ID: 1092736783

View in Genome Browser
Species Human (GRCh38)
Location 12:11590266-11590288
Sequence ATGGGAGAGAAGAATGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1367
Summary {0: 1, 1: 0, 2: 32, 3: 181, 4: 1153}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092736777_1092736783 23 Left 1092736777 12:11590220-11590242 CCTTAATAATAAGGACTTTTCTG No data
Right 1092736783 12:11590266-11590288 ATGGGAGAGAAGAATGAGGATGG 0: 1
1: 0
2: 32
3: 181
4: 1153
1092736776_1092736783 24 Left 1092736776 12:11590219-11590241 CCCTTAATAATAAGGACTTTTCT No data
Right 1092736783 12:11590266-11590288 ATGGGAGAGAAGAATGAGGATGG 0: 1
1: 0
2: 32
3: 181
4: 1153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092736783 Original CRISPR ATGGGAGAGAAGAATGAGGA TGG Intergenic
900149084 1:1170500-1170522 ATGGAGGAGAGGAAGGAGGAGGG - Intergenic
900384087 1:2401410-2401432 ATGGGAGAGAGGAAGGAGGAAGG - Intronic
900522302 1:3111551-3111573 AAGGAAGAGAAGGAGGAGGAAGG + Intronic
901011002 1:6202012-6202034 ATGGGAGTGAGGATGGAGGATGG - Intronic
901372881 1:8815712-8815734 TTGGGAGAGAAGAGAGAAGATGG - Intronic
901459748 1:9384450-9384472 ATGGGAGAGGAGGAGGAGGGTGG - Intergenic
902074802 1:13775807-13775829 CTGGCAGAGCAGAATGAGAATGG - Intronic
902501078 1:16912251-16912273 ATGGTAGAGAGGAAAGAGCATGG + Intronic
902623276 1:17662687-17662709 ATGGTAGGGAAGGATGGGGAGGG + Intronic
902776877 1:18680482-18680504 ATGGGAGACAGAAAGGAGGAGGG - Intronic
902911225 1:19598678-19598700 ATGGGCGAGAAGAGTGAGAGTGG - Intronic
902922118 1:19672275-19672297 ATGGGACAGGAGAAGGGGGAGGG - Intronic
903030358 1:20459531-20459553 TGGGGAGAGAAGAGTGAGAAAGG - Intergenic
903418518 1:23201367-23201389 CTGGGAGAGGAGAATGAAGGAGG + Intergenic
904106764 1:28091134-28091156 ATGGGAAAGTACAAAGAGGATGG - Intergenic
904364286 1:30000589-30000611 ATGAGACAGAAGAATAAGTAAGG + Intergenic
904392518 1:30195372-30195394 ATGTGAGAAGAGAAGGAGGAAGG - Intergenic
904523821 1:31116671-31116693 ATATGAGAGAAGAATCAAGAAGG - Intergenic
904574731 1:31497863-31497885 AGGGGAGAGAGGAATGGGGAGGG - Intergenic
904638096 1:31900209-31900231 ATAGGACAGAGGAAGGAGGACGG - Intergenic
904836802 1:33342919-33342941 ATGGCAGAGTAGAAAGAGCATGG + Intronic
904937739 1:34143686-34143708 ATGGGAGAAAAAAAGAAGGAAGG + Intronic
905111333 1:35596816-35596838 TTGGCAGAGAAGAAAGAAGATGG - Intergenic
905300688 1:36984658-36984680 TTGGGAGAGAAGAAAGAAGGTGG + Intronic
905406149 1:37733725-37733747 TTGGGGGAGAGGAATGAGAAGGG - Intronic
905692622 1:39954669-39954691 ATGAGAGAGAGGCATCAGGAGGG + Intergenic
905960424 1:42038023-42038045 ACTGGAGAGAAGATAGAGGATGG - Intergenic
906078134 1:43067120-43067142 TGGGGAGAGAAGAAAGAGGCAGG + Intergenic
906245022 1:44267397-44267419 AAGGGAGGGAAGAAGAAGGAGGG - Intronic
906286838 1:44593099-44593121 TTGGGAGAGAAGATTGGGTATGG - Intronic
906591012 1:47023999-47024021 ATGGGAGGGAGGAGGGAGGAAGG + Intronic
906646697 1:47480240-47480262 TTGAGAGAGAAGGATGGGGATGG - Intergenic
907457284 1:54583823-54583845 ATGTGTGAGAAAAATGAGGAGGG - Intronic
908921178 1:69194632-69194654 AAGGCAGAGAAGGATGAGGCTGG - Intergenic
909025758 1:70480022-70480044 ATTGAAGAAAAGAAGGAGGAAGG - Intergenic
909169830 1:72281791-72281813 ATGGTATAAGAGAATGAGGAAGG + Intronic
909483079 1:76146501-76146523 GAGGGAGAAAAGAAGGAGGAGGG - Intronic
909997398 1:82297658-82297680 GGAGGAGAGAAGAAAGAGGAAGG - Intergenic
910330082 1:86062684-86062706 ATGGGAGAAAAAGATGAGAAGGG - Intronic
910743821 1:90551348-90551370 ATGGGACAAAAGAATAAGGCGGG - Intergenic
911051779 1:93677506-93677528 AGGGGAGAGAAAAAGGAGGCAGG + Intronic
911117497 1:94260990-94261012 ATGGGGGTGCAGAATTAGGAAGG - Intronic
911989070 1:104668870-104668892 ATGGAAGGGAAGAAAGAGAAGGG - Intergenic
912016100 1:105038465-105038487 AAGGAAGAAAAAAATGAGGAGGG - Intergenic
912135681 1:106657641-106657663 AGGAGAGAGAAGAGTGAGGGAGG - Intergenic
912570001 1:110614456-110614478 AAGGGAGAGAAGAAGGACGTGGG - Intronic
913258187 1:116974176-116974198 ATGAAAGAGAATAATGAGGCTGG + Intronic
913382149 1:118224170-118224192 CAAGGAGATAAGAATGAGGATGG + Intergenic
913703597 1:121397104-121397126 GTGGGAGAGAAGAAGGAGGGCGG + Intergenic
913942268 1:125119618-125119640 ATGGGAGAGAAGAAGGAGAGCGG + Intergenic
913979947 1:143498815-143498837 ATGGGAGAGAAGAAGGAGGGCGG + Intergenic
914074296 1:144324299-144324321 ATGGGAGAGAAGAAGGAGGGCGG + Intergenic
914104880 1:144642147-144642169 ATGGGAGAGAAGAAGGAGGGCGG - Intergenic
914902313 1:151717206-151717228 AGGGGAAAGAAAAATGAGAAAGG + Intronic
915447661 1:155983311-155983333 ATGGGAAGGAAGAAAGAGGAAGG + Intronic
916189058 1:162161139-162161161 TGGGGAAGGAAGAATGAGGAGGG - Intronic
916368192 1:164057778-164057800 ATGAATGAGAAGAAAGAGGAAGG - Intergenic
916524218 1:165593949-165593971 AGGGGAGAGAAAAATGGGGCAGG - Intergenic
916698326 1:167263720-167263742 GTAGGAGAGATGAATGAGGGAGG - Intronic
916724498 1:167510589-167510611 ATGGGAGAGAAGTATGATAGGGG - Intronic
917147476 1:171907652-171907674 ATGCTAGAGAGGAATGAGCAAGG - Intronic
917216153 1:172680310-172680332 ATGGCAGAGAAGTGGGAGGAAGG - Intergenic
917231688 1:172844746-172844768 ATGAGAGAGAAGAGGGAGGGAGG + Intergenic
917469576 1:175314938-175314960 GAAGGAGGGAAGAATGAGGAAGG + Intergenic
917476214 1:175371552-175371574 ATGGAAAAGAATAATGACGAAGG + Intronic
917584161 1:176408485-176408507 ACAGGAGAGAAGAAAGAGGGTGG - Intergenic
918169368 1:181981640-181981662 ATAGGATAGAAAAATGAGGAGGG + Intergenic
918355017 1:183699816-183699838 TTGGGCTTGAAGAATGAGGAAGG - Intronic
918593892 1:186270303-186270325 GAAGGAGAGAAGAAAGAGGAAGG + Intergenic
918876138 1:190046286-190046308 AAGGGAGGGAGGAAGGAGGAAGG + Intergenic
919153154 1:193725571-193725593 ATGAGAGAAGAGAAGGAGGAAGG - Intergenic
919266784 1:195278488-195278510 AAAGAAGAGAAGGATGAGGAAGG - Intergenic
919465973 1:197921805-197921827 AAGGGAGAGAGGGAGGAGGAGGG + Intronic
919945990 1:202319212-202319234 GGGGAAGAGAAGAATGGGGAGGG - Exonic
919973286 1:202594464-202594486 ATGGGTGAGAAGAGTGAGTCTGG + Exonic
919988821 1:202694700-202694722 AAGGAAGAGGAGAAGGAGGAGGG - Intronic
920057408 1:203202586-203202608 ATGGGAATGAGGAATGAGCAGGG - Intergenic
920123867 1:203678095-203678117 ATGGGAGAAAGGAAACAGGAGGG - Intronic
920318228 1:205095618-205095640 ATGTGAGAGCAGAAAGAGAATGG + Intronic
920358321 1:205392757-205392779 AAAGGAGAGAAGAATGAGGTGGG + Intronic
920567513 1:206986680-206986702 AAGGGAGAGAGGAAAGAAGAAGG - Intergenic
920748918 1:208655655-208655677 ATGGGTGTGAAGAAGGAGAATGG - Intergenic
920980109 1:210826336-210826358 ATGGGAGAGAACCAGGAGAACGG - Intronic
921382539 1:214539655-214539677 AAGGAAGGGAAGAAGGAGGAGGG + Intronic
