Intronic
1034581427 7:152046824-152046846 CCAGAAAACAAATAATAAAAAGG - Intronic
1034630016 7:152523624-152523646 CAAACAAACAAACAAAAAACAGG - Intergenic
1034896531 7:154879760-154879782 ACCGTAAATAAATAAAAGACTGG + Intronic
1035311414 7:157971668-157971690 CAAGCCAATAAAAAAAAAAGTGG + Intronic
1036114507 8:5944132-5944154 GCAGCACATAAAAAAAAAAAAGG + Intergenic
1036165562 8:6429526-6429548 CAAACAAATAAAAAAAAAAAGGG - Intronic
1036447442 8:8834150-8834172 CAAACAAACAAACAAAAAACAGG + Intronic
1036777619 8:11624516-11624538 CCAGCAAAAAAAAAAAAAAAAGG - Intergenic
1037287169 8:17313715-17313737 CCAGCAAAGTAATTAAAAATGGG + Intronic
1037444584 8:18951986-18952008 CAAACAAACAAACAAAAAACTGG + Intronic
1038014876 8:23506126-23506148 ACTTCAAAAAAATAAAAAACCGG - Intergenic
1038632329 8:29257842-29257864 CCAACCAACAAACAAAAAACAGG + Intronic
1038784485 8:30599274-30599296 CAAAAAAATAAATAAATAACTGG + Intronic
1038860499 8:31383114-31383136 CCAGGAAACAAATAACAAAATGG + Intergenic
1038882581 8:31630914-31630936 TCAGTAAATACAGAAAAAACTGG + Intergenic
1039254644 8:35705519-35705541 CCAGCAAATAAATATTTAAAGGG - Intronic
1039727875 8:40239907-40239929 CCAGAAAACAAATAACAAAATGG - Intergenic
1039870060 8:41538684-41538706 CAACCAAACAAATAAAAAAAGGG - Intronic
1040025499 8:42778267-42778289 CAAGCAAACAAATAAAAAATAGG + Intronic
1040478873 8:47805648-47805670 TAAGCAACTAAATAAAAAATGGG - Intronic
1040511227 8:48097508-48097530 CCAGAAAACAAATAACAAAATGG - Intergenic
1040739613 8:50557220-50557242 CCAAAAAAAAAAAAAAAAACAGG + Intronic
1040841425 8:51789193-51789215 ACAGCAAAAAAAAAAAAAATGGG - Intronic
1040921173 8:52619512-52619534 CAAGCAAAAAAGGAAAAAACAGG + Intergenic
1041318386 8:56587973-56587995 CTAGCTAATAAATGAAAAATAGG - Intergenic
1041676448 8:60544815-60544837 ACAGAAAATTAATAAACAACAGG - Intronic
1041701496 8:60794121-60794143 TCAAAAAATAAAAAAAAAACTGG + Intronic
1041824322 8:62075413-62075435 CAAGCAAACAAACAAAAACCAGG - Intergenic
1042082317 8:65068692-65068714 CCAGAAAACAAATAACAAAATGG - Intergenic
1042530262 8:69807691-69807713 CAAACAAACAAACAAAAAACAGG - Intronic
1042560254 8:70068633-70068655 ACAACAAATAAATATCAAACTGG - Intronic
1042856619 8:73273745-73273767 TCAGAAAAAAAAAAAAAAACTGG - Intergenic
1042898664 8:73698267-73698289 CCAGAAAACAAATAACAAAATGG + Intronic
1042980618 8:74522770-74522792 CCAGAAAACAAATAACAAAATGG + Intergenic
1043015680 8:74938039-74938061 CCAGAAAACAAATAACAAAATGG - Intergenic
1043124230 8:76368492-76368514 AAATCAAATAAATAAAAAATAGG - Intergenic
1043567567 8:81564792-81564814 CCAGAAAACAAATAAGAAACTGG + Intergenic
1043620419 8:82184525-82184547 CAAGCAAACAAACAAAAACCTGG + Intergenic
1043620487 8:82185839-82185861 CAAGGAAACAAACAAAAAACCGG + Intergenic
