ID: 1092725557

View in Genome Browser
Species Human (GRCh38)
Location 12:11482350-11482372
Sequence TGCTTCTAGACCCATTGGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 86}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092725557_1092725568 23 Left 1092725557 12:11482350-11482372 CCAACCCAATGGGTCTAGAAGCA 0: 1
1: 0
2: 0
3: 12
4: 86
Right 1092725568 12:11482396-11482418 GATAGACCCTTGTGGGGGCCAGG 0: 1
1: 0
2: 2
3: 9
4: 106
1092725557_1092725567 18 Left 1092725557 12:11482350-11482372 CCAACCCAATGGGTCTAGAAGCA 0: 1
1: 0
2: 0
3: 12
4: 86
Right 1092725567 12:11482391-11482413 CAATAGATAGACCCTTGTGGGGG 0: 1
1: 0
2: 0
3: 1
4: 77
1092725557_1092725565 16 Left 1092725557 12:11482350-11482372 CCAACCCAATGGGTCTAGAAGCA 0: 1
1: 0
2: 0
3: 12
4: 86
Right 1092725565 12:11482389-11482411 GGCAATAGATAGACCCTTGTGGG 0: 1
1: 0
2: 0
3: 4
4: 57
1092725557_1092725562 -5 Left 1092725557 12:11482350-11482372 CCAACCCAATGGGTCTAGAAGCA 0: 1
1: 0
2: 0
3: 12
4: 86
Right 1092725562 12:11482368-11482390 AAGCAGTCAACTGTTTCCTGGGG 0: 1
1: 0
2: 2
3: 12
4: 150
1092725557_1092725561 -6 Left 1092725557 12:11482350-11482372 CCAACCCAATGGGTCTAGAAGCA 0: 1
1: 0
2: 0
3: 12
4: 86
Right 1092725561 12:11482367-11482389 GAAGCAGTCAACTGTTTCCTGGG 0: 1
1: 0
2: 0
3: 14
4: 132
1092725557_1092725560 -7 Left 1092725557 12:11482350-11482372 CCAACCCAATGGGTCTAGAAGCA 0: 1
1: 0
2: 0
3: 12
4: 86
Right 1092725560 12:11482366-11482388 AGAAGCAGTCAACTGTTTCCTGG 0: 1
1: 0
2: 0
3: 14
4: 145
1092725557_1092725564 15 Left 1092725557 12:11482350-11482372 CCAACCCAATGGGTCTAGAAGCA 0: 1
1: 0
2: 0
3: 12
4: 86
Right 1092725564 12:11482388-11482410 GGGCAATAGATAGACCCTTGTGG 0: 1
1: 0
2: 0
3: 4
4: 82
1092725557_1092725566 17 Left 1092725557 12:11482350-11482372 CCAACCCAATGGGTCTAGAAGCA 0: 1
1: 0
2: 0
3: 12
4: 86
Right 1092725566 12:11482390-11482412 GCAATAGATAGACCCTTGTGGGG 0: 1
1: 0
2: 0
3: 1
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092725557 Original CRISPR TGCTTCTAGACCCATTGGGT TGG (reversed) Intronic
902265491 1:15260538-15260560 TGCTTCTAGCCCCACTCTGTTGG + Intronic
902806790 1:18865923-18865945 TGCTTCTGAACCAAGTGGGTTGG - Intronic
904438421 1:30514346-30514368 TGCTCCTAGACCCAGGGGGTGGG - Intergenic
906048601 1:42852255-42852277 TGCTTCTAGATCTCTGGGGTGGG + Exonic
907025362 1:51112689-51112711 TGGTTATAGACCCTTTGGTTGGG + Intronic
911288532 1:96027888-96027910 GATTTCTAGACCCATTGGGCAGG + Intergenic
912542516 1:110427840-110427862 TGCTTCTAGGCTCAGTGGGGAGG - Intergenic
916861452 1:168810219-168810241 TGCTTCTAACCGCATTGGCTAGG - Intergenic
917931208 1:179824129-179824151 TGCTTCTAAACTCATTTGTTGGG + Intergenic
921329787 1:214024119-214024141 TACCTCAAGTCCCATTGGGTAGG + Intronic
922737769 1:227998543-227998565 AGCTTCTGGACCCACTGGGCTGG + Intergenic
922737782 1:227998608-227998630 AGCTTCTGGACCCGTTGGGTTGG + Intergenic
1064157418 10:12915685-12915707 TGCTACTGGAGCCTTTGGGTAGG + Intronic
1064243504 10:13651300-13651322 TGCTTCTGGAGCCACTGAGTCGG + Intronic
