ID: 1092720957

View in Genome Browser
Species Human (GRCh38)
Location 12:11440043-11440065
Sequence GACCTGCTCTCTGTTTGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 1, 2: 0, 3: 17, 4: 151}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092720957_1092720959 -4 Left 1092720957 12:11440043-11440065 CCTGCACAAACAGAGAGCAGGTC 0: 1
1: 1
2: 0
3: 17
4: 151
Right 1092720959 12:11440062-11440084 GGTCAGTAATGGCACTGCACAGG 0: 1
1: 0
2: 0
3: 8
4: 88
1092720957_1092720960 11 Left 1092720957 12:11440043-11440065 CCTGCACAAACAGAGAGCAGGTC 0: 1
1: 1
2: 0
3: 17
4: 151
Right 1092720960 12:11440077-11440099 TGCACAGGCAAGAGCCACCATGG 0: 1
1: 0
2: 3
3: 43
4: 702
1092720957_1092720961 12 Left 1092720957 12:11440043-11440065 CCTGCACAAACAGAGAGCAGGTC 0: 1
1: 1
2: 0
3: 17
4: 151
Right 1092720961 12:11440078-11440100 GCACAGGCAAGAGCCACCATGGG 0: 1
1: 0
2: 1
3: 19
4: 225
1092720957_1092720963 25 Left 1092720957 12:11440043-11440065 CCTGCACAAACAGAGAGCAGGTC 0: 1
1: 1
2: 0
3: 17
4: 151
Right 1092720963 12:11440091-11440113 CCACCATGGGTTCAGCAGCATGG 0: 1
1: 0
2: 0
3: 15
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092720957 Original CRISPR GACCTGCTCTCTGTTTGTGC AGG (reversed) Intronic
901570735 1:10158240-10158262 CACCAGCTCTCTGATTTTGCAGG + Intronic
906513396 1:46424128-46424150 CACCTGCTCCCTGTGTCTGCGGG - Intergenic
908137939 1:61152217-61152239 GACCTGCTGCCTCTTTGGGCAGG - Intronic
909165759 1:72222081-72222103 GACCTGTTCTCTGTGTCTACAGG - Intronic
912323956 1:108740171-108740193 GACTTGCTCTGTGTTTGGGGAGG - Intronic
912749593 1:112275298-112275320 GATCTGCACTCAATTTGTGCAGG + Intergenic
916975896 1:170077650-170077672 GAACTGCTCTATGATTGTGCAGG - Intronic
918836761 1:189475296-189475318 GAGCTGTCTTCTGTTTGTGCTGG - Intergenic
920226305 1:204441678-204441700 GACCTGCTCATTGTTTCTTCCGG + Intronic
924378000 1:243433407-243433429 GACTTCCTTTCTGTTTGGGCTGG + Intronic
1063417699 10:5887897-5887919 TACCTGCTCACTGTTTGCCCAGG - Exonic
1064168022 10:13002888-13002910 GGCCTTCTCTCTGTGTGTGATGG + Intronic
1064201249 10:13286855-13286877 GAGCTGCTTTCTGTTACTGCAGG - Intronic
1065785187 10:29206380-29206402 GACCTAATCTGTGTTTCTGCAGG + Intergenic
1067460269 10:46453009-46453031 GACCTGCTCTGTTTATGTCCAGG + Intergenic
1067548442 10:47214625-47214647 GACTTGCTCACTGTTTGTATTGG - Intergenic
1067626921 10:47931594-47931616 GACCTGCTCTGTTTATGTCCAGG - Intergenic
1069623489 10:69852521-69852543 GCACTGCTCTATGTTGGTGCTGG - Intronic
1070924146 10:80207200-80207222 GACCTTCTCCCTGTCTGGGCAGG + Intergenic
1071341546 10:84653427-84653449 GACCAGCCCTTGGTTTGTGCAGG - Intergenic
