ID: 1092730498

View in Genome Browser
Species Human (GRCh38)
Location 12:11528773-11528795
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092730494_1092730498 24 Left 1092730494 12:11528726-11528748 CCTGGACATTGTATATTTTGTGA No data
Right 1092730498 12:11528773-11528795 ATGTGTATGCTGCTGTTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092730498 Original CRISPR ATGTGTATGCTGCTGTTGGG TGG Intergenic
No off target data available for this crispr