ID: 1092729272

View in Genome Browser
Species Human (GRCh38)
Location 12:11513005-11513027
Sequence ACACCCTTCTTCACTGAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 188}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092729272_1092729279 29 Left 1092729272 12:11513005-11513027 CCAGTCTCAGTGAAGAAGGGTGT 0: 1
1: 0
2: 2
3: 17
4: 188
Right 1092729279 12:11513057-11513079 TCCCCTGGAAAACTACTACATGG 0: 1
1: 0
2: 2
3: 13
4: 192
1092729272_1092729276 14 Left 1092729272 12:11513005-11513027 CCAGTCTCAGTGAAGAAGGGTGT 0: 1
1: 0
2: 2
3: 17
4: 188
Right 1092729276 12:11513042-11513064 CCCAGAACACCACTCTCCCCTGG 0: 1
1: 0
2: 2
3: 22
4: 258

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092729272 Original CRISPR ACACCCTTCTTCACTGAGAC TGG (reversed) Intergenic