921383106 1:214544852-214544874 GTGAGAGAGAAAAAAGAGGAGGG + Intronic
921787220 1:219245074-219245096 AAGAGAAAGAAGAAAGAGGAAGG - Intergenic
921904702 1:220484249-220484271 GTGGGAGAGAGGAATGCAGAGGG + Intergenic
921969339 1:221129203-221129225 ATGGGAAGGAAGGAGGAGGAGGG + Intergenic
922150187 1:222995185-222995207 ATGGGAAAGAAAAAGGAAGATGG - Intronic
922403850 1:225291008-225291030 AAGGGAGAGAAGGATAGGGAGGG - Intronic
922424523 1:225480835-225480857 CTGAGAGAAAAGAGTGAGGAGGG - Intergenic
922479386 1:225928449-225928471 AGGGGAGTGAAGAGGGAGGAAGG - Intergenic
923053493 1:230405332-230405354 TGAGGAGAGAAGGATGAGGAGGG - Intronic
923084026 1:230688576-230688598 ATGGGAGAGAATTTTGAGGTGGG + Intronic
923146529 1:231202439-231202461 AGGTGAGAGCAGAATGAGCAAGG + Intronic
923343884 1:233032523-233032545 ACTGGATAGAAGAATAAGGAAGG - Intronic
923532369 1:234821635-234821657 ATGGCACAGAAGAATGAGGATGG + Intergenic
923534496 1:234838321-234838343 AGGGGAAAGAAGAAGGAAGAAGG + Intergenic
923913448 1:238476072-238476094 ATGGGAGAGATGCATGAAGGAGG - Intergenic
924003928 1:239586038-239586060 ATGGAAGAGTAGAAAGTGGATGG - Intronic
924076379 1:240342015-240342037 ATGGGAGAGAACAGACAGGAGGG - Intronic
924290345 1:242529818-242529840 GAGGGAGAGAAGAAGAAGGAAGG - Intergenic
924319256 1:242830836-242830858 ATAGCATAGAATAATGAGGAAGG + Intergenic
924439528 1:244074679-244074701 GTGGGAGAGAAGTAGGAGGTGGG - Intergenic
924562980 1:245172403-245172425 TAGTGAGAGAAGACTGAGGAAGG + Intronic
1062830827 10:604349-604371 ATAGGAGACAAAGATGAGGAAGG + Intronic
1062833630 10:622364-622386 GGGGGAGAGAAGAAGGGGGAGGG + Intronic
1063267284 10:4467451-4467473 ATGGAAGAGGAGAAGGAGGGTGG - Intergenic
1063351856 10:5363669-5363691 ACGGGAGAGAAGGAGGACGATGG - Intergenic
1063424551 10:5941217-5941239 ACGGGAGAGATGAAGGAGAAAGG + Intronic
1063650125 10:7927276-7927298 AATGGAGAGAAGAATGAGAATGG - Intronic
1063875318 10:10470632-10470654 AGGAGATAGAAGAATGAAGAAGG - Intergenic
1064053387 10:12077679-12077701 ATGTCAATGAAGAATGAGGAGGG + Intronic
1064086079 10:12348038-12348060 ATGGGTGAGAAGAATTACTAAGG - Intergenic
1064731516 10:18335908-18335930 TTTGAAGAGAAGGATGAGGATGG - Intronic
1065027490 10:21552869-21552891 AGGGGAGAGAAGAAAGAGGGAGG - Intronic
1065972198 10:30814478-30814500 ATGGGAGCGAAGGGTAAGGAAGG + Intergenic
1066190010 10:33047486-33047508 AAGGGAGAGAAGAGGGTGGATGG + Intergenic
1066259634 10:33716648-33716670 AAGGGGAAGAAGAAAGAGGAAGG - Intergenic
1066262823 10:33745620-33745642 ATGGGAGAGGAGGAGGAGGAGGG + Intergenic
1066637284 10:37517296-37517318 ATGGAACAAAAGAATGAGGGAGG + Intergenic
1066705259 10:38170897-38170919 GAGGGAGAAAAGAAGGAGGAAGG - Intergenic
1066780840 10:38943067-38943089 ATGAGAGAAAAGAAGGAGGGTGG + Intergenic
1066954142 10:42149497-42149519 ATGGGAGAGAAGAAGGAGGGCGG - Intergenic
1067027172 10:42853877-42853899 AAGGGAGGGAGGAAGGAGGAAGG - Intergenic
1067083823 10:43227921-43227943 ATGGCAGAGAAGGAGGAGGAGGG - Intronic
1067268777 10:44771839-44771861 GTGGGAGATTAGAATGAGAACGG + Intergenic
1068004741 10:51380021-51380043 ATGGTGGAGAAGAATGAGCCAGG - Intronic
1068052018 10:51962133-51962155 TTGGGAGAGAAGGGTCAGGAAGG + Intronic
1068174002 10:53433469-53433491 AAGGGAAAGAAGAAGGAGGAAGG + Intergenic
1068253574 10:54476843-54476865 ATAGGAGAGAAGAGTGATGATGG - Intronic
1068523074 10:58098928-58098950 ATGGGAGGGGAAAAAGAGGAGGG - Intergenic
1068601996 10:58966464-58966486 CTGGGAGAGTAGAATGTGAAGGG - Intergenic
1068884234 10:62082008-62082030 TTAAGAAAGAAGAATGAGGAGGG + Intronic
1069060975 10:63894190-63894212 ATGGGAGAAGGGAAGGAGGAAGG - Intergenic
1069677583 10:70259695-70259717 TGGGGAGAGAACAAGGAGGAGGG + Intronic
1069677859 10:70261261-70261283 AGGAGAGAGAAGAATGAGAACGG - Intronic
1069679915 10:70277182-70277204 CTGGGAGGGAAGAATGGGAAGGG - Intronic
1069712724 10:70500327-70500349 ATGGGAGAGAAGCACGACCACGG - Intronic
1069718510 10:70535551-70535573 AAGGAAGAGAAGGAGGAGGAAGG - Intronic
1069898198 10:71691895-71691917 ATGGGTACGAAGACTGAGGAAGG + Intronic
1069913648 10:71774354-71774376 AGGGATGAGAAGAATTAGGAGGG - Intronic
1070313072 10:75287702-75287724 ATGGAGCAGCAGAATGAGGAGGG - Intergenic
1071137908 10:82472694-82472716 ATGGAAGAGAAGAAAGAAAAGGG - Intronic
1071268964 10:83989751-83989773 AAAGGAGGGAAGAAAGAGGAAGG + Intergenic
1071268973 10:83989794-83989816 AAGGGAGGGAAGAAGGAGGAAGG + Intergenic
1071268981 10:83989835-83989857 AAGGGAGGGAAGAAGGAGGAAGG + Intergenic
1071284809 10:84134572-84134594 ATGGGAGAGAGAGAAGAGGAGGG + Intergenic
1071285132 10:84137519-84137541 ATAGCTGATAAGAATGAGGAAGG - Intergenic
1071605069 10:86980250-86980272 CTGGGAGAGAAGTCTGATGACGG + Intronic
1071686887 10:87767594-87767616 ATTTTAGAGAAAAATGAGGAAGG - Intronic
1071709882 10:88039602-88039624 ATGGGGGAGAAGAAAACGGAGGG + Intergenic
1071799370 10:89042288-89042310 ATGGCAGGGAAGAGTGGGGAGGG - Intergenic
1072189966 10:93070886-93070908 AGAGGAGAGAAGAATGGGGTGGG + Intergenic
1072497457 10:95976248-95976270 ATGGGTGAGCAGAAAGTGGAGGG - Intronic
1072555673 10:96512521-96512543 TCGGCAGAGAAGAATGGGGAGGG - Intronic
1072770589 10:98134457-98134479 ATAGCCGAGAGGAATGAGGAAGG + Intergenic
1073131960 10:101195383-101195405 TTGGGAGTGAGGAAAGAGGAAGG - Intergenic
1073203200 10:101753041-101753063 ATGGGAGAGGAGCATGGGAATGG - Intergenic
1073565045 10:104527878-104527900 AGGGCAGAGAGGAAAGAGGATGG - Intergenic
1073832672 10:107403955-107403977 ATCGGAGAGTAGAATGAATATGG + Intergenic
1074066410 10:110018578-110018600 ATGGGAAAGAAGAACAAGGGTGG + Intronic
1074427552 10:113365442-113365464 ATTGGAGAGAAGTAGGAGGAGGG - Intergenic
1074495614 10:113977837-113977859 ATGGGAAAGAGGAGTGAGGTGGG - Intergenic
1075330948 10:121573659-121573681 AGGGGAGAGGAGAAAGAGGGAGG + Intronic
1075609711 10:123842583-123842605 ATAGGAGAAGAAAATGAGGAAGG + Intronic
1076272409 10:129165934-129165956 AAAGAAGAGAAGAAGGAGGAAGG + Intergenic
1076778123 10:132709358-132709380 GTAGGAGAGGAGAATGGGGAGGG + Intronic
1077166469 11:1142017-1142039 ATGGGAGGAGAGAAAGAGGATGG + Intergenic
1077392552 11:2306854-2306876 AGGGGGGAGAAGAAGGAGGGAGG + Intronic
1077731554 11:4736445-4736467 ATAGGAGAGAAGAATAAAGATGG + Intronic
1077777799 11:5290984-5291006 ATGAGAGAGAGAAATGGGGAGGG + Intronic
1078104098 11:8347794-8347816 TGGGGAGAGAAGAGTGAGGGTGG - Intergenic
1078373729 11:10774866-10774888 TTGGGAAAGAAGGAAGAGGAAGG + Intronic
1078379950 11:10830868-10830890 AGGAGAGAGAAGAGTGAGCAGGG + Intronic
1078727877 11:13948046-13948068 ATGGAAAAGAGGGATGAGGAAGG - Intergenic
1078763595 11:14272378-14272400 AGAGGAGAGAAGAGTGAGGGTGG - Intergenic
1078982669 11:16554381-16554403 ATGGGAGAGAAGAAAGAAAGGGG - Intronic