1073193348 10:101668093-101668115 TACCTGAGCTCTGTGTGTGCAGG - Intronic
1073372962 10:103007189-103007211 GACCTACTCCCTGTTCGTACAGG - Intronic
1076868614 10:133181752-133181774 GTCCAGCTGTCTGTGTGTGCTGG + Intronic
1079063958 11:17273769-17273791 GACCTTCTTTATGTTTGTCCTGG - Intronic
1079617174 11:22510001-22510023 TATCTGCACTCAGTTTGTGCTGG - Intergenic
1080590179 11:33716574-33716596 GACATGCCCTCTGTTCTTGCTGG - Intronic
1081402439 11:42658677-42658699 GACCTACTCTCTGATTATGGCGG - Intergenic
1082005925 11:47418952-47418974 GACCTAGACTCTGTTTGTCCCGG - Intronic
1084580355 11:70019486-70019508 GACCTGCCCTCTGGGTGTGCAGG + Intergenic
1089028529 11:115297422-115297444 TACCTACTCGGTGTTTGTGCCGG + Intronic
1092720957 12:11440043-11440065 GACCTGCTCTCTGTTTGTGCAGG - Intronic
1094429806 12:30355626-30355648 GACCTGCCCTCAGTGTGGGCAGG - Intergenic
1096410321 12:51372585-51372607 CACCTTCTCTCTGTCTGTCCTGG - Intronic
1098810304 12:75080011-75080033 GACTTGCTCTATGATTGTTCTGG + Intronic
1099040345 12:77645590-77645612 GGACTGCTTTCTGTTTGTCCTGG - Intergenic
1101142535 12:101811143-101811165 TACTTGCTCTCTGGATGTGCAGG - Intronic
1101311168 12:103580801-103580823 AACCTGATCTCTGTCTCTGCAGG + Intergenic
1106249973 13:27975877-27975899 GACATGCTCTCGGTTTCTGTCGG - Intergenic
1113666393 13:112144422-112144444 GTTCTGATCTCTGTTTCTGCAGG - Intergenic
1113676571 13:112211298-112211320 GGCCTTCTCTCTGTGTGTGGTGG + Intergenic
1114562291 14:23602113-23602135 GACCAGCACTCTGCTTATGCTGG + Intergenic
1116853766 14:49933739-49933761 AATTTGCTCTCTGTTTGAGCTGG - Intergenic
1116891873 14:50276639-50276661 GACCTCTTGTCTGTGTGTGCCGG - Intronic
1118431625 14:65724795-65724817 GACCTCTTCTTTGTGTGTGCAGG + Intronic
1118684610 14:68278810-68278832 GACCTGCCATCTATTAGTGCTGG - Intronic
1120634039 14:86929221-86929243 GCCCTGCTCTCTGTATCTGTAGG - Intergenic
1121183424 14:91946766-91946788 GATTTGCTCTATGTTTGTGTGGG - Intronic
1122071704 14:99209363-99209385 GCCCTGCTCTCTGGTCGCGCAGG - Intronic
1123811501 15:23931034-23931056 GATCTGCTCCCTGTTGCTGCTGG - Intergenic
1124157277 15:27236934-27236956 GACTTGCTCTGGGCTTGTGCTGG + Intronic
1124857350 15:33402682-33402704 GACATGCTCTTAGTCTGTGCAGG - Intronic
1127614418 15:60669585-60669607 AACCTGCTCTCTGTTCTTACTGG + Intronic
1129056171 15:72821946-72821968 GCCTTCCTCTCTCTTTGTGCTGG + Intergenic
1131611991 15:93974993-93975015 GACCTGCACTCTCTCTGTTCGGG + Intergenic
1132481495 16:168475-168497 GAGCTGGTCTCTGTTTGGGCAGG + Intergenic
1135190051 16:20347332-20347354 GGCCTGCTCTCTGTTTGAGAGGG - Intronic
1135782164 16:25313758-25313780 GACCTGATTCCTGTTTCTGCTGG + Intergenic
