ID: 1092722422

View in Genome Browser
Species Human (GRCh38)
Location 12:11454930-11454952
Sequence TATCAGAGGGTGAAGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 529
Summary {0: 1, 1: 0, 2: 9, 3: 52, 4: 467}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092722422 Original CRISPR TATCAGAGGGTGAAGGTGGA AGG Intronic
901270815 1:7952100-7952122 CATCAGAGGGAGACCGTGGAAGG - Intergenic
901451682 1:9339931-9339953 CATCAGAAGGAAAAGGTGGAGGG - Intronic
903081191 1:20814806-20814828 CATCAGAGGGAGACCGTGGAAGG - Intronic
903961943 1:27063469-27063491 CATCAGAGGGAGACCGTGGAGGG - Intergenic
904784943 1:32975812-32975834 CATCAGAGGGAGACCGTGGAAGG + Intergenic
905442426 1:38004082-38004104 TAGCAGAGGGTGAGGGTTGAGGG - Intronic
906427034 1:45724005-45724027 CATCAGAGGGAGACCGTGGAAGG - Intronic
906762081 1:48384308-48384330 CATCAGAGGGAGACCGTGGAGGG + Intronic
907756561 1:57316398-57316420 CATTTGAGGGGGAAGGTGGATGG - Intronic
908146397 1:61249443-61249465 TATTAGATGGGGGAGGTGGAAGG + Intronic
908445986 1:64200488-64200510 CATCAGAGGGAGACCGTGGAAGG - Intergenic
908692581 1:66799434-66799456 TATCAGAGGGTGAGGGTGAGGGG + Intronic
908837388 1:68241514-68241536 TATCAGAGGTGGAGGGTGGGTGG + Intergenic
908926450 1:69260644-69260666 TTTCAGAGGGTGGAGGGGGAAGG + Intergenic
909270824 1:73621323-73621345 TGTCAGAGGGTGAAGGGGGGAGG + Intergenic
909411565 1:75358996-75359018 TACCAGAGGTTGCAGGGGGAGGG - Intronic
909641302 1:77871058-77871080 CATCAGAGGGAGACCGTGGAAGG + Intronic
910050611 1:82969665-82969687 TATAAGAGGATTAAGGTAGAAGG - Intergenic
911436457 1:97865531-97865553 AATCAGAGGGTGAAGGAGGATGG - Intronic
911897220 1:103451981-103452003 TAGCAGAGGATGCAGGTAGAAGG - Intergenic
912430859 1:109627681-109627703 GATCAGAGGGAGCAGGTGGGAGG - Intronic
912700047 1:111871093-111871115 TATCAGAGGGTTGTGGTGAAGGG + Intronic
912751529 1:112292605-112292627 CATCAGAGGGAGACCGTGGAAGG - Intergenic
913225239 1:116693345-116693367 CCTCAGAGGGTGAAGGGGGGAGG - Intergenic
913556486 1:119972172-119972194 AATCAGAGAGTGAAGGAGGGAGG + Intronic
913685411 1:121227216-121227238 TATCAGAGGCTGAAGGTCACCGG + Intronic
914037258 1:144014820-144014842 TATCAGAGGCTGAAGGTCACCGG + Intergenic
914152197 1:145053112-145053134 TATCAGAGGCTGAAGGTCACCGG - Intronic
914879403 1:151535976-151535998 TATCTGAGGTGGAAGATGGAGGG - Intronic
914887840 1:151599612-151599634 CATCAGAGGGAGACCGTGGAAGG - Intergenic
914999727 1:152578390-152578412 CTTCAGAGAGAGAAGGTGGAGGG - Intronic
915342368 1:155183719-155183741 TACCAGAGGGAGACGCTGGAAGG - Intronic
916282441 1:163066825-163066847 TATCAGAGAAAGAAGGTGGAAGG + Intergenic
916326238 1:163562947-163562969 TATCAGAGGGTGAGGGTGGGAGG - Intergenic
917265493 1:173216564-173216586 GATCAGAGACTGAGGGTGGATGG + Intergenic
917304449 1:173612614-173612636 CATCAGAGGGAGACTGTGGAAGG - Intronic
918479745 1:184965640-184965662 TATCAGAGGGTGAACGGTGGAGG + Intronic
918986604 1:191636689-191636711 TATCAGAGGCTGAGGCTGGGTGG - Intergenic
919506593 1:198406455-198406477 TCTCAGAGGGTGGAGGGGGGAGG + Intergenic
920017406 1:202924412-202924434 TACCAGAGGGATAAGGAGGAAGG - Intronic
920045955 1:203132523-203132545 TAACAGATGGTGAAGGGGAAAGG - Intronic
920472729 1:206245774-206245796 TATCAGAGGCTGAAGGTCACCGG + Intronic
922436781 1:225615004-225615026 CATCAGAGGGAGACCGTGGAGGG - Intronic
922603893 1:226877081-226877103 AGTGAGAGGGTGAAGGTGGGTGG + Intronic
924643969 1:245860063-245860085 TGTCACAGAGGGAAGGTGGAAGG - Intronic
1063084831 10:2806952-2806974 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1063108999 10:3018582-3018604 TCACAGTGGATGAAGGTGGATGG + Intergenic
1063221986 10:3977589-3977611 TAGCAGATGGTGGAGATGGAAGG + Intergenic
1063436468 10:6036071-6036093 GAACAGAGGGTGCAGGTGAAGGG + Intronic
1063745262 10:8872173-8872195 TATCAGAGGGTGGAGGGTGGAGG - Intergenic
1063779637 10:9306627-9306649 TCTCAGAGGGTGGAGGTGGGAGG + Intergenic
1063939579 10:11113453-11113475 TATCAGAGGGTGGAGGAAAAGGG + Intronic
1064088293 10:12362252-12362274 TATCAGAAGGTCAGGGAGGAGGG - Intronic
1064108823 10:12520901-12520923 CATCAGAGGGAGACCGTGGAAGG + Intronic
1064194485 10:13234173-13234195 TACAGGAGGGTCAAGGTGGAGGG - Intronic
1064614211 10:17135759-17135781 TATTAGAGGGGGAAGTTGGCCGG + Intergenic
1064949179 10:20827917-20827939 TATCAGAGGGTGAAGAAGGAGGG + Intronic
1065372571 10:25003822-25003844 TATCGGAGGCTGGGGGTGGAAGG - Intronic
1065805708 10:29391892-29391914 TATTAGAGGGTGAAGGCAGAGGG - Intergenic
1066154850 10:32664499-32664521 TATAAGAGGCTGATGGTGGGAGG - Intronic
1066443710 10:35462657-35462679 TCTCAGAGTGTGCGGGTGGAGGG + Intronic
1067532570 10:47085336-47085358 TCTCACAGGGTGAAGGGGGCAGG - Intergenic