1066448692 10:35508582-35508604 TGCTTCTAGGCCCATTTAGCAGG + Intronic
1067537469 10:47124313-47124335 ACCTTCTAGACCTACTGGGTGGG - Intergenic
1070027270 10:72643872-72643894 AGCATCTAGACCATTTGGGTAGG - Intergenic
1071345198 10:84685576-84685598 TGCTTCTTGACTCAGTGGCTTGG - Intergenic
1071406038 10:85333663-85333685 ACCTTCTAGACACACTGGGTGGG + Intergenic
1077473453 11:2775598-2775620 TGCTCCTTGACCCCTTGGGGGGG + Intronic
1079282069 11:19096552-19096574 TGTTTCTAGACCCATTTGATAGG - Intergenic
1080458713 11:32436035-32436057 TGCTTCTAGAACTGTCGGGTAGG + Intergenic
1082994403 11:59239088-59239110 TGCTTTTACACACATTTGGTGGG + Intergenic
1085625752 11:78071380-78071402 TGCCTATAGACCCATTGACTTGG - Intronic
1085759287 11:79227954-79227976 TCCTTCTAAACCCAGTGGGTGGG + Intronic
1092725557 12:11482350-11482372 TGCTTCTAGACCCATTGGGTTGG - Intronic
1094339445 12:29394512-29394534 TGCTTCTAGATCCTGTGAGTAGG - Intergenic
1096610440 12:52797425-52797447 TTCTTCAACACCCACTGGGTAGG + Intergenic
1098177116 12:67804476-67804498 TGCATCTAGTCCAGTTGGGTAGG + Intergenic
1098452785 12:70639109-70639131 TCCTTCTAGAAGCCTTGGGTGGG + Exonic
1100173352 12:92002477-92002499 TGCTGGTAGACACACTGGGTTGG + Intronic
1103034500 12:117645630-117645652 TGCTTCCAGGAACATTGGGTGGG - Intronic
1119466345 14:74861833-74861855 TGCTTGTAGAGCTATGGGGTTGG + Intronic
1121800953 14:96773829-96773851 TGCTTCATGACCCATTGCGTTGG + Intergenic
1126904417 15:53348993-53349015 TGCTTCTAACCCCATTGTGGGGG - Intergenic
1127797931 15:62454392-62454414 TGCTTCCAGACCCATTGGAGGGG + Intronic
1134136495 16:11679877-11679899 TGCTTTTGGACTCATTGTGTTGG - Intronic
1134612929 16:15624738-15624760 AGCTTCTTGACCCATGGGGGTGG - Intronic
1139729518 16:68931122-68931144 TGCTTCTGGACCTTTTGGGAAGG - Intronic
1139870941 16:70108216-70108238 TGCTCCTTGACCCATTTGGCTGG + Intergenic
1140375934 16:74445657-74445679 TGCTCCTTGACCCATTTGGCTGG - Intergenic
1141915061 16:87090128-87090150 TGCTTCTGGACAGATGGGGTGGG + Intronic
1142738655 17:1917688-1917710 TGCTCCCAGACCCACTGGGCAGG + Intergenic
1146437010 17:32859506-32859528 TGGTCCTAAAGCCATTGGGTTGG - Intronic
1146785788 17:35720192-35720214 TGCATCTAAACCCTTAGGGTCGG - Intronic
1148587701 17:48792527-48792549 TCCTTCTTGACCCCTTGGGCTGG - Intronic
1152988730 18:343189-343211 TGCTTCTGGGCACATTGGGTAGG + Intronic
1155639557 18:27997719-27997741 TGCCTCTAGATAAATTGGGTTGG + Intronic
1162487961 19:10973367-10973389 TGCTTTTAGGTCCCTTGGGTAGG + Intronic
1163292936 19:16392427-16392449 TCCTTCTAGATCCATTTGGAGGG - Exonic
1167801999 19:51749488-51749510 TGCTTCTCCATCCATTGGATGGG + Intronic
929043293 2:37767696-37767718 TGCTGCTAGCCCCTTGGGGTAGG - Intergenic
933104022 2:78299014-78299036 TGCCTGTAGTCCCATTGGCTGGG - Intergenic
934922897 2:98359973-98359995 GGCTTCTCGACCCTTTGGGAGGG + Intronic
935262939 2:101370748-101370770 TGATTCTGGAACCATTTGGTGGG - Intronic
947297444 2:228647575-228647597 TGCCTCTGGACACAATGGGTAGG + Intergenic