1138238196 16:55403473-55403495 GATTTGCTCTCTGCTTGAGCTGG - Intronic
1144574188 17:16418581-16418603 GAGCTGCTTCCTGTTTGTGCTGG + Intronic
1145247915 17:21281908-21281930 AACCTGCTCTCTGTGGATGCAGG - Intergenic
1146268004 17:31465724-31465746 GACCTGCTCTGTTTTTGACCTGG - Intronic
1146575068 17:33983934-33983956 GAGAAGCCCTCTGTTTGTGCTGG + Intronic
1146609291 17:34290271-34290293 GAGGTGCCCTCTGTTTGTGAAGG + Intergenic
1150285741 17:63952846-63952868 GATCTGCTCTCTGTCTCTGCTGG - Intronic
1151306834 17:73267933-73267955 GTCCTGCTCTGTCATTGTGCAGG + Intergenic
1155146988 18:23092476-23092498 GATCTGCTCTCAGTGTGGGCAGG - Intergenic
1157288928 18:46396418-46396440 GACCTGCTCTGTGTCTGGGCAGG - Intronic
1158392394 18:57053996-57054018 AGGCTGCTCTCTGTCTGTGCAGG + Intergenic
1158655179 18:59324398-59324420 GATTTGCTCTCTGCTTGAGCTGG + Intergenic
1160827969 19:1089551-1089573 CCCCTGCTCTCTGTCTCTGCAGG - Exonic
1162798897 19:13100506-13100528 GGGCTGTTCTCTGTGTGTGCTGG + Intronic
1163189589 19:15666827-15666849 GACCCCCTCTCTGTATGTGTGGG + Intergenic
1164459729 19:28436534-28436556 CACCTGCTCTATGTGCGTGCCGG - Intergenic
1166253453 19:41586442-41586464 GACCTCTTCTCTGTTTTTACAGG + Exonic
1168513156 19:56989484-56989506 TTCCTGCGCTCTGTTTGTGTGGG + Intergenic
1168704374 19:58460616-58460638 GGCCTACTTTCTGTTTGTGCAGG + Intergenic
925018613 2:551508-551530 GAGCTGCTTTCTGTGTGTGCTGG - Intergenic
926678276 2:15645071-15645093 GAGCAGCTCTCAGTTTTTGCTGG - Intergenic
930085579 2:47494877-47494899 GGCCTGCTCTCTTCTTGTCCTGG + Intronic
934578660 2:95420277-95420299 GACCTGCTGTATGTCTGTGATGG - Intergenic
936534158 2:113298570-113298592 GACCTGCTGTATGTCTGTGATGG + Intergenic
937673285 2:124561393-124561415 GTCCTGCTCTATGCCTGTGCTGG - Intronic
940364221 2:152828409-152828431 GACATGGTCTCAGTTTATGCTGG + Intergenic
941492824 2:166163512-166163534 CACCTTCTCTCTGTAAGTGCAGG - Intergenic
941998618 2:171625099-171625121 GAACTATTCTCTGTTTGTGCTGG - Intergenic
943957134 2:194207171-194207193 GAGGTGCTCTCTGTTTTTCCAGG + Intergenic
944674028 2:202020229-202020251 GTGCTGCTGGCTGTTTGTGCTGG - Intergenic
944913709 2:204335852-204335874 ATCCTGCTCTCTGTCTCTGCTGG + Intergenic
946226665 2:218267493-218267515 GAGCTGCTCTTTGAGTGTGCAGG - Exonic
1170061913 20:12268089-12268111 GACATGCTGTCCCTTTGTGCAGG - Intergenic
1170391617 20:15880945-15880967 GACCTTCTCTCTGACTGAGCTGG + Intronic
1173408860 20:42791919-42791941 GACATACCCTCTGTTTCTGCTGG - Intronic
1174062040 20:47839699-47839721 GACGTGCTCTCTGGTTTGGCTGG - Intergenic
1174069466 20:47889532-47889554 GACGTGCTCTCTGGTTTGGCTGG + Intergenic
1174080617 20:47968677-47968699 GACCTGCTGTCTCTTTCTGAGGG + Intergenic