1079429358 11:20374119-20374141 ATGGGAAAGGAGGATGAGGAAGG + Intronic
1079522172 11:21340764-21340786 ATGGGAGAGATGCATGAAAATGG + Intronic
1079944843 11:26729237-26729259 GTGGAAAAGAAGGATGAGGAAGG - Intergenic
1080219081 11:29879511-29879533 AGGGGAGAGAACAAGGAGGAAGG - Intergenic
1080264686 11:30388487-30388509 TTGGGAGAGAAGGAGCAGGAGGG + Intronic
1080298339 11:30755416-30755438 AAGACAGAGAAGTATGAGGATGG + Intergenic
1080616656 11:33950274-33950296 AGGAGAGAGAAGTATGAGGCTGG + Intergenic
1080749823 11:35141415-35141437 ATGGGAGAGAAGAGTCAAGCTGG + Intronic
1080814054 11:35736842-35736864 AAGGGAGTGAAGAGTGAGGAAGG - Intronic
1081434058 11:43007565-43007587 ATGAGTGAGAAGAGTGAGAAGGG + Intergenic
1081659487 11:44879267-44879289 TAGGGAAAGAAGAAGGAGGAAGG - Intronic
1081932554 11:46882155-46882177 ATGGGAATAAAGAAAGAGGAGGG + Intronic
1082796325 11:57380610-57380632 AAGGGAAAGACGCATGAGGAGGG + Intronic
1082801115 11:57415448-57415470 AAGGGAGAGGAGAATGAGTGTGG + Intronic
1082892430 11:58154195-58154217 AAGGGGGAGGAGAAGGAGGAAGG + Intronic
1082971752 11:59030159-59030181 ATGGGTGAGAAGGATGAGAAGGG - Intronic
1083380463 11:62264229-62264251 ATGAGACAGAAGACTGAAGAAGG + Intergenic
1083479519 11:62934546-62934568 AAAGGAGAGAAGAATGCAGAGGG - Intergenic
1083511096 11:63209989-63210011 ATGGGAAAAAAGCAGGAGGAAGG + Intronic
1083754703 11:64785212-64785234 ATGGGAGGCAAGAAGCAGGAGGG + Intergenic
1084069723 11:66726633-66726655 ATGGGAGAGGAAGATGAAGATGG + Intronic
1084528901 11:69715180-69715202 AAGGGAGGAAAGAAAGAGGAAGG + Intergenic
1084617034 11:70243307-70243329 GTGGGAGCAGAGAATGAGGAAGG + Intergenic
1084923030 11:72487267-72487289 ATGTCAGAGAAGACTGAGTAGGG + Intergenic
1085150247 11:74246672-74246694 AAGGCATAGATGAATGAGGAAGG - Intronic
1085442315 11:76576206-76576228 AAGGGAGAGAAGAAATAGGGTGG + Intergenic
1085825835 11:79846346-79846368 ATGAGAGAGAAGAAGGTGGAGGG + Intergenic
1086092070 11:83014845-83014867 AAGGAAGAAAAGAAAGAGGAAGG + Intronic
1087008877 11:93494986-93495008 ATGCCAGAGAACACTGAGGAGGG - Intronic
1087170412 11:95044154-95044176 ATGACAGAGAAGAATGGGCAGGG + Intergenic
1087391570 11:97541590-97541612 ATGGAAGGGAAGAATCAGTATGG + Intergenic
1087573354 11:99959419-99959441 ATGGGAGATAACAATGCAGATGG - Intronic
1087726678 11:101725989-101726011 AAGGAAGAGAATAAGGAGGAAGG + Intronic
1087793028 11:102427415-102427437 GTGGGAGAGAAGAAATAGGGAGG + Intronic
1087875287 11:103348444-103348466 ATAGGGCAGAAGAAAGAGGAGGG - Intronic
1087922383 11:103881303-103881325 ATGGTAGAGGAAAATGTGGAAGG - Intergenic
1087939386 11:104076793-104076815 AGGAGAGAGAAGAAAGAGAAGGG - Intronic
1087973195 11:104511622-104511644 AGGGGAGAGGAGAAGGAAGATGG + Intergenic
1088220227 11:107562844-107562866 GGGGGAGAGGAGAAAGAGGAAGG + Intronic
1088329832 11:108639858-108639880 ATGTGAGAGAAGGAAGAGAAAGG + Intergenic
1088362078 11:109001604-109001626 AGGAGAGGGAAGAATGGGGAGGG - Intergenic
1088414057 11:109569431-109569453 ATGGGACAAAAGAATTTGGATGG - Intergenic
1088435905 11:109812852-109812874 AGGGGAAAAAAGAGTGAGGAGGG - Intergenic
1088758545 11:112907590-112907612 ATGGGAGAAAAGAATGGGAGAGG - Intergenic
1089032541 11:115347288-115347310 ATGGGTGAGTATAATGGGGAAGG - Intronic
1089100403 11:115958195-115958217 TAGGGAGAGAGGAAGGAGGAAGG - Intergenic
1089103296 11:115982152-115982174 GTGGGAGAGCAAAGTGAGGATGG - Intergenic
1089380659 11:118028873-118028895 TTGGGGGAGAAGAAGGAGGAGGG + Intergenic
1089640273 11:119843314-119843336 AGGGGAGATGAGAATGAGCAGGG - Intergenic
1089679275 11:120110338-120110360 ATGGCAGAGAAGAGAGAGAAGGG - Intergenic
1089717058 11:120370787-120370809 ATGGGAAGGAAGAAACAGGAAGG - Intronic
1089838343 11:121391766-121391788 AGGTGAGAGAAGACAGAGGATGG - Intergenic
1089959089 11:122599835-122599857 CAGGGAAAGCAGAATGAGGAAGG - Intergenic
1090470952 11:126980681-126980703 ATGGGAGATGAGAAAGAGGCTGG + Intronic
1091607939 12:1972854-1972876 AAGAGAGAAAAGAAAGAGGAAGG + Intronic
1091858533 12:3758245-3758267 ATGGGAAAGCAGAATTATGAGGG - Intronic
1092222039 12:6720812-6720834 ATATGAGAGAACAATGAGTAAGG - Intergenic
1092501889 12:9056154-9056176 ATGGGAGAAAAGCTTGAGAATGG + Intergenic
1092736783 12:11590266-11590288 ATGGGAGAGAAGAATGAGGATGG + Intergenic
1092746020 12:11673229-11673251 GTGGGAGTGGTGAATGAGGAGGG + Intronic
1092937776 12:13379856-13379878 CTGGGAGAGAAGACTGAAGCTGG - Intronic
1093020340 12:14197639-14197661 CTGGAATAGAAGAATAAGGAGGG + Intergenic
1093058424 12:14578297-14578319 ATGGGTGAAGAGAAGGAGGAAGG + Intergenic
1093073071 12:14727071-14727093 ATGGAAGAAAATAATAAGGATGG - Intergenic
1093521624 12:20057764-20057786 ATAGGAAAGAAGAAGAAGGAAGG - Intergenic
1093534013 12:20201876-20201898 ATGGGACAAAAGAATTTGGATGG - Intergenic
1093773714 12:23047964-23047986 ATGTGAGAGAAGAATCAGAGTGG + Intergenic
1093957406 12:25236634-25236656 AAGAGAGAGAAGAAGGGGGAGGG + Intronic
1093994179 12:25623832-25623854 ATGGGAGAGACGAAGGAGGCAGG - Intronic
1094203581 12:27817386-27817408 AAGGGAGGGAAGAAGAAGGAGGG - Intergenic
1094790146 12:33903204-33903226 ATAAGAGAGAAGTATCAGGAAGG - Intergenic
1095298840 12:40558766-40558788 AAGGCAAAGAAGAATGAGGTAGG - Intronic
1095399846 12:41801411-41801433 ATGAAAGAGAAGAATGATGGAGG + Intergenic
1095956504 12:47809346-47809368 ACAGGTGAGAAGAGTGAGGAAGG - Intronic
1096555717 12:52402480-52402502 ATGGGTGGCAAGAAAGAGGAAGG - Intronic
1096756940 12:53807549-53807571 GCTGAAGAGAAGAATGAGGAAGG - Intergenic
1096814857 12:54195703-54195725 AAGAAAGAGAAGGATGAGGAAGG - Intergenic
1096847092 12:54413309-54413331 ACGGAAGAGGAGAGTGAGGAGGG + Intronic
1096968215 12:55645652-55645674 AAGGAAGAGAAGAATGGGGAAGG - Intergenic
1097393044 12:59039382-59039404 AACAGAGAGAAGAAAGAGGAGGG - Intergenic
1097397850 12:59097769-59097791 AAGGGAGAGAAGGAGGATGAAGG + Intergenic
1097579320 12:61434239-61434261 ATTAGAGTGAAGAAAGAGGATGG - Intergenic
1097983307 12:65756316-65756338 AGGGAAGAGAAGAAGGAGGAAGG - Intergenic
1098128222 12:67322191-67322213 CTGAGAGAGAGGAATGAGAAGGG + Intergenic
1098228287 12:68347144-68347166 TTGGTAGAGAAGAGTGAGGAGGG - Intergenic
1098335872 12:69403898-69403920 AAGAGAGAGAAGAAAGAGAAAGG - Intergenic
1098576260 12:72046559-72046581 ATGTCAGAGAAGGATGAGTAGGG - Intronic
1099170589 12:79359349-79359371 AAGGGACAGAAAAATGATGAAGG - Intronic
1099248780 12:80226520-80226542 ATGGGAAGGAAAACTGAGGAAGG - Intronic
1099341349 12:81438953-81438975 AGGGGAGGGAATAATGAAGAGGG - Intronic
1099629954 12:85129997-85130019 ATGAGAGATAGGAATCAGGAAGG + Intronic
1100123546 12:91396121-91396143 AAGAGAGAGAAGAATGAAGAAGG - Intergenic
1100250370 12:92815365-92815387 AAGGGGGAGGGGAATGAGGAGGG - Intronic