1068969434 10:62947048-62947070 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1069639377 10:69945019-69945041 TGTCCGAGGGTGAGGGTGGAGGG + Intronic
1070013310 10:72498253-72498275 TATCAGTGGGAGAAAGTAGATGG - Intronic
1070730942 10:78827964-78827986 CATCACAGGCTGGAGGTGGAGGG - Intergenic
1070998903 10:80812244-80812266 TATCAGAGGGTGAAGGTAGCTGG - Intergenic
1071365871 10:84900160-84900182 TACTAGAGGGTGAAGGGAGAAGG - Intergenic
1071902443 10:90135761-90135783 TATTAAAGGGCTAAGGTGGAAGG + Intergenic
1072311288 10:94157760-94157782 AATCAGAGGGTGAATGAGGCAGG - Intronic
1072602565 10:96942415-96942437 CATCAGAGGGAGACCGTGGAAGG + Intronic
1073319575 10:102606596-102606618 TAAAAGAGGATAAAGGTGGAGGG + Intronic
1073573336 10:104599318-104599340 ATTCAGAGGGAGCAGGTGGAGGG + Intergenic
1074108355 10:110405090-110405112 TACCAGATGGGGAAGTTGGATGG - Intergenic
1078176713 11:8977391-8977413 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1078841556 11:15080318-15080340 GATCAGAGGCTGAGGGTGGAAGG - Intronic
1078869127 11:15327792-15327814 TCTTAGAGGGAGAAGGGGGATGG + Intergenic
1079446544 11:20561894-20561916 ACTCAAAGGGTGAGGGTGGAAGG + Intergenic
1080790857 11:35521349-35521371 AATGAGAGGGAGAAGGTGGAAGG - Intronic
1081828839 11:46087998-46088020 TTTGGGAGGCTGAAGGTGGATGG - Intronic
1082986561 11:59174384-59174406 CATCAGAAGGTGAGGGTGGAGGG + Intronic
1083272147 11:61577993-61578015 AACCAGAGGGTGAAGGCTGAGGG + Intronic
1083437054 11:62649749-62649771 CATGAGAGGGTGGAGGTGGACGG + Exonic
1084534147 11:69746922-69746944 AAGCAGAGAGGGAAGGTGGAGGG - Intergenic
1085179858 11:74524621-74524643 TTTCAGGGGGTGAAGGATGAAGG + Intronic
1085480711 11:76820825-76820847 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1086490657 11:87355122-87355144 CATGAGACGGGGAAGGTGGATGG - Intergenic
1087487148 11:98770727-98770749 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1087563889 11:99828421-99828443 CATCATATGGTGAAGATGGAAGG + Intronic
1088317958 11:108526573-108526595 TCTCAGAGGGCAAAGCTGGATGG + Intronic
1088432466 11:109773915-109773937 CCTCAGAGGGAGAAGGAGGAAGG - Intergenic
1088496615 11:110437788-110437810 TACCAGAGGGGGAAGGGAGAGGG - Intronic
1088628016 11:111746469-111746491 TATCAGGGGGTGAGGGGCGAGGG + Intronic
1090032341 11:123217829-123217851 TATTGGAGGGTGAGGGTGGGGGG - Intergenic
1090133741 11:124172750-124172772 TATAAGTGGATGGAGGTGGATGG + Intergenic
1090907061 11:131085118-131085140 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1091296810 11:134479697-134479719 TGGCAGAGGGAGAAGGTGAAAGG + Intergenic
1092021609 12:5207240-5207262 TGACAGAGGGTGAGGGTGGGAGG + Intergenic
1092453373 12:8624380-8624402 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1092627597 12:10344164-10344186 TATCAGAGGCTGAAGGTACAGGG - Intergenic
1092722422 12:11454930-11454952 TATCAGAGGGTGAAGGTGGAAGG + Intronic
1092741011 12:11629571-11629593 TATCTGAAGGTGAAGGGAGAAGG - Intergenic
1092828026 12:12415522-12415544 CATCAGAGGGAGACCGTGGAAGG + Intronic
1093160831 12:15744292-15744314 TCTCATAGGGTGAAAGAGGAAGG - Intronic
1093189101 12:16054814-16054836 TGTCAGATGGTGGAGGTGGAGGG + Intergenic
1093624686 12:21331273-21331295 TACCAGACAGTGAAGGGGGAAGG + Intronic
1093978629 12:25451520-25451542 TATCAGAGGGTGGAGATTGCAGG + Intronic
1094103084 12:26784374-26784396 CATCAGAGGGAGACCGTGGAAGG - Intronic
1095976929 12:47946424-47946446 TCTCCCAAGGTGAAGGTGGAGGG + Intergenic
1096086494 12:48868561-48868583 TATCTGAGGGTGGAGGATGAGGG - Intergenic
1096374196 12:51094464-51094486 TATGAGAGGGTGAATAAGGAGGG + Exonic
1096648760 12:53051841-53051863 TTTCCTAGGCTGAAGGTGGAGGG - Exonic
1098379700 12:69854317-69854339 CATCAGAGGGAGACCGTGGAGGG + Intronic
1098412435 12:70201154-70201176 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1098929970 12:76400160-76400182 TTTCAGAGGGTGAGGGTGGGAGG - Intronic
1099860233 12:88217403-88217425 TTTCAGAGAGTGGAGGTGGGAGG - Intergenic
1102027080 12:109719737-109719759 TATAAGATGGTGGAGGTGAAAGG + Intronic
1102172316 12:110851712-110851734 TTTCAGAGGGCGAAGGTGCAGGG - Intronic
1102752734 12:115309785-115309807 TATCAGAGGCTGCAGGTGGATGG - Intergenic
1103201882 12:119094516-119094538 GAACAGACAGTGAAGGTGGAGGG - Intronic
1103516779 12:121513437-121513459 TTCCAGAGGGCGAAGGGGGAAGG + Intronic
1103922311 12:124405366-124405388 AACCAGAGGGTGAGGGTGGAAGG - Intronic
1104091513 12:125521611-125521633 GGCCAGAGGGTGAGGGTGGAGGG + Intronic
1105251320 13:18700774-18700796 TATCAGAGGGTGAAGACTTAGGG - Intergenic
1106015747 13:25867566-25867588 TAGGAAAGGGTGAAGGAGGATGG - Intronic
1107327509 13:39260776-39260798 TTTCAAAGGGTAAATGTGGATGG - Intergenic
1107677067 13:42808514-42808536 GATCAGAGGGTCCAGGGGGAGGG - Intergenic
1108582124 13:51836743-51836765 TATCTGAGGGGGCAGGTGGGAGG + Intergenic