1174136760 20:48385239-48385261 GACCTGCTGTCTCTTTCTGAGGG - Intergenic
1174869456 20:54169553-54169575 GACTTGCTCACTGATTTTGCAGG - Intronic
1175742146 20:61427216-61427238 GACCTGTGCCCTGTGTGTGCAGG + Intronic
1176124459 20:63469290-63469312 GACCTGCTCTCTGCCTGGTCGGG - Intronic
1179898308 21:44375739-44375761 GACCTGGTCTCTGTGAGGGCCGG + Intronic
1181191495 22:21144168-21144190 CACCTTCTCTCTGTTGGAGCAGG + Intergenic
1181921746 22:26326203-26326225 GACCTGCTGTCTGTCTGAGCTGG + Intronic
1184479997 22:44740820-44740842 AACATGCTCTCTGGATGTGCTGG + Intronic
950524348 3:13514930-13514952 GACAGGCTTTCTGTTTGTGGTGG - Intergenic
952212013 3:31237385-31237407 GACCTGCCTTCTGCATGTGCTGG - Intergenic
955043785 3:55340814-55340836 AATCTACTCTCTGTTTGAGCTGG + Intergenic
955567732 3:60266737-60266759 GCCCTGCTCTCTCATTTTGCTGG - Intronic
959202117 3:103260375-103260397 GAGCTGCTCTATGGTTGTGGTGG + Intergenic
959581089 3:107983360-107983382 GACATGCTATGGGTTTGTGCTGG - Intergenic
960109582 3:113832815-113832837 GACTGGCTTTCTGTGTGTGCTGG + Intronic
964843094 3:161015750-161015772 AACCTGCTCAGTGTGTGTGCAGG + Intronic
966485063 3:180459662-180459684 GATTTGTTCTCTGTTTGAGCTGG - Intergenic
970354702 4:15240185-15240207 GGCCTGCTCAGTGTTTGTCCCGG - Intergenic
974974806 4:68877711-68877733 GCACTGCTCTCTGGTTGTGCTGG - Intergenic
974976510 4:68900736-68900758 GTACTGCTCTCTGGATGTGCTGG - Intergenic
974983029 4:68985096-68985118 GTACTGCTCTCTGGTTGTGCTGG - Intergenic
974994339 4:69134697-69134719 GTACTGCTCTCTGGTTGTGCTGG + Intronic
975017505 4:69441029-69441051 GTACTGCTCTCTGGTTGTGCTGG + Intergenic
975825560 4:78316383-78316405 TACCTACTGTCTGTTAGTGCAGG + Intronic
976359880 4:84165470-84165492 AAACTGCTCTCTGCTTGAGCTGG + Intergenic
976400146 4:84597756-84597778 GAACTGCTTTCTATCTGTGCTGG - Intronic
976896373 4:90116835-90116857 AAGCTGCTCTCTGTTTGAGCTGG + Intergenic
977736733 4:100426254-100426276 ACCCATCTCTCTGTTTGTGCTGG + Intronic
980528817 4:134024129-134024151 GATCTGGTCTCTGTTTCTCCAGG + Intergenic
982925961 4:161337355-161337377 GACCTACTTCCTGTTTGTCCTGG - Intergenic
982989785 4:162257832-162257854 GACATCCTTTCTGATTGTGCAGG - Intergenic
983009845 4:162534081-162534103 GACCTGCTCTCTGTCACAGCAGG + Intergenic
987975164 5:25006052-25006074 GTCTTGCTCTCTGCTTGTGGAGG + Intergenic
996881787 5:128305822-128305844 GACCTGCTGTTGGTTTGTGAAGG - Exonic
1003838274 6:10093991-10094013 GACCATTTCTCTGTTTATGCAGG + Intronic
1005361046 6:25031084-25031106 TACCTGCTCTGTGTTTGACCTGG + Intronic
1006405644 6:33843326-33843348 GGCCGGCTCTCTGTCTGTCCTGG + Intergenic
1011826819 6:91317452-91317474 GACCTGCTGTTTGGTTATGCAGG + Intergenic