1100263054 12:92950649-92950671 GAGGGAGAGAAGAGGGAGGAAGG + Intergenic
1100550742 12:95644399-95644421 AAGGGGGAGAAGAAGGGGGAAGG - Intergenic
1100604889 12:96143529-96143551 AGGGCAGAGCAGAAAGAGGAAGG + Intergenic
1101025141 12:100595937-100595959 AAAGAAGAGAAGAAGGAGGAGGG - Intronic
1101295332 12:103417577-103417599 ATAGGAGAGAAGAGAGTGGAAGG - Intronic
1101405065 12:104421293-104421315 AGGGGAGAGAACAAGCAGGAGGG - Intergenic
1101527647 12:105546233-105546255 GTGGGTGAGGGGAATGAGGAAGG + Intergenic
1101673258 12:106896515-106896537 AGGGGAGGGAAGGAAGAGGAGGG + Intergenic
1101673267 12:106896539-106896561 AGGGGAGGGAAGGAAGAGGAGGG + Intergenic
1101673276 12:106896563-106896585 AGGGGAGGGAAGGAAGAGGAGGG + Intergenic
1101821229 12:108185718-108185740 ATGGCAGAGAACAGGGAGGAAGG - Intronic
1101830851 12:108255311-108255333 GTGGGAGACAAGAGGGAGGAAGG + Intergenic
1101909412 12:108850506-108850528 ATGGGAGAGGAGCTTGGGGAGGG + Intronic
1101909463 12:108850644-108850666 ATGGGAGAGGGGATTGGGGAGGG + Intronic
1101923599 12:108953042-108953064 AAGAAAGAAAAGAATGAGGAAGG + Intronic
1102556049 12:113727295-113727317 AAGAGAGAGAGGAAAGAGGAAGG - Intergenic
1103005632 12:117418096-117418118 AAGGTAGAGAGGAAGGAGGAAGG + Intronic
1103073480 12:117963890-117963912 TTTGGAGTGAAGGATGAGGAGGG - Intronic
1103222788 12:119259775-119259797 ATGGTAGATAAGTATGAGGATGG + Intergenic
1103245481 12:119453300-119453322 ATGGAAGAAAAGGAGGAGGAGGG - Intronic
1103366800 12:120389668-120389690 AAGGGAGAGAGGAAGGAGGGAGG + Intergenic
1103366814 12:120389712-120389734 AAGGGAGAGAGGAAGGAGGGAGG + Intergenic
1103430824 12:120884202-120884224 AGGGGACAGAGGCATGAGGAAGG + Intronic
1103840960 12:123863923-123863945 ATGTAAGAGAAGAATGAGGTAGG + Intronic
1103915099 12:124372133-124372155 AAGGCAGAGAAGAAGGAGGGCGG - Exonic
1104518047 12:129446042-129446064 AAGGGAGAGAAGCTTGAGCAAGG + Intronic
1104596596 12:130124481-130124503 GTGGGAGAGAAGGATCTGGATGG + Intergenic
1105600818 13:21885483-21885505 ATGTGAACGAATAATGAGGATGG - Intergenic
1105764590 13:23546918-23546940 AGGGGAGAGAGGAGGGAGGAAGG - Intergenic
1105956730 13:25290251-25290273 ATAGGAAAGAAGAAAGATGAGGG - Intergenic
1105972286 13:25440309-25440331 AGGGGAAGGAAGAAAGAGGAAGG - Intronic
1106104377 13:26721493-26721515 ATGTGAGAGGAGTATAAGGACGG - Intergenic
1106300968 13:28465174-28465196 ATGGTAGGCAGGAATGAGGAAGG - Intronic
1106485232 13:30166611-30166633 GTGGGAGACAAGGCTGAGGAGGG + Intergenic
1106512283 13:30422007-30422029 AGGGGAGAGAAGGAGGAGGTGGG + Intergenic
1106584299 13:31043919-31043941 AGGGGATAGAAGAATGAGAAGGG + Intergenic
1106894201 13:34280443-34280465 ATGGGAGAGAATAAATAAGAAGG - Intergenic
1107015790 13:35706810-35706832 ATGGGAGCAAAGGAAGAGGACGG + Intergenic
1107339250 13:39388593-39388615 ATGGGGGAAAATTATGAGGAGGG + Intronic
1107571442 13:41663306-41663328 ATGGAAAAGAGGAATGAGGGTGG - Intronic
1107607039 13:42069119-42069141 TGGGGAGAGAGAAATGAGGAAGG - Intronic
1107651795 13:42552433-42552455 ATGGGAGAGGAGAAAGAACAGGG + Intergenic
1107689256 13:42935475-42935497 ATGGGAGGTATGAAGGAGGAGGG + Intronic
1107788457 13:43977638-43977660 ATGGGAGAGAAGGAGGAAGGAGG - Intergenic
1107855363 13:44610325-44610347 ATGAGAGAGAGGGAAGAGGAAGG + Intergenic
1108038307 13:46315456-46315478 AGGGTAGAGAAAAATGAGGTTGG + Intergenic
1108223644 13:48265215-48265237 ATGGGACTGAGGAAGGAGGATGG - Exonic
1108292062 13:48971902-48971924 ATGGGACAGCAGATTGAGGTGGG - Intergenic
1108348299 13:49567235-49567257 AGGGGAGAGTAGAGTGAAGATGG + Exonic
1108705721 13:52983960-52983982 ACAGAAGACAAGAATGAGGAAGG - Intergenic
1109190445 13:59316462-59316484 ATGTGAGATAAGATTGATGAAGG + Intergenic
1110265910 13:73537419-73537441 AGGGCAGAAAAGAATGTGGAGGG + Intergenic
1110533451 13:76623597-76623619 GAGAAAGAGAAGAATGAGGAGGG - Intergenic
1110689027 13:78410064-78410086 ATGGGAGGGATGAATGATTATGG + Intergenic
1110927134 13:81167524-81167546 ATGAGAAAGAAGAATGACAAAGG - Intergenic
1111096223 13:83518544-83518566 ATGGAAAAGAAAAATGAGGAGGG + Intergenic
1111119774 13:83831554-83831576 AGGGAAGAAAAGAAGGAGGAAGG + Intergenic
1111293891 13:86255599-86255621 ATGGGAAAGTAGAGAGAGGAAGG - Intergenic
1111350830 13:87028768-87028790 ATGGAATAGTAGAATGTGGATGG + Intergenic
1111350833 13:87028787-87028809 ATGGGATAGTAGAATGTGGAAGG + Intergenic
1111447079 13:88360848-88360870 ACAGGAGAGCAGAGTGAGGAGGG - Intergenic
1111563782 13:89988337-89988359 ATGGCAGAGAAGAATTTGTATGG - Intergenic
1111698318 13:91653953-91653975 GTAGGAGAGAAGAATGACAAAGG - Intronic
1112363429 13:98737806-98737828 ATAGGTCAGAAGAATGTGGAGGG + Intronic
1112460845 13:99602550-99602572 ATGGGAAAGAAGGATGGGGCGGG - Intergenic
1112708131 13:102095625-102095647 AAGGGGGAGGAGAATGAGGAGGG - Intronic
1112932101 13:104753603-104753625 AGAGGAGTGAAAAATGAGGAGGG - Intergenic
1113105700 13:106769722-106769744 AAGGGAGAGAAGAAGGATTAGGG + Intergenic
1113116428 13:106879040-106879062 ATGAGAGAGAAGAATGAAGGAGG - Intergenic
1113368736 13:109704082-109704104 ATGGCAGGGAAGCATTAGGAGGG - Intergenic
1113423164 13:110185746-110185768 GTGGGAGAGGAGAACGACGAGGG + Intronic
1113540019 13:111100022-111100044 TAGGAACAGAAGAATGAGGAAGG + Intergenic
1113589648 13:111489381-111489403 AGGGGAGAGGAGGAGGAGGAGGG + Intergenic
1113655840 13:112067519-112067541 AGCGGAGAGAAGAATGGGGAGGG - Intergenic
1113895052 13:113759128-113759150 AAGGGAGAGTAGAGCGAGGAAGG + Intergenic
1114558678 14:23576633-23576655 GTGGGAGAGCAGAGTGAAGACGG + Intronic
1114666545 14:24380662-24380684 AGGAGAGAGAAGAACGAGGCTGG + Intergenic
1115108745 14:29794664-29794686 AGGGAAGGGAAGAATGAGAAGGG - Intronic
1115320420 14:32075154-32075176 GTGGGAAAGAAGGATGCGGAAGG - Intergenic
1115500921 14:34049077-34049099 TTGGGAGAAAAGCATCAGGATGG - Intronic
1115555613 14:34543005-34543027 ATGGTAGAGCAGACGGAGGAGGG - Intergenic
1115558295 14:34560088-34560110 ATGGTAGAGCAGACGGAGGAGGG + Intergenic
1115751246 14:36492643-36492665 ATGGGAGAGAGATTTGAGGAGGG - Intronic
1116044162 14:39722398-39722420 ATGGGCAAGGAGAATCAGGAAGG - Intergenic
1116133321 14:40889248-40889270 AAGGGAGGGAAGAAGGAGGGAGG + Intergenic
1117116568 14:52519693-52519715 ATGGTAGAGCAAAATGAGGTTGG - Intronic
1117212281 14:53513001-53513023 ATGGGAGAGATTAAGGAGGGAGG + Intergenic
1117967559 14:61221381-61221403 ATGAGAGAGAAGAAAAAGCAGGG - Intronic
1117967576 14:61221497-61221519 AGGAGAGAAAAGAATGGGGAGGG - Intronic
1118632468 14:67718291-67718313 AGGGAAGAGGAGAAGGAGGAAGG + Intronic
1118866723 14:69710213-69710235 ATGGAAGAGGAGGAAGAGGAGGG - Intronic
1118979104 14:70701716-70701738 GGGGGTGAGAAGAAAGAGGAAGG + Intergenic
1119456469 14:74760326-74760348 AAGGGAGAGAGGAAGGAGGGAGG - Intergenic