1110726008 13:78824685-78824707 TATTGGAGGGTGGAGGTGGAAGG - Intergenic
1111233964 13:85383741-85383763 TCACAGAGGGAGAAGGTAGAGGG - Intergenic
1112092058 13:96091785-96091807 TCTTAGAGGGTGAAGGCAGAGGG - Intronic
1113098385 13:106690554-106690576 TATCAGAGGGTGGTGGGGGGCGG + Intergenic
1113157411 13:107339429-107339451 AATCAGAGGTGGAAGGTGGGAGG - Intronic
1113735913 13:112679011-112679033 CATCAGAGGGAGACTGTGGAGGG + Intronic
1114198934 14:20505337-20505359 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1114725918 14:24937134-24937156 TGTCGGCGGGTGAGGGTGGAGGG + Intronic
1115239845 14:31243302-31243324 TACCAGAGGGGGAAGGTAGAAGG - Intergenic
1115703911 14:35978605-35978627 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1116728147 14:48588460-48588482 TTTCTGGTGGTGAAGGTGGAAGG + Intergenic
1117165643 14:53029931-53029953 TAGCAGAGGGTGGAGGGTGAGGG - Intergenic
1117696478 14:58369808-58369830 TATCTGAAGGTGATGGTGAATGG + Intronic
1118992046 14:70806223-70806245 CATCAGAGGGTGAACATGGGCGG - Intronic
1119181244 14:72606640-72606662 TATCAGCGGGGAAAAGTGGAAGG - Intergenic
1119382356 14:74237359-74237381 TGCCAGAGGCTGAAGGTGAAGGG - Intergenic
1119582592 14:75800602-75800624 TATCAGAGGGTCTGGGTTGAAGG + Intronic
1120255767 14:82117484-82117506 TATGAGAGGGAGATGGAGGAAGG + Intergenic
1120868862 14:89319312-89319334 TAGCAGAGGGAAAAGGTGCATGG + Intronic
1121427228 14:93861002-93861024 TGGCATAGGGTGATGGTGGAGGG + Intergenic
1122287751 14:100662003-100662025 TATCAGAGAGTGCAGGTCTAGGG - Intergenic
1122386167 14:101349668-101349690 TATCTGAGGATGGGGGTGGATGG + Intergenic
1122420223 14:101571712-101571734 AAGCAGAGGGGGAAGGAGGAGGG + Intergenic
1122568707 14:102678175-102678197 CATCAGAGGGAGACCGTGGAAGG + Intronic
1123038861 14:105482328-105482350 TAGAAGAGAGTGAAGGTTGAGGG - Intergenic
1124391841 15:29266295-29266317 TCACAGGGGGTGAAGGTGGAGGG + Intronic
1125791062 15:42366041-42366063 TATCAGAGGGTGTCCATGGAAGG + Intronic
1125919269 15:43515899-43515921 GTTCAGAGGGTGAAGGCTGAAGG + Intronic
1126295205 15:47131773-47131795 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1126862636 15:52901980-52902002 TACCAGAGTCTGAAGGTGGGAGG - Intergenic
1126921693 15:53533656-53533678 TATCAGAGGCTGAGATTGGAAGG - Intronic
1126981285 15:54246746-54246768 TATCGGAGGGTGGGGGTGGGAGG + Intronic
1127424527 15:58841996-58842018 TATCAGAGGGTGGTGAAGGAGGG - Intronic
1127584089 15:60365872-60365894 CATCAGAGGGAGACCGTGGAGGG - Intronic
1128078656 15:64843297-64843319 TCTCAGTGGGTGAAGGTAGGGGG + Intronic
1128675079 15:69602600-69602622 TAGCAGAGAGAGAGGGTGGAGGG - Intergenic
1129057835 15:72834516-72834538 TGGCAGAGGATGAAGGAGGAGGG + Intergenic
1129921571 15:79323629-79323651 CCTCAGAGGGTGAAGGAGAAGGG - Intronic
1130018789 15:80209565-80209587 TGTCAAAGCGTGAAGGTGTAAGG + Intergenic
1132862518 16:2078600-2078622 TGCCTGAGGGTGACGGTGGAAGG + Intronic
1133273688 16:4624464-4624486 TTTCAGAGGGGGCAAGTGGAAGG + Intronic
1133845339 16:9448263-9448285 GATCCTAGGGTGAAGCTGGAGGG + Intergenic
1133978110 16:10614796-10614818 TAGCAGAGGGTGAAGGGTGGTGG + Intergenic
1135187625 16:20328816-20328838 TATCAGAAGTTGGAGGGGGAAGG - Intergenic
1135531257 16:23256712-23256734 TCTCATAAGGTGATGGTGGAAGG - Intergenic
1136571961 16:31103654-31103676 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1138848790 16:60600698-60600720 TACTTGAGGGTGGAGGTGGAAGG - Intergenic
1139556166 16:67712309-67712331 CATCAGAGGGAGACCGTGGAGGG - Intronic
1139864026 16:70050350-70050372 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1140690301 16:77477398-77477420 CCTCACATGGTGAAGGTGGAGGG + Intergenic
1141151883 16:81570077-81570099 TATCAATGGGGGAAGGGGGATGG + Intronic
1141276125 16:82589822-82589844 TACCTGAGGTGGAAGGTGGAAGG - Intergenic
1142654970 17:1385625-1385647 TTTCAGAGGGTGGGGGAGGAGGG + Intronic
1142818397 17:2446633-2446655 CATCAGAGGGAGACCGTGGAAGG - Intronic
1143934552 17:10469297-10469319 TATCAGATGAAGAAGGTGGCAGG + Exonic
1144770990 17:17759471-17759493 CATCAGAGGGTGGGGGTGGTGGG - Intronic
1145762718 17:27435333-27435355 TGTGAGAGGGTGAAGCTGGCAGG - Intergenic
1145959468 17:28879100-28879122 CATCACAGGCAGAAGGTGGAGGG - Intergenic
1146216591 17:30981332-30981354 CATCAGAGGGAGACCGTGGAGGG + Intronic
1146444673 17:32923793-32923815 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1146570339 17:33946971-33946993 TCTCAGTGGGTGCAGGTGCAGGG - Intronic
1147957805 17:44146801-44146823 TAGCAGAGGGTGGGGGTGGTGGG + Intronic
1148815414 17:50324391-50324413 TCTTAGAGGGTGAGGGTGTAGGG + Intergenic
1148982115 17:51586157-51586179 TATCAGACGGTGGAGGGTGAAGG - Intergenic
1149137990 17:53393357-53393379 TATCAAAGAGTAAAGGTGCAAGG + Intergenic