1170959928 20:21016223-21016245 AGCTTCCACACCCCTTGGGTAGG + Intergenic
1172147879 20:32769520-32769542 TGCTTCTTGACCGTTGGGGTGGG + Intronic
1175323917 20:58109437-58109459 GCCTTCTAGACCCACTGGGGTGG - Intergenic
1178237456 21:30859064-30859086 ATCTTCTAGACCCATTGTGGTGG - Intergenic
1178636666 21:34309542-34309564 TGCTTCCAGCCCTATTAGGTGGG + Intergenic
1180025643 21:45160116-45160138 TGCCTCCAGGCCCATCGGGTAGG + Intronic
949415710 3:3811802-3811824 AGCTTCCAGACTCATTGGGGAGG + Intronic
950665554 3:14492857-14492879 TGGTTCTGGGCCCATTGGGCAGG - Exonic
952953773 3:38544080-38544102 CGCTTCTCGGCCCCTTGGGTGGG - Intergenic
955167914 3:56533356-56533378 TTTTTCCAGACCTATTGGGTTGG - Intergenic
955690426 3:61585411-61585433 TGGTACTATAGCCATTGGGTGGG + Intronic
973552579 4:52051016-52051038 TGTTCCTTGACCCACTGGGTGGG - Intergenic
977716490 4:100189827-100189849 TGCCTCTGGATCTATTGGGTGGG - Intronic
980676054 4:136082904-136082926 TGCTTCTAAGCACATTAGGTGGG - Intergenic
982359347 4:154502824-154502846 TGGTTCTAGACAGATTGGGCAGG - Intergenic
982821839 4:159950562-159950584 TGCTTCTAGTCCCACTGGTTGGG + Intergenic
984835089 4:184011888-184011910 AGCTTCTAGATCCATTGGAGAGG - Intronic
997073392 5:130643225-130643247 TTCTTCTAGTGCCACTGGGTTGG - Intergenic
998218906 5:140259364-140259386 TGCTTCTACAACCCTTGTGTTGG - Intronic
1001309178 5:170598510-170598532 TGCTTCTATACTCACAGGGTAGG - Intronic
1001938380 5:175723420-175723442 TGCTCTTAGAGCCATGGGGTCGG + Intergenic
1004348170 6:14867583-14867605 TGCTTCTTGACCCATTAGCTAGG - Intergenic
1006183803 6:32169200-32169222 TGCTTCAGGGCCCACTGGGTGGG + Exonic
1008012894 6:46487872-46487894 TGCTACTAGAACCATTGGTTTGG - Intronic
1021813853 7:24428608-24428630 TGCTTCTATCCCCACTGGGGTGG - Intergenic
1022028821 7:26473131-26473153 TGCTTCAGGACACAGTGGGTGGG - Intergenic
1023325047 7:39045245-39045267 AGCTTCAGGACCCACTGGGTGGG + Intronic
1029961814 7:104695700-104695722 TGCTTCTAGGTCCCTTGGGTAGG - Intronic
1037643568 8:20770624-20770646 TGCTTCAAGATCCTTTGGGCCGG - Intergenic
1042503588 8:69536535-69536557 TGCTTCTAGGTACATTTGGTTGG + Intronic
1043606083 8:82001902-82001924 CTCTTCTATACCCATTGGATGGG + Intergenic
1044516395 8:93143637-93143659 TGCTTCTAGACTCATTGAAATGG + Intronic
1046265532 8:111824759-111824781 TGTTTCTATTCTCATTGGGTTGG - Intergenic
1048205421 8:132411700-132411722 AGCTTCTAGTTCCTTTGGGTGGG - Intronic
1050174191 9:2852901-2852923 AGCTTCTGGACCCCTTGGGTGGG - Intergenic
1052396648 9:27947017-27947039 TGCTTCTTGACATATTGGATTGG - Intergenic
1057569749 9:96195423-96195445 TCCTTCCAGACCCATTTTGTTGG + Intergenic
1061288852 9:129639592-129639614 TGCTTCTGGACACTTTAGGTGGG - Intronic
1185874356 X:3690158-3690180 TGCTGCTATAACCAGTGGGTGGG + Intronic
1193175512 X:78388195-78388217 TGCCTGTAGACCCATTGTTTTGG - Intergenic
1195527325 X:105906488-105906510 TGCTTCAACACCCATTTGTTCGG + Exonic
1196314618 X:114208804-114208826 ACCTTCTAGACCCACTGGGATGG + Intergenic
1201282646 Y:12354575-12354597 TACTTTTAGAGCCATTGGGGTGG + Intergenic