1119632727 14:76247979-76248001 ATAGGATAGAGGCATGAGGAAGG + Intronic
1119726163 14:76922939-76922961 ATAGGAGGGAAGAAGGAGGAGGG - Intergenic
1119997651 14:79271382-79271404 AGGGGAAGGAAGAAGGAGGAAGG - Intronic
1120144085 14:80960454-80960476 ATGGGAGAGGAGAGAGAGAATGG - Intronic
1120366737 14:83580956-83580978 AAGGGCTAGAAAAATGAGGAAGG - Intergenic
1120388129 14:83871237-83871259 AAGGGGGAGAAGAAGGAGGAAGG + Intergenic
1121154455 14:91669866-91669888 ACGGGAGAAGAGAATGATGAAGG + Exonic
1121189528 14:92013584-92013606 ATGGAATAGAAAAAAGAGGAAGG + Intronic
1121654959 14:95588406-95588428 AGGGGAGACCAGGATGAGGAGGG + Intergenic
1121764067 14:96470247-96470269 AAGGCGGAGAAGGATGAGGAGGG + Intronic
1121910172 14:97782825-97782847 AGGGGAGAGAAGGAGGGGGAAGG + Intergenic
1122277845 14:100604330-100604352 CTGGGAGAGCAGATTGGGGAAGG + Intergenic
1122390306 14:101375703-101375725 AGGAGAGAGAACAAAGAGGAAGG + Intergenic
1122905402 14:104799421-104799443 AAGGCAGAGAAGAATGAGACCGG + Intergenic
1122948571 14:105027074-105027096 AAGGGAGGGAGGAAGGAGGAAGG + Intergenic
1202939850 14_KI270725v1_random:136513-136535 ATGGGAGAGAAGAAGGAGGGTGG - Intergenic
1123393274 15:19899364-19899386 ATGGGAGAGAAGAAGGAGGGCGG + Intergenic
1123737350 15:23198600-23198622 ATGACAGAGAAGAAGGCGGATGG - Intergenic
1124168292 15:27349088-27349110 ATAGGAAATAAGAAAGAGGAAGG + Intronic
1124288566 15:28427264-28427286 ATGACAGAGAAGAAGGCGGATGG - Intergenic
1124294659 15:28490050-28490072 ATGACAGAGAAGAAGGCGGATGG + Intergenic
1124338306 15:28873612-28873634 ATGGTAGAAGAGACTGAGGAAGG + Intergenic
1124601950 15:31140589-31140611 ATGGAAGAGAAGAAGCAAGAAGG - Intronic
1125056783 15:35368582-35368604 ATGAGAGATAAGCATGGGGATGG + Intronic
1125301111 15:38253464-38253486 ATGAGAGGGAATAATGTGGATGG + Intronic
1125397107 15:39261032-39261054 AGAGGAGAGAAGAAGGGGGAGGG + Intergenic
1125426812 15:39556981-39557003 ATGGAAAAGAGGGATGAGGAAGG - Intergenic
1125602917 15:40925472-40925494 ACTGGAGAGAGGAGTGAGGAAGG - Intergenic
1125612590 15:40981934-40981956 AGGGAGGAGAAGAATGAGGAAGG - Intronic
1125663296 15:41411380-41411402 TTGGGAGAGAAGAGGGATGAGGG + Intronic
1126395595 15:48213202-48213224 AAGGGAAAGCAGACTGAGGATGG - Intronic
1126423270 15:48498412-48498434 ATAGGTGACAAGAAAGAGGAAGG - Intronic
1126426225 15:48529455-48529477 ATGGGAGGAAAGAGTGTGGAGGG + Intronic
1126670827 15:51113686-51113708 ATGGGTCAGAAGAAGCAGGAAGG - Intergenic
1127107862 15:55636440-55636462 AAGGGAGAGAAGATTGAGGAAGG - Intronic
1127299639 15:57640020-57640042 GTGGGAGAAGAGAACGAGGAAGG - Intronic
1127726426 15:61754459-61754481 AAAGGAGGGAAGAGTGAGGAGGG - Intergenic
1127820701 15:62653203-62653225 ATTGAAGAAAAGAAAGAGGAAGG + Exonic
1127965107 15:63917477-63917499 ATGGGAGAGATGAATGAAAGAGG + Intronic
1128086613 15:64891178-64891200 ATGGGAGTGAGTACTGAGGATGG + Intronic
1128646352 15:69381343-69381365 AAGGGAGGGAAGTAAGAGGAAGG - Intronic
1129165684 15:73775921-73775943 GTGGGATAGAAGAAAGAGCATGG + Intergenic
1129239232 15:74241838-74241860 AAGAGAGGGAAGAATCAGGAAGG + Intronic
1129668015 15:77590312-77590334 CAGGGAGAGAAGAGTGAGCAGGG + Intergenic
1129727928 15:77911049-77911071 ATAGGACAGAGGAAGGAGGAGGG - Intergenic
1129787339 15:78318649-78318671 AAGGGAGACTAGCATGAGGATGG + Intergenic
1129839951 15:78737811-78737833 ATAGGACAGAGGAAGGAGGAGGG + Intergenic
1129931469 15:79414613-79414635 TATGGAGATAAGAATGAGGATGG + Intronic
1129933060 15:79428291-79428313 AAGGGAGAGAAGAAGGAAGGAGG - Intergenic
1130961280 15:88660061-88660083 ATGGAATAGGAGAATGAGGAGGG - Intergenic
1131173241 15:90192966-90192988 GAGAGAGAGAAAAATGAGGAAGG + Intronic
1131344718 15:91635808-91635830 ATCTGAGAGAATAAAGAGGAAGG - Intergenic
1131676069 15:94671985-94672007 GTGGGAGGGAAGAGAGAGGAGGG + Intergenic
1131818336 15:96245941-96245963 AACGGAGAAAAGAATGAGAAAGG + Intergenic
1132059997 15:98684697-98684719 ATGAGAGAGTAGAAGGAGAAAGG + Intronic
1132394547 15:101463227-101463249 ATGGGAGAGACGAGAGAGGCAGG + Intronic
1132676771 16:1124294-1124316 AGGGGAGAGAAGAGGGAGGCTGG + Intergenic
1132709070 16:1258599-1258621 ATGGGAGAGGGGACTCAGGATGG - Exonic
1133118103 16:3589655-3589677 ACGGGAGTGAGGCATGAGGACGG + Exonic
1133194424 16:4158832-4158854 AAGGAGGAGAAGAAAGAGGAAGG + Intergenic
1133415847 16:5606441-5606463 AAGGGAGGGAGGAATGAGGGTGG - Intergenic
1133443721 16:5841996-5842018 CAGGGAGAGGAGGATGAGGATGG - Intergenic
1133549939 16:6844370-6844392 ATGGGAGAGAACAATGGGCGTGG - Intronic
1133554460 16:6891890-6891912 AGGGAAGAAAAGAATGAGCAGGG - Intronic
1134071952 16:11265758-11265780 TTGCGAAAGAGGAATGAGGAAGG + Intronic
1134092264 16:11397895-11397917 ATGGAAGATAGGAAGGAGGATGG + Intronic
1134478868 16:14600421-14600443 ATAGGAGAGAAGAAGGTGGGTGG - Intronic
1134615891 16:15650687-15650709 AAGGAAGAGGAGAAAGAGGATGG - Intronic
1134692082 16:16197670-16197692 GTGGGAGAGATGCAGGAGGAGGG + Intronic
1135002342 16:18787310-18787332 ATGGAAAAGAGGGATGAGGAAGG - Intronic
1135124854 16:19800134-19800156 ATGGGAAAGTAGAGAGAGGAAGG + Intronic
1135200772 16:20436232-20436254 AGGGGAGAGGAGAGTGGGGAGGG - Intronic
1135770445 16:25214337-25214359 AAGGGAGAAAGGAAGGAGGAAGG - Intergenic
1135904706 16:26500960-26500982 AAGGGAGAAGAGAATGAGAAGGG + Intergenic
1136081331 16:27854283-27854305 GGGGGAGAGAAGGAGGAGGAGGG + Intronic
1136487386 16:30582268-30582290 AAGGGAGAGAACAATCATGAAGG + Exonic
1136696271 16:32084465-32084487 ATGGGAGAGAAGAAGGAGAGCGG - Intergenic
1136699268 16:32116729-32116751 ATGGGAGAGAATAAGGAGGGCGG + Intergenic
1136715562 16:32278895-32278917 AGGGGAGAGAAGAAGGAGGGCGG + Intergenic
1136752346 16:32650872-32650894 AGGGGAGAGAAGAAGGAGGGCGG - Intergenic
1136768382 16:32811205-32811227 ATGGGGGAGAAGAAGGATGGTGG - Intergenic
1136771626 16:32846141-32846163 ATGGGAGAGAAGAAGGAGGGCGG - Intergenic
1136796766 16:33027717-33027739 ATGGGAGAGAAGAAGGAGAGCGG - Intergenic
1136799759 16:33059900-33059922 ATGGGAGAGAATAAGGAGGGCGG + Intergenic
1136822245 16:33329590-33329612 AGGGGAGAGAAGAAGGAGGGCGG + Intergenic
1136828808 16:33386129-33386151 AGGGGAGAGAAGAAGGAGGGCGG + Intergenic
1136833874 16:33484911-33484933 AGGGGAGAGAAGAAGGAGGGCGG + Intergenic
1136867922 16:33771061-33771083 ATGTGAGAGAAGAAGGAGGGCGG + Intergenic
1136898956 16:34015284-34015306 ATGGGAGAGAAAAAGGAGGGCGG + Intergenic
1136957675 16:34803922-34803944 ATGGGAGAGAAGAAGGAGGGCGG + Intergenic
1137455352 16:48613798-48613820 ATGGGAGAATGGAATGGGGAAGG - Intronic
1137526889 16:49244373-49244395 AGCAAAGAGAAGAATGAGGATGG + Intergenic
1137854539 16:51780723-51780745 ACAGGAGAGAAGAAGGAGAAGGG - Intergenic
1138638234 16:58361499-58361521 AGGGGAGAGAAGAGTGGGAAGGG - Intronic