1152019940 17:77775688-77775710 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1152576179 17:81142102-81142124 TAGCCGAGGGTGATGGTGGCAGG - Intronic
1152684825 17:81688806-81688828 TACCAGATCATGAAGGTGGAGGG + Exonic
1153022994 18:648055-648077 TAACAGTAGGCGAAGGTGGAAGG + Intronic
1154111114 18:11569318-11569340 TACCAGTGGGAGATGGTGGAAGG - Intergenic
1154437617 18:14359184-14359206 TATCAGAGGGTGAAGACTTAGGG + Intergenic
1155308278 18:24499860-24499882 TATAACTGGGTGAAGGTAGATGG + Intergenic
1155775036 18:29751125-29751147 TTTCAGAAGATGAAGGTGGCTGG + Intergenic
1156708641 18:39914427-39914449 GATCACAAAGTGAAGGTGGATGG - Intergenic
1156737778 18:40282401-40282423 ACTCAGAAGGTGAAGATGGAGGG + Intergenic
1157110839 18:44818825-44818847 TCACAGAGGGAGATGGTGGAAGG - Intronic
1157643280 18:49240040-49240062 TATCAGAGGTTGAAAGAGAAGGG - Intronic
1157799166 18:50604984-50605006 GAGCAGAGGGTGCAGGAGGATGG + Intronic
1157989122 18:52473917-52473939 TGTCAGAAGAGGAAGGTGGAAGG - Intronic
1158868961 18:61665752-61665774 CATCTGAGGGAGAAGGGGGAAGG - Intergenic
1159346450 18:67212867-67212889 TACCTGAGGGTGAAGATGGGAGG - Intergenic
1159397945 18:67888264-67888286 TATCAGAGGGTGGAGGTAAAAGG + Intergenic
1159615923 18:70579405-70579427 TAGCAGAGGTGGAAGGTGGGAGG - Intergenic
1159775820 18:72601918-72601940 TAGCAGAGTGTGATGGAGGAAGG - Intronic
1160049008 18:75414469-75414491 TATCAGAGGAGGAAGGAAGAGGG + Intronic
1160365423 18:78320760-78320782 TATCAGTTGATAAAGGTGGAAGG - Intergenic
1160920308 19:1516438-1516460 TTTCAGCACGTGAAGGTGGAGGG - Intergenic
1161993421 19:7698332-7698354 TATGAAGGGGTCAAGGTGGAGGG - Intronic
1162589415 19:11581121-11581143 TAGGAAAGGGTGGAGGTGGAGGG - Intronic
1162683083 19:12361743-12361765 CATCAGAGGGAGACCGTGGAGGG - Intronic
1163496049 19:17647215-17647237 TCTCAGAGGGTGGAGAAGGAGGG + Intronic
1164275364 19:23712642-23712664 TATCAGAGGTTGAGGGTGGTGGG - Intergenic
1164532079 19:29056420-29056442 TAGCAGAGTGTGAAGGTGCATGG + Intergenic
1164873442 19:31666596-31666618 CATCAGAAAGTGAAGGTGGATGG - Intergenic
1165012069 19:32856036-32856058 TACCAGAGGCTGAAGGAAGAGGG + Intronic
1166137341 19:40785808-40785830 GTTCAGTGGGTGAGGGTGGAAGG + Intronic
1166163267 19:40967413-40967435 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1167276560 19:48543587-48543609 TATCGGAGGGTGGTGGTGCACGG + Intergenic
1167734814 19:51287518-51287540 TGACAGAGTGTGAAGTTGGAGGG - Intergenic
1167790450 19:51675407-51675429 TAACAGAGAGTGAAGGTGGAGGG + Intergenic
1167924342 19:52810913-52810935 CATCAGAGGGAGACTGTGGAGGG - Intronic
1167937282 19:52919191-52919213 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1167971224 19:53188554-53188576 CATCAGAGGGAGACCGTGGAGGG + Intronic
925403798 2:3592220-3592242 CATCAGAGGGAGACCGTGGAAGG + Intergenic
925644709 2:6023940-6023962 CACCAGAGGGAGAAGGTGGAAGG + Intergenic
925693851 2:6553171-6553193 TATAAAAGGGTGAAAGAGGATGG - Intergenic
925781486 2:7386210-7386232 CATCAGGGGTGGAAGGTGGAAGG + Intergenic
927247855 2:20972213-20972235 AGCCAGAGGGGGAAGGTGGATGG + Intergenic
927684138 2:25159256-25159278 TCTCAGAGGGAGAAGGTGTGGGG + Intergenic
927762739 2:25774102-25774124 TACTTGAGGGTGGAGGTGGAAGG + Intronic
928003399 2:27541367-27541389 CATCAGAGGGAGACCGTGGAAGG + Intronic
928005612 2:27558873-27558895 CATCAGAGGGAGACCGTGGAGGG + Intronic
928558278 2:32448623-32448645 CATCAGAGGGAGACCGTGGAAGG + Intronic
929120230 2:38478073-38478095 TATCTGAGGATGGAGATGGAGGG - Intergenic
929739360 2:44587499-44587521 CATCAGAGGGAGACCGTGGAAGG - Intronic
929873419 2:45776702-45776724 AATCAGAGTGTCATGGTGGAGGG - Intronic
930163693 2:48183093-48183115 TAACAGGAGGTGAAGTTGGAGGG - Intergenic
930228226 2:48816435-48816457 TGTCAGAGGGTGAAAGTGGGAGG - Intergenic
931113061 2:59134268-59134290 TATCAGAGAGTGACAGAGGAAGG - Intergenic
931626528 2:64261172-64261194 TTTCACAGGGTGAAGATGGGAGG - Intergenic
931753501 2:65351145-65351167 TATCAGAGAGTGGAGGGGCAGGG + Intronic
932121698 2:69106725-69106747 TCCCACAGGGTGAAGGTGCATGG - Intronic
932820577 2:74896252-74896274 CTTCAGAGGGTGGAGGGGGAAGG + Intergenic
933117258 2:78489810-78489832 TATCAGAGGGTGGGGGTGGGTGG + Intergenic
934833901 2:97564670-97564692 GATCAGATGGTGTAGGTGTATGG + Intronic
934856455 2:97733134-97733156 TATCTGAAGCTGAAGGCGGACGG + Exonic
935084349 2:99830117-99830139 TATCAGAGGGTGGAGGGCAAGGG + Intronic
935630991 2:105211888-105211910 CATCAGAGGGAGACCGTGGAAGG + Intergenic
935854221 2:107257483-107257505 TGTAGGAGGGTGAAGGTGGCCGG + Intergenic
937072901 2:119077790-119077812 TCACAGAGGGGGAAGATGGAAGG + Intergenic
938533632 2:132220387-132220409 CATCAGAGGGAGACCGTGGAAGG - Intronic
938686855 2:133746820-133746842 TGTCAGTGGGTGAAGGGGTAGGG - Intergenic
939063523 2:137453768-137453790 TATCCGAGGCTGGAAGTGGAGGG - Intronic