1043636336 8:82388059-82388081 CCAGTCAAAAAAAAAAAAACTGG - Intergenic
1043739945 8:83798878-83798900 CCAGAAAACAAATAATAAAATGG - Intergenic
1043767652 8:84157364-84157386 CTAGAAAAAAAAAAAAAAACGGG + Intergenic
1043945736 8:86250308-86250330 CCAGAAAACAAATAACAAAATGG - Intronic
1043986363 8:86697079-86697101 CCAGAAAGCAAATAACAAACTGG + Intronic
1043998292 8:86845871-86845893 CCAGAAAACAAATAAGAAAATGG + Intergenic
1044061575 8:87643373-87643395 CAAGAAAAAAAAAAAAAAACAGG - Intergenic
1044189590 8:89299253-89299275 TCAGCAAATAGAAAAATAACTGG + Intergenic
1044192792 8:89339827-89339849 CCAGAAAACAAATAACAAAATGG - Intergenic
1044331078 8:90921008-90921030 CAAACAAACAAACAAAAAACTGG - Intronic
1044454199 8:92373437-92373459 CCAGACAATAAATTAACAACAGG + Intergenic
1044543616 8:93435235-93435257 CAAACAAACAAACAAAAAACAGG + Intergenic
1044624646 8:94225351-94225373 CAAGCAAATAAATGAAAAGCAGG + Intergenic
1044643848 8:94416550-94416572 CAAACAAATCAATAGAAAACAGG + Intronic
1044682957 8:94800387-94800409 CAAACAAAAAAAAAAAAAACAGG + Intergenic
1044878210 8:96694226-96694248 CCAGAAAACAAATAATAAAATGG + Intronic
1045048211 8:98299293-98299315 CAAACAAACAAACAAAAAACTGG + Intergenic
1045072162 8:98519292-98519314 CAAACAAACAAACAAAAAACTGG + Intronic
1045135593 8:99213819-99213841 CCAGCCAAAAAAAAAAAAAAAGG - Intronic
1045328686 8:101136694-101136716 CAAACAAACAAACAAAAAACTGG + Intergenic
1045441290 8:102214809-102214831 CCAATAAATAAATAAGAAAATGG + Intronic
1045590206 8:103585122-103585144 CCAACAAACATATGAAAAACAGG + Intronic
1045605858 8:103774220-103774242 TCAATAAATAAATAATAAACTGG + Intronic
1046207874 8:111026132-111026154 AAAGCAAATAAAAAATAAACTGG + Intergenic
1046298428 8:112253842-112253864 ACAGCAAATATATAAAAATGCGG - Intronic
1046553035 8:115740496-115740518 TCAACAAAGAAAAAAAAAACAGG - Intronic
1046640038 8:116719532-116719554 ACAGCACACAAATAAAAAAGAGG + Intronic
1046825922 8:118691398-118691420 CCAGCAAACATATAAAAAAATGG - Intergenic
1047098354 8:121648676-121648698 TAAACAAATAAATAAAAAGCTGG - Intergenic
1047227811 8:122971287-122971309 CCAGGAAAAAAAAAAAAAAAAGG - Intronic
1047604182 8:126457958-126457980 CCATCAAAAAAAAAAAAAAAGGG + Intergenic
1047789603 8:128189517-128189539 CCAAAAAATAAATAAATAAGAGG - Intergenic
1047830152 8:128620757-128620779 CCAGCATTTAAAAAAAAAAAAGG - Intergenic
1047910359 8:129521204-129521226 CCAGAAAACAAATAACAAAATGG + Intergenic
1047967279 8:130055531-130055553 CCAGTAAAAAAAAAAAAAAAAGG + Intronic
1048118989 8:131557918-131557940 CCAGCAAACAAATAATAAAATGG + Intergenic
1048359160 8:133680921-133680943 CCTGTAAACAAATATAAAACTGG + Intergenic
1048400259 8:134059695-134059717 CCAGAAAATAATTAACAAAATGG + Intergenic
1049079117 8:140427845-140427867 CCACCATTAAAATAAAAAACAGG + Intronic