1138813773 16:60180769-60180791 AGGGGAGAGAAGAGGAAGGAAGG - Intergenic
1138912733 16:61421861-61421883 AAGGATGAAAAGAATGAGGATGG + Intergenic
1139042000 16:63009047-63009069 ATAGAAAAGAAGAATTAGGAAGG + Intergenic
1139173360 16:64658078-64658100 TAGGGAGAGAAGTATGATGATGG + Intergenic
1139330319 16:66183550-66183572 AGGAGAGAGGAGAAGGAGGAAGG + Intergenic
1139429772 16:66904842-66904864 ATGCTAGGGAAGAACGAGGAAGG + Intergenic
1139486482 16:67259683-67259705 AATGGAGAGGAGTATGAGGAAGG - Intronic
1139532968 16:67552483-67552505 ATGGAACAGAAGCCTGAGGAGGG + Intergenic
1139620655 16:68138568-68138590 ATGGGAAAGAAGAAGGTGTATGG + Intronic
1139760354 16:69180086-69180108 AGGGAAAAGAAGAAAGAGGAAGG - Intronic
1140112116 16:72013319-72013341 ATGGGAGTGAATAATGAGTGGGG + Intronic
1140155982 16:72427186-72427208 ATGGGAGTGAAGGAGGAGGAGGG + Intergenic
1140337208 16:74118742-74118764 AGGGGAGAGGAGAAGGAGGGAGG + Intergenic
1140828341 16:78728028-78728050 GAGGGAGAGAGGAAAGAGGAAGG - Intronic
1140896030 16:79325015-79325037 AGGGGAGAGAAGAAGGAACAGGG - Intergenic
1140959654 16:79899802-79899824 AAGGGAGAAGAGAAAGAGGAGGG - Intergenic
1140965882 16:79965610-79965632 ACGGGAGAAAAAAATGAAGAAGG - Intergenic
1141024504 16:80532571-80532593 TTGCCAGAGAAGAATGAGTAGGG - Intergenic
1141082019 16:81061088-81061110 ATGAGAGAGAAGAAAGAGAAAGG + Exonic
1141314379 16:82947077-82947099 ATCAGAGAGAGGAATAAGGAAGG - Intronic
1141365003 16:83434471-83434493 ATGGGAGAGTGGAATGAGATGGG - Intronic
1141492723 16:84385455-84385477 ATGAGAGAGAATGATGATGATGG - Intronic
1141657646 16:85424572-85424594 CTGGGAGAGAAGGAAGAGGGCGG - Intergenic
1141867696 16:86762059-86762081 ATGGAAAATCAGAATGAGGAAGG + Intergenic
1142071323 16:88092485-88092507 AAGGGAGAGAGGAAGGAGGGAGG + Intronic
1142116920 16:88362302-88362324 ATGGGTGAACAGCATGAGGATGG - Intergenic
1142251454 16:88993793-88993815 GAGGGAGAGAAGAAGGGGGAGGG - Intergenic
1203011042 16_KI270728v1_random:239609-239631 AGGGGAGAGAAGAAGGAGGGCGG - Intergenic
1203054492 16_KI270728v1_random:910856-910878 AGGGGAGAGAAGAAGGAGGGCGG - Intergenic
1203070774 16_KI270728v1_random:1073221-1073243 ATGGGGGAGAAGAAGGATGGTGG - Intergenic
1203074052 16_KI270728v1_random:1108252-1108274 ATGGGAGAGAAGAAGGAGGGCGG - Intergenic
1203104255 16_KI270728v1_random:1345217-1345239 ATGTGAGAGAAGAAGGAGGGCGG - Intergenic
1203129259 16_KI270728v1_random:1617151-1617173 ATGTGAGAGAAGAAGGAGGGCGG + Intergenic
1142865919 17:2791424-2791446 TGGGGAGAGAATAATGAAGATGG - Intronic
1143013206 17:3877584-3877606 AGGCGAGAGAAGAAAGAGGAAGG + Intronic
1143129920 17:4671776-4671798 TTGGAAGAGGAGACTGAGGATGG - Exonic
1143296142 17:5873419-5873441 ATGGAACAGAAGAAGGAAGAAGG - Intronic
1143312426 17:6003036-6003058 GTGAGAGAGAAAAATTAGGACGG + Intronic
1143391418 17:6561243-6561265 AAGGAAGAGGAGAAGGAGGAAGG - Intergenic
1143391533 17:6561661-6561683 AAGGGAGAGGAGGAAGAGGAGGG - Intergenic
1143854510 17:9838837-9838859 ATGGGAGAGAGGAAGGAGCTTGG + Intronic
1144215349 17:13050346-13050368 ATGGGTGAGAAGGAGGGGGAAGG - Intergenic
1144396155 17:14845142-14845164 ATGAGAGAGAAGAAAGGGAAAGG + Intergenic
1144613531 17:16746858-16746880 AAGGGAGAGAAGGGAGAGGAGGG - Intronic
1145016551 17:19402577-19402599 AGGAGAGAGAAGGATGAGGAAGG + Intergenic
1145690207 17:26731759-26731781 ATGGGAGAGAAGAAGGAGAGCGG + Intergenic
1145710081 17:26963364-26963386 ATGGGAGAAAAGAAGGAGGGCGG + Intergenic
1145765635 17:27456674-27456696 ATGGGAGAGAAGAAGGAGGGCGG + Intergenic
1146289632 17:31598250-31598272 ATGGGAGGGAAGAAGGAGGTGGG + Intergenic
1146291771 17:31612906-31612928 AAAGGAGAGGAGAAGGAGGAGGG - Intergenic
1146525809 17:33566076-33566098 AAGGGAGAGCTGAGTGAGGAGGG - Intronic
1146673679 17:34758586-34758608 AGGAGAAAGAAGAAGGAGGAAGG + Intergenic
1146838760 17:36134867-36134889 ATGGGACCGAAGAATAAGGTTGG - Intergenic
1146886574 17:36474780-36474802 CTGGGAGGGAAGGGTGAGGAGGG + Intergenic
1146979508 17:37146707-37146729 AAGGGAGAGAAGAAGGAGGGGGG + Intronic
1147310848 17:39595478-39595500 TTGGGAGAGAAGGAAGAGAAAGG + Intergenic
1147484756 17:40801861-40801883 ATGGAAGTGAAGAAGGAGGATGG + Intergenic
1147888890 17:43703264-43703286 GTGTGAGAGAAGAGTGAGGCAGG - Intergenic
1148387352 17:47243867-47243889 AAGAGAGAGAAGAAAGAGAAAGG - Intergenic
1148874816 17:50680684-50680706 CTGAGAGAGAAGAAAGAGAAGGG - Intronic
1149374630 17:56031697-56031719 ATGGCTGAGTAAAATGAGGAAGG + Intergenic
1149434091 17:56618724-56618746 GTGGGAGAGCAGAGTGAGCATGG + Intergenic
1149439411 17:56662374-56662396 TTGGGAGAGAAAAGTGGGGAGGG - Intergenic
1149612467 17:57967635-57967657 CTGAGGGAGAAGAATGGGGAGGG - Intergenic
1149684384 17:58527028-58527050 CCGGAAGGGAAGAATGAGGAAGG + Intronic
1150118182 17:62574006-62574028 AAGGAAGAGAAGAATGGAGAAGG - Intronic
1150410605 17:64937879-64937901 AAGGGAGAGAAGACCCAGGATGG + Intergenic
1150451324 17:65271244-65271266 AGGGGAGAGGGGAAAGAGGAGGG + Intergenic
1150628600 17:66859822-66859844 AAGGGGGAGGAGAAGGAGGAGGG - Intronic
1150936762 17:69644064-69644086 ATGGAAAAGAGGGATGAGGAAGG - Intergenic
1150947610 17:69765399-69765421 AGGGGAGGGAAGAAGGGGGAGGG - Intergenic
1150947659 17:69765528-69765550 AGGGGAGGGAAGAAGGGGGAAGG - Intergenic
1150998662 17:70348791-70348813 ATGGAAAAGAGGGATGAGGAAGG - Intergenic
1151572018 17:74931183-74931205 TTGGGAGAAGAGACTGAGGAAGG + Intronic
1152009385 17:77701838-77701860 ATGAAAGGGAGGAATGAGGATGG - Intergenic
1152374925 17:79914063-79914085 ATGGGTGGTAAGAATGATGATGG + Intergenic
1152668995 17:81590248-81590270 CTGGGAGAGAAGGATGGGGTGGG - Intronic
1153104037 18:1507415-1507437 ATGGGAGGGAGGGATAAGGAGGG - Intergenic
1153571419 18:6476996-6477018 ATAAGAGAGAAGGAGGAGGAAGG + Intergenic
1153577226 18:6534636-6534658 ATGGGAGAGGGAAATGAGGGTGG - Intronic
1153578358 18:6545721-6545743 ACGGCAGAGAAGGATGAGGTGGG - Intronic
1153588791 18:6651417-6651439 AGGGGAAAGGAGAGTGAGGAAGG - Intergenic
1153680639 18:7497346-7497368 AAGGAAGAGGAGAAGGAGGAAGG + Intergenic
1153685101 18:7537562-7537584 AGGAGAGAGAAGAATGAAGGAGG + Intergenic
1153736123 18:8069635-8069657 ATGAGAGAGAAGAAAGATAAAGG - Intronic
1153998904 18:10466622-10466644 AGGGGAGGGCAGAATGAGGGAGG + Intronic
1154076202 18:11204163-11204185 CTGGGAGACAGGAATGAAGAGGG + Intergenic
1154339308 18:13489862-13489884 ATGGGTTAGAAGAAGGAGGGAGG + Intronic
1154518294 18:15197723-15197745 ATGGGAGAGAAGAAGGAGGGCGG - Intergenic
1155715911 18:28943461-28943483 ATGGCAGAGAAAAATCAAGATGG - Intergenic
1155777283 18:29780885-29780907 TTGGTAGAGCAGCATGAGGAAGG + Intergenic
1155903970 18:31426959-31426981 AGGGGAGAGAAGAGTGTGGAGGG - Intergenic