939208566 2:139141040-139141062 CATCAAGGGATGAAGGTGGAGGG + Intergenic
939629105 2:144513586-144513608 TTTCAGAGGCTGATGCTGGAAGG + Intronic
940643095 2:156367584-156367606 CATCAGAGGGAGACCGTGGAGGG - Intergenic
941106385 2:161359075-161359097 ACTCAGAAGGTTAAGGTGGAAGG - Intronic
941804668 2:169699169-169699191 TGTCAGAGGGTGGGGGTGGGAGG - Intronic
943692083 2:190880174-190880196 CATGGGAGGGTGGAGGTGGAGGG - Intergenic
943740185 2:191399238-191399260 CATCAGAGGGAGACCGTGGAAGG + Intronic
944068166 2:195641261-195641283 AATCAGAGGGTGCAAGGGGAAGG + Intronic
944615545 2:201455595-201455617 ACTCAGAGGGTTAAGGTGGGAGG + Intronic
945232781 2:207609821-207609843 CATCAGAGGGAGACCGTGGAGGG - Exonic
945429173 2:209744681-209744703 TGTCAGAGGGGGTAGGGGGAAGG + Intergenic
945835983 2:214836327-214836349 CATCAGAGGGAGACCGTGGAGGG + Intergenic
947394637 2:229674611-229674633 AAGCAGAGTGTGAAGGTGGCTGG - Intronic
947889909 2:233608245-233608267 TGGCAGAAGGTGAGGGTGGAGGG + Intergenic
947894579 2:233657402-233657424 TGGCAGAAGGTGAATGTGGAAGG + Intronic
947895338 2:233666100-233666122 TGGCAGAAGGTGAGGGTGGAGGG + Intronic
947920390 2:233866349-233866371 TGTAAGAGGGTGGAGGTGGCTGG + Intergenic
949022342 2:241748695-241748717 CACCAGGGGCTGAAGGTGGAGGG - Intronic
949027992 2:241775199-241775221 CAGCAGGGGGTGAAGGTGGCTGG + Intergenic
1169085497 20:2823089-2823111 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1169321267 20:4635083-4635105 TTTCAGAGGGAGCAGGTGCAGGG - Intergenic
1169521616 20:6379785-6379807 TACCAGATGGGGAAGGTGGTAGG + Intergenic
1169957955 20:11126823-11126845 TGTGAGAGGGTGAAAGTGGAAGG - Intergenic
1171057597 20:21922608-21922630 TATCAGAGGGTGGGGTTGGGAGG - Intergenic
1172489697 20:35325918-35325940 AATCAGAAGGTGGAGCTGGAAGG + Intronic
1173385267 20:42581807-42581829 ACTCAGAGGTTGAAGGGGGAGGG + Intronic
1173965804 20:47111778-47111800 CTTCAGAGGGTGAAGATGTAAGG + Intronic
1173985584 20:47259200-47259222 TTTCAGGGTGTGGAGGTGGAAGG + Intronic
1174671947 20:52316631-52316653 GATGAGAGGGAAAAGGTGGAGGG + Intergenic
1175167336 20:57054199-57054221 GAAGAGGGGGTGAAGGTGGAGGG + Intergenic
1176836839 21:13800658-13800680 TATCAGAGGGTGAAGACTTAGGG - Intergenic
1177151433 21:17459083-17459105 TCTCAGAGGGTGGAGGTGGGGGG + Intergenic
1177213564 21:18100279-18100301 TAATAGATGTTGAAGGTGGAAGG + Intronic
1177279579 21:18963754-18963776 TATCTGAGGGTGAATGTTGGAGG - Intergenic
1177488839 21:21794681-21794703 ATTCAGAGGGTGAAAGTGAAGGG + Intergenic
1177963334 21:27696518-27696540 TATCAGAGGGTCAGGGTGAGTGG - Intergenic
1178973775 21:37204707-37204729 TATCAGAAGGAGAAGCTGGGAGG + Intergenic
1179058218 21:37955327-37955349 TATCACAGGGGGAGGGAGGATGG + Intronic
1179640587 21:42745155-42745177 TCTCAGAGGCAGAAGGTGAAGGG + Intronic
1181585944 22:23853838-23853860 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1181712511 22:24699482-24699504 TACCAGACGCGGAAGGTGGAAGG + Intergenic
1182028513 22:27138772-27138794 TTGCAGAGGTTCAAGGTGGAGGG + Intergenic
1182538722 22:31026313-31026335 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1182824516 22:33253354-33253376 TCTCAGAGGGTGAAAGAAGATGG + Intronic
1183124084 22:35758570-35758592 TGTCAGAGGTTGAAGGTCAAAGG + Intronic
1183182352 22:36268598-36268620 ACTCAGGGGGTCAAGGTGGAAGG - Intergenic
1184201197 22:42971109-42971131 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184202453 22:42980510-42980532 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184241717 22:43214492-43214514 TATAAGCGGGTGGAGATGGAGGG - Intronic
1184523951 22:45010366-45010388 TATCAGAGGGAGGCGGAGGAGGG - Intergenic
949097380 3:101404-101426 TAGGACAGGGTGAAGGTGAATGG - Intergenic
950112373 3:10427650-10427672 TCTGGGATGGTGAAGGTGGAGGG + Intronic
950286420 3:11748772-11748794 TATCAGAGGGGTCATGTGGATGG + Intergenic
950515565 3:13462784-13462806 AATCAGACATTGAAGGTGGAGGG - Intergenic
950887449 3:16374112-16374134 CATGAGATGGTGAAGGTGAAAGG - Intronic
951959221 3:28296951-28296973 AATAAGAGTTTGAAGGTGGAAGG - Intronic
952550828 3:34475118-34475140 TACCAGAGGCTGGTGGTGGAGGG - Intergenic
953560062 3:43981539-43981561 TACCAGAGGGTGAAGGGTGAGGG - Intergenic
953827855 3:46269583-46269605 CACCAGAGGGTGAGGATGGATGG - Intergenic
954399787 3:50312948-50312970 CATCAGAGGGAGACCGTGGAGGG + Intergenic
955412909 3:58667421-58667443 AATTAGAGGTTAAAGGTGGAGGG + Intergenic
955502371 3:59598030-59598052 TATGTGGGGCTGAAGGTGGAAGG - Intergenic
956169250 3:66419744-66419766 GATCAGAGGGTGGAGCTGGTAGG - Intronic
958707853 3:97678366-97678388 GTTCAGAGGGTGCAGTTGGAAGG + Intronic
958851973 3:99338328-99338350 TACCAGAGGCTGAGGGTGGGAGG - Intergenic
959415920 3:106075761-106075783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