1049081209 8:140444863-140444885 TCAGGAAAAAAAAAAAAAACAGG + Intronic
1050002054 9:1087670-1087692 CCAGAAAATCAACAAGAAACAGG - Intergenic
1050134799 9:2450830-2450852 CTAGAAAAAAAAAAAAAAACAGG - Intergenic
1050312551 9:4368335-4368357 CCAAAAAAAAAAAAAAAAACAGG - Intergenic
1050338948 9:4616577-4616599 CAAACAAACAAACAAAAAACTGG - Intronic
1050392432 9:5159250-5159272 CCAGAAAATATATAACAAAATGG + Intronic
1050582019 9:7068619-7068641 CCAGCAAAGAAACCAAAACCAGG - Intronic
1050643975 9:7699565-7699587 CCAGAAAACAAATAACAAAATGG - Intergenic
1050914226 9:11110684-11110706 CCAGAAAACAAATAACAAAATGG + Intergenic
1050969907 9:11856541-11856563 CAAACAAACAAACAAAAAACGGG - Intergenic
1051469488 9:17421602-17421624 CCAGAAAATAAATAACAAAATGG - Intronic
1051550882 9:18327933-18327955 CAAACAAACAAACAAAAAACAGG - Intergenic
1051645883 9:19267965-19267987 CCAGAAAACAAATAACAAAATGG - Intronic
1051741863 9:20260089-20260111 CAAACAAATAAATAAATAAAAGG + Intergenic
1051954011 9:22667640-22667662 CCACCAAAAAAAAAAAAAAAAGG + Intergenic
1051965813 9:22828360-22828382 CCAGAGAATAAATAACAAAATGG - Intergenic
1051987162 9:23105005-23105027 CCAGTAAATTAATAAAGAAAAGG - Intergenic
1051990852 9:23151124-23151146 CCAGAAAACAAATAATAAAATGG - Intergenic
1052214259 9:25946221-25946243 CAAACAAACAAACAAAAAACTGG - Intergenic
1052318454 9:27141303-27141325 CCATTAATAAAATAAAAAACAGG - Intronic
1052356442 9:27509715-27509737 CCTCCAAAAAAACAAAAAACAGG - Intronic
1052420508 9:28237400-28237422 CCAGAAAAGAAATAATAAAATGG + Intronic
1052459046 9:28739519-28739541 CCAGCAAATAATAATACAACAGG + Intergenic
1052566012 9:30152856-30152878 CCAGAAAACAAATAACAAAATGG - Intergenic
1052738389 9:32369065-32369087 CAAACAAACAAACAAAAAACAGG + Intergenic
1053046551 9:34924803-34924825 CCAGAAAACAAATAACAAAATGG - Intergenic
1053204999 9:36178748-36178770 CCAGAAAACAAATAACAAACTGG + Intergenic
1054953027 9:70874382-70874404 CCAGGATACAAATAAAAATCTGG + Intronic
1054983730 9:71237040-71237062 CCATCAAAAAAAAAAAAAAAAGG + Intronic
1055243531 9:74214658-74214680 CCAGAAAACAAATAATAAAATGG - Intergenic
1055289211 9:74765346-74765368 AGAGCAAAAAAAAAAAAAACAGG + Intronic
1055302348 9:74894998-74895020 CCAGAAAATAAATAACAAAATGG + Intergenic
1055387448 9:75777648-75777670 CCAGAAAACAAATAACAAAATGG + Intergenic
1055555184 9:77466610-77466632 CAAACAAACAAACAAAAAACAGG - Intronic
1055599599 9:77901861-77901883 CCATCAATTAATTAAGAAACTGG - Intronic
1055605464 9:77965834-77965856 CGAGCAAAAAAAAAAAAAAAAGG + Intronic
1055827287 9:80341999-80342021 CCAGAAAACAAATAACAAAATGG + Intergenic
1055841263 9:80507127-80507149 GTAGCCAATAAAAAAAAAACTGG + Intergenic
1055967208 9:81877091-81877113 CAAACAAATAAAAAAAAAATAGG + Intergenic