1014998901 6:128190041-128190063 AACCTGCTTTCTGTTTGTTATGG - Intronic
1015126110 6:129756686-129756708 GACCTACTATAGGTTTGTGCAGG - Intergenic
1016498959 6:144696231-144696253 GAACTGCTCTCTTTTTTTTCTGG + Intronic
1016792342 6:148079062-148079084 ACCCTGCTCTCTGTTTGGGATGG + Intergenic
1018390562 6:163337987-163338009 GACCAGCTGGCTGTTTGTGTGGG - Intergenic
1018724741 6:166603280-166603302 CACCTGCTCTCGGCTTGTGTGGG + Intronic
1022649291 7:32259919-32259941 GACCTGCTGCAGGTTTGTGCCGG - Intronic
1025232412 7:57211464-57211486 GACGTGCTCTCTGGTTTGGCTGG + Intergenic
1027358392 7:77382778-77382800 GACCTGCAATGTGTGTGTGCAGG - Intronic
1027436923 7:78174301-78174323 GATGAGCTCTCTGTTTGTTCCGG - Intronic
1027605001 7:80288767-80288789 GAATTTCTCTCTGTGTGTGCTGG - Intergenic
1027782326 7:82534820-82534842 CACCAGCTGTCTGTCTGTGCAGG - Intergenic
1031425198 7:121596780-121596802 TTCATGCTTTCTGTTTGTGCAGG + Intergenic
1035160047 7:156943683-156943705 GACCTGCACTCTGGCTGTGCTGG - Intergenic
1035669998 8:1409760-1409782 GACCTCCTCTCTTCTTGAGCTGG + Intergenic
1038033448 8:23664700-23664722 GATGTTCTCTCTTTTTGTGCAGG + Intergenic
1039657456 8:39425066-39425088 GACCTGCTCTCTGTTATGGAGGG + Intergenic
1043809502 8:84719169-84719191 GACCTGATCTCTGTCTTTGGGGG - Intronic
1046066168 8:109199262-109199284 GACCTTCTCTGTGCTTGTACTGG - Intergenic
1047999524 8:130366388-130366410 GACCTACACTCTGCATGTGCTGG - Intronic
1049659792 8:143814840-143814862 GACCTCCTCTCCTTTTTTGCTGG - Intronic
1049941923 9:554333-554355 TACTTGCTCTCTGCTTGAGCTGG - Intronic
1050339627 9:4622791-4622813 CACTTGCTCTCTTTCTGTGCGGG - Intronic
1051225836 9:14898299-14898321 GCCTTGCTCTATGTGTGTGCTGG - Intronic
1056854500 9:90114352-90114374 GACCTGCTCTCTGTATGTGCAGG + Intergenic
1057938220 9:99258268-99258290 GACATGCTCACTGCTTGGGCTGG - Intergenic
1059173716 9:112150209-112150231 GACCTGCTGCCTGTTTCTGTAGG - Intronic
1059374624 9:113872630-113872652 GACCTGCTCTATGATGGAGCAGG - Intergenic
1059431428 9:114252745-114252767 GACCAGCTCCCTCTTTGTCCAGG + Intronic
1060110714 9:120904591-120904613 GGCCTGCTCTCTTTTTCTCCAGG - Exonic
1060829964 9:126707248-126707270 TCCCTGCTCTCTGTGTGTGAGGG - Intergenic
1062082109 9:134629685-134629707 GACCTGCTCCCTGTCTGGACTGG + Intergenic
1062387862 9:136321424-136321446 GTCTTTCTGTCTGTTTGTGCTGG + Intergenic
1187668959 X:21649692-21649714 GCCCTGCTCACTGTGTGTGGGGG + Intronic
1190267298 X:48835211-48835233 GACTTGGTCTCTGCCTGTGCGGG - Intronic
1197716807 X:129715017-129715039 GACCTGGTCTGTGTTTTTCCAGG - Intergenic
1199053974 X:143270583-143270605 GGACTGCTCTCTGTTTGGGTTGG - Intergenic