960780797 3:121314567-121314589 CATCAGAGGGAGACCGTGGAGGG + Intronic
962469715 3:135695427-135695449 TATTAGAGAGTGTTGGTGGAGGG + Intergenic
962816057 3:139001852-139001874 TACCAGAGGCTGGAGGAGGAGGG - Intergenic
963498217 3:146095910-146095932 CATCAGAGGGAGACTGTGGAGGG - Intronic
963586265 3:147193315-147193337 TACCAGATGGTGAAGGTGTCTGG - Intergenic
963911782 3:150821809-150821831 CATCAGAGGGAGACCGTGGACGG + Intergenic
966104394 3:176318747-176318769 TATTAGAGGGTGCAGCTTGAAGG - Intergenic
966783686 3:183607362-183607384 CATCAGAGGGAGACCGTGGAAGG - Intergenic
967251688 3:187546619-187546641 CATGAGAGGGAGAAGGTGTAGGG - Intergenic
968506991 4:975366-975388 CATCAGAGGGAGACCGTGGAAGG - Intronic
969182037 4:5449622-5449644 GAGCAGGGGGTGAAGGTGAATGG + Intronic
969834607 4:9830354-9830376 TATCAGGGGGTTGTGGTGGAGGG + Intronic
969922849 4:10557257-10557279 TAGAGAAGGGTGAAGGTGGAGGG - Intronic
969997583 4:11328802-11328824 TACTAGAGGGTGAAGGGAGAGGG + Intergenic
970320183 4:14867800-14867822 TACTAGAGGGAGAAGGTGGAAGG + Intergenic
970409072 4:15790206-15790228 CATCAGAGGGAGACCGTGGAAGG - Intronic
970544969 4:17119053-17119075 TTTCAGAGGATAAAGGTAGAGGG + Intergenic
971185766 4:24374399-24374421 TATCAGAGGGTGGGGGTGGAAGG + Intergenic
971362225 4:25948952-25948974 AATCAAAGAGTGAAGGTGGTAGG + Intergenic
971589064 4:28443572-28443594 TTTGAGGGGGTGAAGGTGGGAGG + Intergenic
972653990 4:41048696-41048718 CATCAGAGGGAGACCGTGGAAGG - Intronic
973564618 4:52171490-52171512 TTTCAGAGGGTGAGGTGGGAGGG - Intergenic
973657493 4:53064268-53064290 TACTAGAGGGGGAGGGTGGAAGG - Intronic
974085572 4:57257039-57257061 TATCAGAGGTAGACGGTGGTAGG - Intergenic
974801092 4:66819018-66819040 TATTAGGGGGTGAAAGTGGATGG + Intergenic
975685418 4:76916103-76916125 CATCAGAGGGAGACCGTGGAAGG - Intergenic
976743167 4:88378016-88378038 AACCAGAGGGTGGAGGCGGAAGG - Intergenic
976764103 4:88581054-88581076 CATCAGAGGGCAAAGGAGGAAGG + Intronic
978260728 4:106754604-106754626 TATCAGAGGCTGAGGGTAGAAGG - Intergenic
978305287 4:107321818-107321840 TACCTGAGGGTGGAGGTGGAGGG - Intergenic
978408967 4:108408843-108408865 CATCAGAGGGAGACCGTGGAAGG - Intergenic
978810777 4:112847156-112847178 TATCAGAGAGTGGAGGCTGAAGG - Intronic
979273574 4:118791548-118791570 CATCAGAGGGAGACCGTGGAGGG - Intronic
979538667 4:121854110-121854132 TATTAGAGAGTGATGGTAGAAGG - Intronic
980282700 4:130741034-130741056 TACCAGAGGTTGAGGGTGGAGGG - Intergenic
980306548 4:131068085-131068107 TGGCAGAAGGTGAAGGTGAAGGG - Intergenic
980468831 4:133222905-133222927 TATCCGAAGGTGAACGAGGAGGG + Intergenic
981724932 4:147837202-147837224 TACCAAAGGGTGAGTGTGGAGGG + Intronic
982040247 4:151390193-151390215 CATCAGAGGGAGACCGTGGAAGG - Intergenic
983802426 4:171949533-171949555 TAAAAGAGGGTGAAGGTGAGGGG + Intronic
984804404 4:183737761-183737783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
984980257 4:185273674-185273696 TACCAGGGGCTGAAGGTGGGAGG - Intronic
986061757 5:4198313-4198335 TGTCAGTGGGTGCAGATGGAAGG + Intergenic
986122756 5:4857429-4857451 CATCAGAGGGTGATGGGAGATGG - Intergenic
986482652 5:8204350-8204372 TAGCAGAAGGTGAAGGAGGAAGG - Intergenic
986516676 5:8571691-8571713 TCTCAGAAGGTGAAGGAGGGTGG + Intergenic
987446887 5:18031203-18031225 TATCGGAGGGTGGAGGGTGAAGG - Intergenic
987590700 5:19922039-19922061 TCTGAGAATGTGAAGGTGGAGGG + Intronic
988933288 5:36058348-36058370 TATCAGGGGCTGAAGGTGGAGGG + Intronic
989383944 5:40836099-40836121 ACTCAGGGGGTGGAGGTGGAGGG + Intergenic
989588164 5:43089091-43089113 CATCAGAGGGAGACCGTGGAAGG + Intronic
990786921 5:59431777-59431799 TACTTGAGGGTGAAGGTGGGAGG - Intronic
991275595 5:64842842-64842864 TTTGAGAGGGTGAGGGTGGGCGG - Intronic
991375248 5:65958593-65958615 CATCAGAGGGAGACCGTGGAAGG + Intronic
992021394 5:72628175-72628197 TATCAGAGGGTGGAGAGTGAGGG + Intergenic
992718723 5:79537424-79537446 GAACAGAGGGTAAAGGTTGAGGG - Intergenic
992785531 5:80167229-80167251 TATCAGAGGGTGGAGGTGGGAGG - Intronic
993050893 5:82924516-82924538 TATCAGGTGGTGATGGTGGGAGG + Intergenic
993301233 5:86213572-86213594 TGTCAGAGGGTGGTGGTGGGAGG - Intergenic
993763537 5:91827184-91827206 TGCTAGAGGGTGAAGGTAGAGGG + Intergenic
994234819 5:97350086-97350108 TATCAGAGGGTGGAGCATGATGG - Intergenic
994430709 5:99656762-99656784 TATCGGAGGGTGGATGTGGGAGG + Intergenic
995822153 5:116247807-116247829 TATTGGAGGGTGAAGGTGGGAGG + Intronic
996437198 5:123447786-123447808 TATCATTGGGAGAAGCTGGATGG - Intergenic
996675058 5:126165508-126165530 TATTTGATGGGGAAGGTGGAGGG - Intergenic
998225978 5:140326582-140326604 CATCAGAGGTTGAAGATGCAAGG - Intergenic
998681456 5:144472322-144472344 GTTCAGAGGGTGGAAGTGGAGGG + Intronic
998754203 5:145358256-145358278 TATGAGAGGGAGGAGGTGGATGG + Intergenic