1056184139 9:84116299-84116321 CCAGAATATAAATAACAAAATGG - Intergenic
1056211025 9:84365709-84365731 ACAGTAAAAGAATAAAAAACTGG - Intergenic
1056254733 9:84787327-84787349 CAAACAAACAAACAAAAAACAGG + Intronic
1056723869 9:89094951-89094973 CAAACAAACAAACAAAAAACAGG + Intronic
1056768147 9:89457731-89457753 AAAGCAAATAAACAAAAAACAGG + Intronic
1057288834 9:93786442-93786464 CCAGAAAATAAGTAACAAAATGG - Intergenic
1058000498 9:99860338-99860360 AAAGCAAACAAACAAAAAACTGG - Intronic
1058232730 9:102449323-102449345 CGAGAAAATAAATAACAAAATGG + Intergenic
1058422352 9:104844024-104844046 CCAGAAAAAAAAAAAAAACCAGG + Intronic
1058558230 9:106194048-106194070 CCAGAAAACAAATAACAAAATGG - Intergenic
1059094968 9:111402915-111402937 CCAGAAAACAAAAAACAAACTGG + Intronic
1059535543 9:115077057-115077079 CAAAAAAATAAATAAATAACTGG - Intronic
1059591677 9:115669169-115669191 GCAGGAAATAAATAAAGAAATGG - Intergenic
1059715062 9:116905849-116905871 CCCCCAAAAAAAAAAAAAACAGG - Intronic
1059890726 9:118799170-118799192 CCAGAAATGAAACAAAAAACTGG + Intergenic
1060501576 9:124161192-124161214 CAAACAAACAAACAAAAAACTGG + Intergenic
1060652415 9:125340011-125340033 CAAACAAACAAACAAAAAACAGG - Intronic
1061251678 9:129430078-129430100 ACAGAAAAAAAAAAAAAAACAGG - Intergenic
1061371071 9:130197964-130197986 CCAGAAAAAAAAAAAAAAAAAGG + Intronic
1061964988 9:134008354-134008376 CAAACAAACAAACAAAAAACAGG - Intergenic
1062230198 9:135478163-135478185 CCAACAGAAAAATAAAAAATGGG + Intergenic
1062675205 9:137739069-137739091 CTAGTAAAAAAAAAAAAAACAGG + Intronic
1203628879 Un_KI270750v1:51817-51839 ATAGCAAATAAAGAAAAAAAAGG - Intergenic
1185484797 X:474185-474207 GTAGAAAATAAATAACAAACTGG - Intergenic
1185622139 X:1456581-1456603 CAAACAAACAAACAAAAAACAGG - Intergenic
1185656497 X:1689764-1689786 TCAAAAAATAAATAAATAACAGG - Intergenic
1185682816 X:1902411-1902433 ACAGCAGATAAAGAAAACACAGG - Intergenic
1185856573 X:3541879-3541901 CAAACAAACAAACAAAAAACCGG + Intergenic
1186056261 X:5652971-5652993 CCATCAAACAAATTAGAAACAGG - Intergenic
1186119043 X:6338618-6338640 CCACCAAATAAATAATAAGTAGG - Intergenic
1186581427 X:10823726-10823748 CCAGTAAATAAAACAAGAACTGG + Intronic
1186745373 X:12562608-12562630 GCAGAAAATGAATAAAACACAGG + Intronic
1187407654 X:19018267-19018289 CAAACAAACAAACAAAAAACTGG - Intronic
1187618467 X:21024668-21024690 CCAGAAAACAAATAACAAAAAGG - Intergenic
1187651822 X:21417939-21417961 CCAGAAAACAAATAACAAAATGG - Intronic
1187683663 X:21794658-21794680 ACAGAAAATAAAAAAGAAACTGG + Intergenic
1187781252 X:22828359-22828381 AAAATAAATAAATAAAAAACAGG + Intergenic
1187934110 X:24319340-24319362 TCAGTAAAAAAAAAAAAAACAGG - Intergenic
1187994239 X:24908128-24908150 TCAGAAAATAAATAATAAAATGG + Intronic