1155969617 18:32070005-32070027 GAGAGAGAGAAGAAGGAGGAAGG - Exonic
1156078182 18:33305742-33305764 AAGGAGGAGAAGAAGGAGGAGGG - Intronic
1156104394 18:33640477-33640499 CTAGTGGAGAAGAATGAGGATGG - Intronic
1156232366 18:35165958-35165980 ATGGAAAAGAAAAAGGAGGATGG + Intergenic
1156245655 18:35295377-35295399 CTGGGGGAAAAGTATGAGGATGG - Intergenic
1156398170 18:36717799-36717821 ATGGGAGAGAAAAATGAGAAAGG - Intronic
1156883513 18:42108115-42108137 AAGGAAGAGAACAAGGAGGAGGG + Intergenic
1156958781 18:42997454-42997476 AAGAGAGAGAAGAAGGGGGAGGG + Intronic
1157303667 18:46500101-46500123 ATGGAAAAGAAGGAAGAGGAGGG - Intronic
1157316396 18:46593557-46593579 ATGGGAGGGAGAAAGGAGGAAGG - Intronic
1157563791 18:48666194-48666216 AAGGGAGACAAGAGTGAGCAGGG - Intronic
1157756943 18:50227059-50227081 ATGAGAGAGAAGAGAAAGGAAGG + Intergenic
1157817586 18:50741332-50741354 ATGGGAGGGGTGATTGAGGAAGG - Intergenic
1158057720 18:53301755-53301777 ATTGGAGAAGAAAATGAGGATGG - Intronic
1158275297 18:55760519-55760541 AATGGAAAGAAGAAGGAGGAGGG - Intergenic
1158464843 18:57680896-57680918 ATGTGAGAGCAGAATGTGGAAGG - Intronic
1158727016 18:59983016-59983038 AGGTGAGAGAAGAATGAAGGAGG - Intergenic
1159737344 18:72115804-72115826 AAGGAAGGAAAGAATGAGGAAGG - Intergenic
1160283772 18:77519073-77519095 ATAGGAGAGGAGAATGGGGAGGG - Intergenic
1160558679 18:79742326-79742348 ATGGGAGAGAGGCCTGAGGGTGG + Intronic
1160970661 19:1766440-1766462 GGGGGAGAGAAGGAGGAGGAGGG + Intronic
1161195438 19:2983752-2983774 AGGACAGAGAAGAAGGAGGAGGG + Intronic
1161357310 19:3826191-3826213 AGGGGAAAGAGGAATGAGCAGGG - Intronic
1161501447 19:4618284-4618306 GAGAGAGAGAAGAATGAGAAAGG - Intergenic
1161648078 19:5466756-5466778 AGGGGAGAGGAGAAAGAGAAGGG + Intergenic
1161653144 19:5497535-5497557 ATGGGAGAGAAGGAGGAGGGAGG + Intergenic
1161814325 19:6490307-6490329 GAGGGAGAGAAGAGGGAGGAAGG - Intergenic
1161918740 19:7250353-7250375 AAGGGAAAGAGGAAGGAGGAGGG + Intronic
1162182213 19:8877927-8877949 AAGTGAGAGAAGGAAGAGGAAGG - Intronic
1162734842 19:12740918-12740940 ATGGGATAGAAGTTTGAGGAGGG + Intronic
1162755213 19:12854039-12854061 CAGGGAGGGAGGAATGAGGAGGG - Intronic
1162900750 19:13794493-13794515 AATGGTGAGAAGTATGAGGAAGG + Intergenic
1163289507 19:16370277-16370299 ATAGGAGAGATGAAAGATGAGGG + Intronic
1163376619 19:16937025-16937047 AAGGGAGAAAGGAAAGAGGAAGG - Intronic
1163939522 19:20479191-20479213 ATGGGAGAGAAGGAAGAAGTCGG + Intergenic
1164011184 19:21204711-21204733 ATGGGATAAAAGCAGGAGGAAGG - Intergenic
1164015836 19:21255250-21255272 ATGGGATAAAAGCAGGAGGAAGG + Intronic
1164324521 19:24180066-24180088 ATAGGAGAGAAGTAGGAGGAGGG + Intergenic
1164419464 19:28075924-28075946 ATGGAAGAGGAGGATGAGGGAGG + Intergenic
1164441853 19:28284985-28285007 ATGAAGGAGAAGAAGGAGGATGG + Intergenic
1165333516 19:35154396-35154418 CTGGGGGAGGAGAATGAAGAGGG - Intergenic
1165395761 19:35562795-35562817 AAGGGAGAGATGAAGGAGGGAGG - Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166142892 19:40814691-40814713 AGGGGAGGGAAGAAAGAGGCTGG - Intronic
1166184666 19:41132121-41132143 AGGGGAGGGAAGAAAGAGGCTGG + Intergenic
1166286846 19:41836250-41836272 AGGGGAGAGAGGAAAGAGCAGGG - Intergenic
1166636051 19:44452694-44452716 ATGGGAGACATGATTAAGGAGGG + Intergenic
1166654423 19:44599762-44599784 AAGGGAAAGAAGAATGGGCATGG + Intergenic
1166901765 19:46069290-46069312 ATGAGAGAGAAGAATACAGAGGG - Intronic
1167189961 19:47979169-47979191 ATGGAAGAGGAGGAGGAGGAGGG - Intronic
1167428131 19:49440118-49440140 ATGAGAGACAAGAATAAGGCTGG - Intronic
1167607627 19:50489841-50489863 ATGGGAGAACAGAAAGAGGGAGG + Exonic
1167653223 19:50745172-50745194 ATCTGAGGGAAGAACGAGGATGG + Intergenic
1167674510 19:50876004-50876026 GTGGGAGAGAAAAAGGAGGGAGG - Intronic
1167703835 19:51066496-51066518 GTGGGGGAGAGGAAGGAGGAAGG + Intergenic
1167781758 19:51602880-51602902 GTGGGAGGGGAGAATCAGGAAGG - Intergenic
1168120455 19:54249579-54249601 TTGGGAGAATAGAATGAGGAGGG + Intronic
1168144168 19:54410388-54410410 ATGGGAGGGAAGATTGGGGGAGG - Intergenic
1168351318 19:55677768-55677790 ATGGGAAAGAAGGCTGATGAAGG - Intronic
1168357675 19:55712725-55712747 GGAGGAGAGAAGAATGAGGGAGG + Intronic
1202669858 1_KI270709v1_random:40421-40443 ATGGGAGAGGAGAAGGAGAGCGG + Intergenic
1202680197 1_KI270712v1_random:2656-2678 ATGGGAGAGAAGAAGGAGGGCGG - Intergenic
924961622 2:40373-40395 GTTAGAGAGAAGAATGTGGAGGG - Exonic
925238231 2:2297730-2297752 CTGGGAGGGCAGAAGGAGGAGGG - Intronic
925842588 2:8006566-8006588 ATGGAGGAGAAGAGAGAGGAGGG - Intergenic
926211803 2:10876686-10876708 AAGAGAGAGAAAAAGGAGGAAGG - Intergenic
926385314 2:12329998-12330020 CTGGGATAGAAAAATGAGCAGGG - Intergenic
926835349 2:17013084-17013106 ATGGGAGAGATAAGTGAGCAAGG + Intergenic
926862571 2:17324442-17324464 ATGGATGAGGAGAATGGGGATGG - Intergenic
926963517 2:18385517-18385539 ATGGGACAGAAGGCTGAGGCTGG - Intergenic
927190470 2:20513652-20513674 CTGGGAGACAACAATGAGGACGG - Intergenic
927676391 2:25109711-25109733 GGGGGAGAGAGGAATGGGGAGGG + Intronic
927679896 2:25132355-25132377 CTAAGAGAAAAGAATGAGGAAGG + Intronic
927856081 2:26528774-26528796 ATGGGAAAGAAGACTGGGCAAGG + Intronic
928244790 2:29617844-29617866 CTGGGAGAGAGGAAAGATGATGG - Intronic
928274088 2:29883083-29883105 AAGGGAGAGAGGAAGGAGGAAGG + Intronic
928533794 2:32219399-32219421 AGGGGGCAGAAGAAGGAGGAGGG - Intronic
928600422 2:32898985-32899007 ATGGGGGAGAAGCAAGAGGAGGG - Intergenic
928920280 2:36519896-36519918 ATGGCAGAGAAGAGCGAGGGAGG + Intronic
929362633 2:41112716-41112738 ATGGGGGGGATGAAAGAGGAAGG - Intergenic
929404013 2:41620239-41620261 AAGGCAGAGAAGAATGAAGGAGG + Intergenic
929997791 2:46839833-46839855 ATGTGGTAGAAGAATGAGGTGGG + Intronic
930749002 2:54914442-54914464 ATGGTAGAGGAGGATGAGGCTGG + Intronic
931131211 2:59338365-59338387 AGGGGAGGGAGGAGTGAGGAAGG - Intergenic
931133383 2:59366199-59366221 GGGGGAGAGAAGAAGGAAGAAGG + Intergenic
931441457 2:62293463-62293485 TTGGGAGTGAAGCATGAGAAGGG + Intergenic
931786332 2:65622425-65622447 AGGGGAAAAGAGAATGAGGAGGG + Intergenic
932354834 2:71060144-71060166 ACTGGACAGAAGAAAGAGGACGG - Intergenic
932592729 2:73076764-73076786 TTGGGTGAGAAGAAAGGGGAAGG - Intronic
932843907 2:75115284-75115306 ATGGGGGAAAATAATGAGAATGG - Intronic
933036825 2:77410551-77410573 ATGGGAAAGTACATTGAGGATGG + Intronic
933091220 2:78119845-78119867 GAGGGAGAGAATAAGGAGGAAGG + Intergenic
933129013 2:78649737-78649759 TTGGGAGAGGAGGAAGAGGAGGG - Intergenic
933255087 2:80071686-80071708 AGGGGAGAGAGGACTGAGGGAGG + Intronic
934095502 2:88598925-88598947 ATGGGGGAGAAGAGTGAGAGTGG + Intronic
934458595 2:94196961-94196983 GTGGGAGAGAAGATTGAAGAGGG + Intergenic