999369225 5:151043129-151043151 CAGCAGTGGATGAAGGTGGATGG - Intronic
1000346228 5:160316328-160316350 CTTCAGAGGTTGAGGGTGGAGGG - Intronic
1001397017 5:171424839-171424861 CAGCAGAGGGGGAAGGGGGAGGG + Intronic
1001971249 5:175956614-175956636 CAGCAGCGGGTGAAGGAGGAGGG - Intronic
1002246193 5:177887163-177887185 CAGCAGCGGGTGAAGGAGGAGGG + Intergenic
1002400690 5:178990281-178990303 AATCTGAGGGTGAGGGTGGGAGG - Intronic
1003074066 6:2968293-2968315 TATCAGAGGGTGGAGGGTGAAGG + Intronic
1003606468 6:7565823-7565845 GGGCAGAGGGTGGAGGTGGAAGG + Intronic
1003799892 6:9651974-9651996 TATTAGAGTTTGAAAGTGGAAGG + Intronic
1004897157 6:20159606-20159628 TACCAGAGGCTGGGGGTGGAAGG + Intronic
1005562667 6:27056664-27056686 TACCAGAGGGTGGAGGGGGAAGG - Intergenic
1005651425 6:27888698-27888720 TGTAGGAGGGTGAAGGAGGAAGG + Intergenic
1006155510 6:32011011-32011033 CCTCAGAGTGTGCAGGTGGACGG - Intergenic
1006161843 6:32043865-32043887 CCTCAGAGTGTGCAGGTGGATGG - Exonic
1006265254 6:32916261-32916283 TATTGGAGGGTGGAGGTGGGAGG - Intergenic
1006339963 6:33441507-33441529 CCTCTGAGGGTGCAGGTGGAGGG - Intronic
1006479634 6:34281347-34281369 TATCAGAGAGAGGAAGTGGAAGG - Exonic
1007270807 6:40635534-40635556 TTTCAGAGAGTGGAGGGGGAGGG - Intergenic
1008135007 6:47764818-47764840 TCTTAGAGGGTGAAGGTGGGTGG + Intergenic
1008225552 6:48910588-48910610 TATCAGGGGGTAAAGGTCTAGGG + Intergenic
1008288193 6:49680147-49680169 TATCAGAGGGTGGAGGATGCAGG - Intergenic
1008318756 6:50080615-50080637 TGTCAGAGGGTTGGGGTGGAAGG - Intergenic
1008480531 6:51981369-51981391 CATCAGAGGGAGACCGTGGAGGG - Intronic
1012954343 6:105552866-105552888 TATGAGAGGCTGAAGATGGAAGG + Intergenic
1012976333 6:105784551-105784573 TCTAAGAGAGTGAAGGTTGAAGG - Intergenic
1012993055 6:105946011-105946033 CATCAGAGTTTGGAGGTGGAGGG - Intergenic
1013427449 6:110026096-110026118 TATCAGAGGGGGCAGGGGGAAGG + Intergenic
1013752598 6:113424468-113424490 TAGCAGAGCGGGAAGATGGAAGG - Intergenic
1014369880 6:120591857-120591879 TATCAGCGGGTAAAGGAGGAAGG - Intergenic
1015675890 6:135748196-135748218 TATCAGAGGCTGAGAGTGGTGGG - Intergenic
1016118723 6:140321183-140321205 TCTCAGAGGGTCATTGTGGAGGG - Intergenic
1016700165 6:147045377-147045399 GTTCAGAGGGTAAAGGTGTAAGG - Intergenic
1017306169 6:152921245-152921267 TTTTACAGGGTGTAGGTGGAGGG - Intergenic
1017819048 6:158036610-158036632 TATCAGAGGGTGGAGGATGGAGG + Intronic
1018339532 6:162836556-162836578 TACCAAAGAGTGGAGGTGGAGGG + Intronic
1018602875 6:165563985-165564007 GATCAGTGGGAGAGGGTGGAGGG - Intronic
1018791466 6:167151511-167151533 TGTCAGAGAGTGAAGGAGTAAGG + Intronic
1019132055 6:169884221-169884243 TCTCAGAGGCTGAAGATGCATGG + Intergenic
1019411025 7:906817-906839 GGTCAGATGGTGATGGTGGATGG + Intronic
1019459303 7:1147934-1147956 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1019715176 7:2535260-2535282 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1019843088 7:3468900-3468922 CTTCAGAGGGTGAAGGGGGTAGG + Intronic
1020512394 7:9074135-9074157 TACCAGAGGGTGGAGGGTGAAGG - Intergenic
1021735151 7:23635906-23635928 CATCAGAGGGAGACCGTGGAAGG - Intronic
1023797802 7:43808272-43808294 GTTCAGAGGGAGAAGGTGGCTGG - Intergenic
1024575929 7:50764139-50764161 TACCAGCAGGGGAAGGTGGAAGG - Intronic
1025979687 7:66395044-66395066 CATCAGAGGGAGACCGTGGAGGG + Intronic
1027496861 7:78898648-78898670 TATCAGAGGATCAGGGTGGGAGG + Intronic
1027513674 7:79114450-79114472 TTTCAGAGGCTGAAATTGGAAGG + Intronic
1027991235 7:85363765-85363787 TATCAGAGGATGAGGGTGGGGGG - Intergenic
1028026270 7:85844354-85844376 TATCAGAGGCTGGAGGGGGTGGG + Intergenic
1028042346 7:86069868-86069890 TACCAGAGGCTGGAGGTGGAAGG - Intergenic
1028938461 7:96492235-96492257 TATCAGGGGTTGAAGGGAGAGGG - Intronic
1030645140 7:112052739-112052761 TATCAAAGGGGGATGGTGGGAGG - Intronic
1031193545 7:118585822-118585844 TATGAGAAGGTGAAAGTGAAAGG - Intergenic
1031893094 7:127317957-127317979 TGTCAGAGGCTGGAGGAGGAGGG + Intergenic
1033323597 7:140361572-140361594 CATCAGAGGGAGACCGTGGAAGG - Intronic
1034526042 7:151663233-151663255 TAACATAAAGTGAAGGTGGAAGG - Intronic
1034961979 7:155368406-155368428 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1035159928 7:156943086-156943108 TTTCAGAGGCTGAAGGGTGACGG - Intergenic
1035219711 7:157399032-157399054 TCTCAGAGGGTGAGGCTGAACGG + Intronic
1037153868 8:15675594-15675616 TATTAGAGGGTAGAGGAGGAAGG - Intronic
1037930236 8:22875471-22875493 TATTTGAGGGGGAAGGTGGGAGG - Intronic
1037974140 8:23197521-23197543 TATCTGAGGGTGATGGGAGACGG - Intronic
1038117988 8:24579242-24579264 TATCAGTGGGTGGGGGTGAAGGG + Intergenic
1038594947 8:28880282-28880304 CATCAGAGGGAGACCGTGGAGGG - Intronic
1038687715 8:29733800-29733822 CATCAGAGGGTGAAGGGAGAGGG - Intergenic