1188068563 X:25692374-25692396 CCAGAAAACAAATAACAAAATGG - Intergenic
1188094407 X:26003736-26003758 CAAACAAGTAAATAAAATACTGG + Intergenic
1188161618 X:26811922-26811944 CCAGAAAACAAATAACAAAATGG - Intergenic
1188426818 X:30058081-30058103 CCAGAAAACAAATAACAAAACGG - Intergenic
1188473813 X:30568966-30568988 CCAGCAAAAAAAAAAAAAAAAGG + Intronic
1188555134 X:31402711-31402733 TCAGCAAATAAAGATCAAACAGG + Intronic
1188953818 X:36410331-36410353 CCAGAAAACAAATAAGAAAATGG - Intergenic
1188972100 X:36630410-36630432 CCATAAAACAAATAATAAACTGG - Intergenic
1188994498 X:36866644-36866666 CAAACAAACAAACAAAAAACAGG - Intergenic
1189584959 X:42449950-42449972 CCAGAAAACAAATAACAAAATGG + Intergenic
1189657737 X:43264504-43264526 CTAGAAAACAAATAAAAAAATGG - Intergenic
1189782271 X:44526469-44526491 ACAGTAAAAAAATAAAAAAGGGG + Intronic
1189822957 X:44888004-44888026 CAAACAAACAAACAAAAAACTGG + Intronic
1189870266 X:45374095-45374117 CCAGAAAACAAATAACAAAATGG + Intergenic
1189976877 X:46470015-46470037 ACAGAAAATAAATAAAAAAATGG - Intronic
1190100167 X:47516712-47516734 CAAACAAACAAACAAAAAACAGG + Intergenic
1190124575 X:47692523-47692545 TAAATAAATAAATAAAAAACTGG - Intergenic
1190156367 X:47996485-47996507 CCAGAAAACAAATAATAAAGTGG + Intronic
1190226655 X:48551321-48551343 CAAACAAACAAACAAAAAACAGG - Intronic
1190228558 X:48563827-48563849 CCACCAAAGAAAAAATAAACTGG + Intergenic
1190253613 X:48746172-48746194 GGAGCAAAAAAAAAAAAAACTGG + Intergenic
1190498370 X:51050176-51050198 CCAGAAAATAAGTAATAAAATGG + Intergenic
1190498713 X:51053978-51054000 GCAGAAAAAAAAAAAAAAACTGG - Intergenic
1190614837 X:52219822-52219844 CCAGAAAACAAATAACAAAAGGG + Intergenic
1190683198 X:52847308-52847330 CAAACAAACAAACAAAAAACAGG - Intergenic
1191116188 X:56855647-56855669 CCAGAAAACAAATAACAAAATGG - Intergenic
1191118955 X:56882631-56882653 CCAGAAAATAAATAAGAAAATGG - Intergenic
1191204802 X:57822407-57822429 CAAACAAACAAACAAAAAACGGG - Intergenic
1191646841 X:63490934-63490956 CCAGGAAACAAATAACAAAATGG + Intergenic
1191700867 X:64040840-64040862 CCAGAAAACAAATAAGAAATGGG + Intergenic
1191989869 X:67023154-67023176 CAAGAAAATAAATAAACAAGTGG - Intergenic
1192027406 X:67468775-67468797 CCAGAAAACAAATAAGAAAATGG + Intergenic
1192060421 X:67819163-67819185 CCAGAAAACAAATAACAAAATGG + Intergenic
1192062741 X:67845781-67845803 ACAGAAAATAAATAATAAAATGG + Intergenic
1192073671 X:67967464-67967486 CCAGAAAACAAATAACAAAATGG + Intergenic
1192138113 X:68624514-68624536 CCAGAAAACAAATAACAAAATGG - Intergenic
1192193334 X:69011058-69011080 TGAGCAAATAAATGAAAAACTGG - Intergenic
1192406331 X:70889896-70889918 CCAGAAAATAAATAACAAAATGG + Intronic
1192458164 X:71294916-71294938 CAAAAAAATAAATAAAAGACTGG + Intronic
1192611358 X:72570602-72570624 CCATCAAAAAAAAAAAAAAAAGG + Intronic
1192671525 X:73148314-73148336 CCAGAAAACAAATAACAAAATGG - Intergenic
1192695337 X:73408547-73408569 CCAGAAAACAAATAACAAAATGG + Intergenic
1192738104 X:73867918-73867940 CCAGAAAATAACTAACAAAATGG + Intergenic
1192821526 X:74651088-74651110 CCAGAAAACAAATAACAAAATGG - Intergenic
1192855738 X:75009666-75009688 CCAGAAAACAAATAATAAAATGG - Intergenic
1192887698 X:75353418-75353440 CCAGAAAACAAATAACAAAATGG - Intergenic
1192959732 X:76114911-76114933 CCAGAAAATAAATAACAAAATGG + Intergenic
1193028222 X:76868817-76868839 CCAGAAAACAAATAAAAGAATGG + Intergenic
1193092845 X:77512973-77512995 CCAGAAAACAAATAACAAAATGG + Intronic
1193175384 X:78386619-78386641 CCAGAAAACAAATAAGAAAATGG + Intergenic
1193186333 X:78517571-78517593 CCATCAAAAAAAAAAAAAACTGG - Intergenic
1193277417 X:79605266-79605288 ACAGCAAATTAAGAAAAACCAGG + Intergenic
1193316694 X:80073177-80073199 CCACCAAACAAATGGAAAACAGG - Intergenic
1193345470 X:80398416-80398438 AAAGCAAATAAAAAACAAACAGG - Intronic
1193369718 X:80680056-80680078 CCATCAAATAACTTAAAAATAGG - Intronic
1193409248 X:81143240-81143262 CCAGAAAACAAATAACAAAATGG + Intronic
1193413019 X:81187732-81187754 CCAGAAAACAAATAATAAAATGG - Intronic
1193498601 X:82243276-82243298 CCACCAAATGTATAAAATACTGG + Intergenic
1193596198 X:83449185-83449207 CCAGAAAACAAATAACAAAATGG - Intergenic
1193650587 X:84125963-84125985 CCAGAAAACAACTAAAAAAATGG + Intronic
1193665644 X:84312501-84312523 CCAGAAAACAAATAACAAAATGG + Intergenic
1193778689 X:85676656-85676678 AAAGCAAACAAACAAAAAACTGG - Intergenic
1193874920 X:86850440-86850462 CAAACAAATAAATAAATAAATGG - Intergenic
1193905707 X:87241771-87241793 CCAGAAAACAAATAAGAAAATGG - Intergenic
1194016824 X:88632300-88632322 CCAGAAAACAAATAACAAAATGG + Intergenic
1194054951 X:89120260-89120282 ACAGCAAACAAACAAAAAACTGG + Intergenic
1194196518 X:90900975-90900997 CCAGAAAACAAATAACAAAATGG - Intergenic
1194236141 X:91385501-91385523 CCAGAAAACAAATAACAAAATGG + Intergenic
1194274590 X:91863629-91863651 CCAGGAAACAAATAATAAAATGG - Intronic
1194285458 X:92005225-92005247 CCAGAAAATAAATAAGAAAATGG - Intronic
1194338492 X:92679879-92679901 CCAGAAAATAAATAACAAAATGG - Intergenic
1194415329 X:93605080-93605102 CCAACAAATAAAAAAAAAGTGGG - Intergenic
1194479144 X:94398898-94398920 CCAGAAAACAAATAACAAAAGGG - Intergenic
1194480892 X:94422766-94422788 CCAGAAAATAAATAACAAAGTGG - Intergenic
1194506570 X:94740871-94740893 CTAGAAAACAAATAACAAACTGG - Intergenic
1194515477 X:94846317-94846339 CCAGAAAACAAATAATAACCTGG - Intergenic
1194530214 X:95038245-95038267 CCAGCTAATACACAAAGAACTGG - Intergenic
1194575201 X:95604596-95604618 ATATCAAAAAAATAAAAAACTGG - Intergenic
1194605934 X:95977561-95977583 CCAGAAAACAAATAACAAAATGG + Intergenic