1038745043 8:30247855-30247877 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1038774622 8:30517456-30517478 AATTAGTGGCTGAAGGTGGAGGG + Intronic
1038922463 8:32099907-32099929 ACTCAGTGGATGAAGGTGGAGGG + Intronic
1039012853 8:33114179-33114201 TATCAGAGGGTGAGGGTAGGAGG + Intergenic
1039779729 8:40772598-40772620 AATAAGATGATGAAGGTGGAAGG - Intronic
1039965976 8:42284178-42284200 CATCATAGGGTGAAGGCGAAAGG + Intronic
1040070180 8:43181065-43181087 CATCAGAGGGAGACCGTGGAGGG + Intronic
1040818482 8:51533517-51533539 CATCAGAGGGAGACCGTGGAGGG - Intronic
1041282634 8:56226841-56226863 TATCAGAGGATAACAGTGGATGG - Intergenic
1041487547 8:58395712-58395734 TGTCACAGGGTGGAGGTGGAAGG + Intergenic
1041555531 8:59150347-59150369 TATCACAGGATGAAAGAGGAAGG - Intergenic
1043935772 8:86140601-86140623 TATTAGATAGTGAAGGAGGAGGG + Intronic
1044081984 8:87896785-87896807 TTCCAGAGGGTGAAGGTTTAGGG + Intergenic
1044340774 8:91044219-91044241 TCTAAGAGGATGATGGTGGAAGG + Intergenic
1044801948 8:95966151-95966173 TAAGAGAGGGAGAAGGAGGAAGG + Intergenic
1044817823 8:96131108-96131130 TACAAGTGGGGGAAGGTGGAAGG - Intergenic
1045120610 8:99029748-99029770 CATCAGAGGGAGACCGTGGAAGG + Intronic
1045148938 8:99381051-99381073 TATCAGAGGGTGGAGGGTGAAGG - Intronic
1046636106 8:116678013-116678035 CATCAGAGGGAGACCGTGGAAGG - Intronic
1046676466 8:117114329-117114351 GTTCAGAGGGGCAAGGTGGAAGG - Intronic
1047068219 8:121311345-121311367 TATCAGAGGGTGGAACTGGGAGG - Intergenic
1048718750 8:137298574-137298596 TAGAAAAGGGTAAAGGTGGAGGG - Intergenic
1048958784 8:139558418-139558440 TATCTGGAGGTGAAGGAGGATGG + Intergenic
1048990729 8:139758690-139758712 TGTCAGAAGGTGAAGGCGGTTGG + Intronic
1049414598 8:142489446-142489468 CATCAGAGTGTGCACGTGGACGG - Intronic
1049444712 8:142624647-142624669 GATCCAAGGGTGAAGCTGGAGGG - Intergenic
1049517939 8:143071978-143072000 TTTCAGAGGGTAAATGTGAAGGG - Intergenic
1049959318 9:723210-723232 CATCCAAGGGTCAAGGTGGAAGG - Intronic
1050572028 9:6949814-6949836 CATCAGAGGGAGACCGTGGAGGG + Intronic
1050651248 9:7779154-7779176 ACTCAGAGGGTGGAAGTGGAGGG + Intergenic
1051527318 9:18060476-18060498 TGTCAGAAGCTGAAGCTGGAAGG - Intergenic
1051791912 9:20814598-20814620 TCTGGGAGGCTGAAGGTGGATGG - Intronic
1053286415 9:36852230-36852252 GATCAAAGGGTGAAGGGGCAGGG - Intronic
1053301690 9:36957020-36957042 TATAAGAGGGTGGAAGTGGGGGG - Intronic
1057626250 9:96679881-96679903 TATCTGGGACTGAAGGTGGAGGG + Intergenic
1058764183 9:108165428-108165450 TATCAGGTGGGGAAGGGGGATGG - Intergenic
1059238912 9:112786261-112786283 TAGCAGAGCGTGATGGTGCACGG - Intronic
1059744108 9:117183684-117183706 TATCTGAGAGGGAAGGTGAAGGG - Intronic
1061099894 9:128484616-128484638 AAGCAGAGGGTGAAGGAGAAAGG - Intronic
1061799997 9:133108630-133108652 TGCCAGAGGGTGAATGAGGAGGG - Intronic
1186420726 X:9423751-9423773 TACCAGAGGCTGCAGGAGGAAGG - Intergenic
1187563243 X:20422418-20422440 TATCAGAGGGTGGAGGGTGGAGG - Intergenic
1188004248 X:25006110-25006132 TGTCAGAGGGAAAAAGTGGAGGG + Intronic
1188368141 X:29335235-29335257 CATCAGAGGGAGACCGTGGAGGG + Intronic
1188513854 X:30964392-30964414 TATCATATGGTGCAGGTGGAGGG - Intronic
1188928396 X:36074790-36074812 CATCAGAGGCTGAAGGTTGAGGG - Intronic
1189838235 X:45042224-45042246 CATCAGAGGGAGACCGTGGAAGG + Intronic
1190417916 X:50199493-50199515 TGGCAGGGGGTGATGGTGGAAGG - Intronic
1190760520 X:53434311-53434333 TGTCGGAGCGTGAAGGTAGAAGG - Exonic
1190845283 X:54185013-54185035 TATAAATGGGGGAAGGTGGAGGG - Intergenic
1190918900 X:54831355-54831377 TACCAGAGGCTGAGGGAGGAGGG - Intergenic
1191164718 X:57376381-57376403 TGTCAGAGGGTGAAGGGCTAGGG - Intronic
1191764870 X:64686862-64686884 TATCAGAGTCAGAGGGTGGAGGG + Intergenic
1194250680 X:91570949-91570971 TATCAGGGGCTGAAGGAGTAAGG + Intergenic
1194358979 X:92923882-92923904 TATCAGAGGATGACTGTGTAGGG + Intergenic
1194820889 X:98505695-98505717 TATCAGAGGGAGAAAATTGAGGG + Intergenic
1196504620 X:116426652-116426674 GATAAGAGGGGAAAGGTGGAAGG + Intergenic
1196699114 X:118646892-118646914 TTTCAGAGAGTGAAGCTAGAGGG - Intronic
1197028433 X:121783430-121783452 TATCTCTGGGTGATGGTGGAGGG - Intergenic
1198788817 X:140319847-140319869 TAACAGAGAAGGAAGGTGGAAGG - Intergenic
1199037644 X:143072062-143072084 TATCAGAGGGGGATGGAAGATGG + Intergenic
1199074159 X:143510807-143510829 GATCCGAAGGAGAAGGTGGAGGG - Intronic
1199093153 X:143714068-143714090 GATCCGAAGGAGAAGGTGGAGGG - Intronic
1199215182 X:145254092-145254114 GATCCGAAGGAGAAGGTGGAGGG + Intronic
1199491783 X:148407949-148407971 TATCAAAGGGAGAATGTAGATGG - Intergenic
1200569623 Y:4812198-4812220 TATCAGGGGCTGAAGGAGTAAGG + Intergenic
1202090890 Y:21188218-21188240 TACCAGAGGGTGAAGGCTGGAGG - Intergenic