1194614935 X:96088336-96088358 CAAACCAATAAATAAAATACTGG + Intergenic
1194796128 X:98213123-98213145 CCAGAAAACAAATAACAAAATGG + Intergenic
1194892339 X:99395842-99395864 CCAGAAAACAAATAACAAAATGG - Intergenic
1194991001 X:100546686-100546708 CCAGAAAACAAATAACAAAATGG + Intergenic
1195172008 X:102278729-102278751 CCAGAAAACAAATAACAAAATGG - Intergenic
1195186852 X:102408364-102408386 CCAGAAAACAAATAACAAAATGG + Intronic
1195199724 X:102536083-102536105 CCAGAAAACAAATAACAAAATGG + Intergenic
1195289901 X:103422581-103422603 CCAGAAAACAAATAAGAAAAAGG - Intergenic
1195300205 X:103522379-103522401 CTAGCAGAAAAAAAAAAAACAGG + Intergenic
1195396376 X:104414822-104414844 CCAGAAAACAAATAACAAAATGG + Intergenic
1195584887 X:106553453-106553475 CCAGAAAACAAATAACAAAATGG + Intergenic
1195601479 X:106753566-106753588 CCAGAAAACAAATAATAAAATGG + Intronic
1195650733 X:107281052-107281074 CCAGAAAACAAATAACAAAATGG + Intergenic
1195806939 X:108784215-108784237 TCATCAAATAAAAAAAAAAGAGG - Intergenic
1195820250 X:108937324-108937346 CCAGAAAACAAATAACAAAATGG - Intergenic
1195823724 X:108973847-108973869 ACAGCATATAAACAAAAACCAGG + Intergenic
1195824748 X:108987292-108987314 CCAGAAAACAAATTAAAAAATGG - Intergenic
1195847303 X:109242025-109242047 CAACCAAACAAACAAAAAACTGG - Intergenic
1196003158 X:110807915-110807937 CAAGCATATAAATAAAATAGGGG + Intergenic
1196040002 X:111192345-111192367 CCAAAAAATAAAAAAAAAAGTGG + Intronic
1196247608 X:113418133-113418155 CCAGAAAACAAATAAGAAAATGG + Intergenic
1196269182 X:113690969-113690991 CCAGAAAACAAATTAAAAAATGG - Intergenic
1196461158 X:115933142-115933164 CCAGAAAACAAATAATAAAATGG - Intergenic
1196508094 X:116473344-116473366 CCAGAAAACAAATAACAAAATGG - Intergenic
1196508787 X:116480615-116480637 CCAGAAAACAAATAACAAAATGG + Intergenic
1196551377 X:117030468-117030490 TCAGGAAATAAATAGATAACAGG - Intergenic
1196578895 X:117356564-117356586 CCAGAAATTAAATAACAAAATGG - Intergenic
1196639524 X:118041831-118041853 CCAGAAAACAAATAACAAAATGG + Intronic
1197003251 X:121464982-121465004 CCAGAAAATAAATAACAAAATGG - Intergenic
1197073409 X:122326808-122326830 GCAGCCACCAAATAAAAAACTGG + Intergenic
1197100925 X:122653928-122653950 CCAGAAAATCAATTAAAAATTGG + Intergenic
1197104664 X:122699968-122699990 CCAGCAAACAAACAAATAAGTGG - Intergenic
1197105197 X:122705479-122705501 CCAGAAAACAAATAACAAAATGG + Intergenic
1197358259 X:125464667-125464689 CCAGTAAAATAATATAAAACTGG - Intergenic
1197623309 X:128776682-128776704 CCAGAAAACAAATAACAAAATGG - Intergenic
1197672115 X:129288724-129288746 CCAGGAAACAAATAATAAAATGG + Intergenic
1198027402 X:132720526-132720548 CCAGAAAATAAATAACAAAATGG + Intronic
1198091093 X:133330963-133330985 CAAACAAACAAACAAAAAACAGG + Intronic
1198430555 X:136562321-136562343 CCAGAAAACAAATAACAAAATGG - Intergenic
1198478541 X:137018843-137018865 ACAGCAGATAAAACAAAAACGGG - Intergenic
1198537945 X:137604742-137604764 CCAGAAAACAAATAACAAAATGG + Intergenic
1198578735 X:138039537-138039559 CCAGAAAACAAATAATAAAATGG + Intergenic
1198605731 X:138334525-138334547 CCAGATAATAAACAAAAATCTGG - Intergenic
1198612205 X:138414099-138414121 CCAGAAAACAAATAACAAAATGG + Intergenic
1198696991 X:139352539-139352561 CCAGAAAACAAATAACAAAATGG - Intergenic
1198781527 X:140242266-140242288 CCAGAAAATAAATAACAAAAGGG - Intergenic
1198809339 X:140519754-140519776 CAAACAAACAAACAAAAAACAGG - Intergenic
1198813857 X:140565788-140565810 CCAACAAATCAATAATAAAAAGG - Intergenic
1198816083 X:140591842-140591864 CAAACAAACAAACAAAAAACTGG - Intergenic
1198965651 X:142227028-142227050 AAAGCAAATAAATAAAAAAATGG + Intergenic
1198982175 X:142410885-142410907 CCAGAAAACAAATAACAAAATGG + Intergenic
1199153813 X:144522985-144523007 CCAGAAAACAAATAACAAAATGG - Intergenic
1199236619 X:145500888-145500910 CGAGCAAAAAAATCAAAACCTGG + Intergenic
1199241823 X:145555524-145555546 CAACCCAATAAATAAAATACTGG + Intergenic
1199247907 X:145628005-145628027 CCAGAAAACAAATAACAAAATGG + Intergenic
1199316457 X:146384317-146384339 CAAGCAAACAAACAAAAACCAGG - Intergenic
1199434924 X:147802482-147802504 AAATAAAATAAATAAAAAACTGG + Intergenic
1199442772 X:147887386-147887408 CCAGAAAACAAATAACAAAAAGG - Intergenic
1199454797 X:148016485-148016507 CCAGAAAACAAATAACAAAATGG - Intronic
1199795354 X:151190655-151190677 CAAACAAAAAAACAAAAAACTGG + Intergenic
1200369768 X:155712714-155712736 CCAGAAAACAAATAACAAAATGG - Intergenic
1200542364 Y:4475175-4475197 CCAGAAAACAAATAACAAAATGG - Intergenic
1200591830 Y:5085036-5085058 CCAGGAAACAAATAATAAAATGG - Intronic
1200603029 Y:5229765-5229787 CCAGAAAATAAATAAGAAAATGG - Intronic
1200646896 Y:5796662-5796684 CCAGAAAATACATAACAAAATGG - Intergenic
1200666358 Y:6030372-6030394 CCAGAAAACAAATAACAAAATGG - Intergenic
1200812118 Y:7496924-7496946 CCAACAATTAAAGTAAAAACTGG - Intergenic
1200877086 Y:8168474-8168496 CAAACAAACAAACAAAAAACAGG + Intergenic
1200944038 Y:8814402-8814424 CCAGAAAAAAACTGAAAAACTGG + Intergenic
1201501413 Y:14647014-14647036 CCAGCAAGTTAACAAATAACTGG - Intronic
1201639036 Y:16159135-16159157 CCAAAAAAAAAAAAAAAAACTGG - Intergenic
1201672038 Y:16533740-16533762 CAAACAAATAAACAAAAAAAAGG + Intergenic
1201944824 Y:19500554-19500576 CAAACAAATAAATAAATAAAGGG + Intergenic
1202019595 Y:20450785-20450807 CCAGAAAAGAGAGAAAAAACAGG + Intergenic
1202143242 Y:21751172-21751194 CCAGCACATAGAGAAAAAGCTGG - Intergenic
1202595672 Y:26537036-26537058 CCAGAAAACAAATAACAAAATGG + Intergenic