934652356 2:96099849-96099871 AGGGGAGAGGAGTAGGAGGAAGG + Intergenic
934883491 2:98004688-98004710 AAGGGAGAGGAGGAGGAGGAGGG - Intergenic
935137158 2:100317221-100317243 ATGGGAGGGAAGAATAGAGAAGG - Intronic
935634281 2:105237937-105237959 ATGAGAGAGAAAAAGAAGGAAGG + Intergenic
936548565 2:113414292-113414314 ATAGGGAAGAAAAATGAGGAAGG - Intergenic
936717319 2:115203091-115203113 AAGGAAGAGATGAATAAGGAAGG + Intronic
936993135 2:118387030-118387052 AAGGGAGCGAAGCATGAGGGTGG - Intergenic
937356608 2:121201841-121201863 AAGGGACAGATGAAGGAGGAAGG + Intergenic
937357703 2:121208771-121208793 AAGGGACAGATGAAGGAGGAAGG + Intergenic
937366328 2:121264509-121264531 CTGGGAGTGCAGAATCAGGAGGG + Intronic
937635637 2:124152654-124152676 AAGGTAGAGAGGAATGAGGAGGG + Intronic
937877261 2:126835290-126835312 CTGGGAGAGCAAAATGAGGCAGG - Intergenic
938272825 2:129990256-129990278 AAGGAAGAGAAGGAGGAGGAGGG + Intergenic
938443405 2:131355852-131355874 AAGGAAGAGAAGGAGGAGGAGGG - Intergenic
938518206 2:132037953-132037975 ATGGGAGAGAAGAAGGAGGGCGG - Intergenic
938851277 2:135263098-135263120 CTGGGAGAGAAGAATGGATATGG - Intronic
939076924 2:137614278-137614300 ATGAGAAAGAAGAATGGGGATGG - Intronic
939566719 2:143794313-143794335 ATAGGAGACATGAATGAGCACGG + Intergenic
939855385 2:147352758-147352780 CAGAGAGAGAAGAATGAGGAAGG + Intergenic
939989560 2:148864611-148864633 ATGGGAGAGAAGAGTGATGTGGG + Intergenic
940092845 2:149940818-149940840 AAGGAAGAGAAGAAAGAGGAAGG - Intergenic
940436086 2:153656944-153656966 ATGGGAAAGAAAAATTAAGAAGG + Intergenic
940526804 2:154826041-154826063 ATGGGAGAGAAGTATTATCAAGG - Intronic
940527506 2:154835683-154835705 AAGGGAGAGAGAAAGGAGGAAGG - Intronic
940778786 2:157911264-157911286 AGAGGAGAGAAGAAAGAGAAGGG + Intronic
941595967 2:167477473-167477495 ATTAGACAGAAGAAAGAGGAAGG + Intergenic
941624432 2:167815130-167815152 ATGTGAGAGGAGAAAGAAGAAGG - Intergenic
941872936 2:170404665-170404687 ATAGGAAAGAAGAGAGAGGAAGG - Intronic
942618819 2:177825391-177825413 GTGGGAGAGGAGAACAAGGAAGG + Intronic
942718271 2:178919450-178919472 AAGGGAGAGTAGAAAGAGGCAGG + Intronic
942720704 2:178949228-178949250 CTGGTAGATAAGAATGAAGAAGG + Intronic
943265818 2:185730509-185730531 ATGAGAGAGTAGAATAAGGTGGG + Intergenic
943338397 2:186646608-186646630 AAGAAAGGGAAGAATGAGGAAGG - Intronic
943612291 2:190047286-190047308 ATGGGAAAGAAGAAGGAAGAAGG - Intronic
943715975 2:191152171-191152193 CTGGGAGAGAAGAATCCAGAGGG - Intergenic
943811846 2:192196345-192196367 CGGGGGGAGAAGAAGGAGGAGGG - Intergenic
944257790 2:197641401-197641423 CTGGGAGAGAAGAAGAGGGAGGG + Intronic
944667494 2:201969622-201969644 ATGGCAGAGAAGGATGAGGAAGG - Intergenic
944822432 2:203444047-203444069 AAGGGAGAGAAGGAAGGGGAGGG + Exonic
945120533 2:206452748-206452770 ATGGCTGAGAAAGATGAGGAAGG - Intronic
945693883 2:213078817-213078839 ATGGGAGAGAAGAATCACTTTGG - Intronic
945889517 2:215413569-215413591 ATGGAACAGAAAGATGAGGATGG - Intronic
945975660 2:216268500-216268522 AGGAGAGAGAAGAATGAAGGAGG - Intronic
946125650 2:217560377-217560399 ATGGGAGAGAGGAAATGGGAAGG - Intronic
946368724 2:219267076-219267098 AGTGGGGAGAAGAAGGAGGAGGG + Intronic
946554432 2:220839392-220839414 AAGGGAGAGGAGAAAGAAGAAGG + Intergenic
946768321 2:223060869-223060891 ATGGGAGAGGAGAATTAAAAAGG - Intronic
947491495 2:230599289-230599311 TTGAGAAAGAAGAATGAAGATGG + Intergenic
947643530 2:231721364-231721386 GTGGGAGAGAACAGTGAGAAAGG + Intergenic
947985892 2:234447136-234447158 TTGGAGTAGAAGAATGAGGATGG + Intergenic
948303071 2:236923011-236923033 ATAGAAGAGAGGAAGGAGGAAGG - Intergenic
948625064 2:239263648-239263670 ACGGGAGAGAAGAATAAACAGGG + Intronic
948974715 2:241457257-241457279 ACGGGAGGGAGAAATGAGGAAGG - Intronic
949005489 2:241644480-241644502 ATGGGTGAGGAGACTGAGGCTGG + Intronic
1168831466 20:847374-847396 TGGGGAGACAAGCATGAGGAGGG + Intronic
1169026281 20:2374335-2374357 ATGGAAGAAATGAATGAAGAGGG + Intergenic
1169160348 20:3372297-3372319 AGGGGAAAGAAGACTGAGGTGGG + Intronic
1169550833 20:6699595-6699617 AGGGGAGAGAGGAAGGAAGATGG - Intergenic
1169892338 20:10466665-10466687 ATGGGTGGGAAGAAAGAGGAGGG - Intronic
1169979708 20:11370712-11370734 ATGGGCAAGAAGAAAAAGGATGG + Intergenic
1170363125 20:15569080-15569102 ATTGTAGAGAAGGATGAGGGAGG + Intronic
1170483117 20:16788060-16788082 ATGGGTGAGAACAATGAGTTTGG + Intergenic
1170498794 20:16953364-16953386 ATAGGAGACAAAGATGAGGATGG + Intergenic
1170797156 20:19558059-19558081 ATGGGGGAGGGAAATGAGGATGG + Intronic
1171093127 20:22305024-22305046 ATGGAAAAGAAGAAAGAGGAAGG - Intergenic
1171107033 20:22444026-22444048 ATGAGAGAAAGGAAAGAGGAGGG - Intergenic
1171316519 20:24200369-24200391 ATTGAAGGGAAGACTGAGGAGGG - Intergenic
1171492848 20:25533252-25533274 GTGGGAGAGGAGAATAATGAAGG + Intronic
1171965565 20:31527459-31527481 AGAGGAGAGAAGAATGACAATGG - Intronic
1172063977 20:32206888-32206910 ATGGGAAGGAAGAGCGAGGATGG + Intronic
1172399133 20:34634018-34634040 AGGGGTGGGAAGAAAGAGGAAGG + Intronic
1173104314 20:40118719-40118741 ATGGGAGAGAAAAGTCAAGAAGG + Intergenic
1173135102 20:40432456-40432478 ATGGGAGATAAGCATGAAAAGGG + Intergenic
1173596010 20:44258710-44258732 GAGGGAGAGAAGGAGGAGGAAGG - Intronic
1173719701 20:45245119-45245141 AGGAGAGAGAAGAAAGAGAAAGG - Intergenic
1174308727 20:49633877-49633899 AGGGGAGAGGAGAATGAGAAGGG + Exonic
1174339852 20:49888896-49888918 CTGGGAGAGGGGAAAGAGGATGG - Exonic
1174861704 20:54097518-54097540 AAGAGAGAGGAGAATGAGAAAGG - Intergenic
1174873465 20:54204594-54204616 CTGGGGGAGAAGAATGACAATGG - Intergenic
1174988957 20:55487843-55487865 ATGGGAGAGAGGAAGGGGTAGGG + Intergenic
1175017914 20:55811603-55811625 GTGGGAGGTAGGAATGAGGAGGG - Intergenic
1175657331 20:60782425-60782447 ATGGGAGAGAAGAGCAAGGTGGG - Intergenic
1176197066 20:63842299-63842321 ATGGGAGAGAAGTCAAAGGAGGG + Intergenic
1176583339 21:8550572-8550594 ATGGGAGAGAAGAAGGAGGGTGG + Intergenic
1176648331 21:9371455-9371477 CTGGGAAATAAGAATGGGGAGGG - Intergenic
1176843554 21:13859411-13859433 ATGGGAGTGAAAGATGAGGGCGG - Intergenic
1177207986 21:18032523-18032545 ATTGGAGAGATAAATGAGAAAGG - Intronic
1177494142 21:21867475-21867497 AGGGGAGTGAGGAATGGGGATGG - Intergenic
1177558540 21:22721039-22721061 CTGGGTTAGAAGAATAAGGATGG + Intergenic
1177669813 21:24210005-24210027 ATGGGAGAGAACACTGATTAAGG + Intergenic
1178005962 21:28219804-28219826 TTGGGGAAGAGGAATGAGGATGG - Intergenic
1178071471 21:28972721-28972743 AAACAAGAGAAGAATGAGGAAGG + Intronic
1178455691 21:32748139-32748161 ATGGGAAAGCACAATGAGGCAGG - Intronic
1178733934 21:35131833-35131855 AATGGAGAGATGAATGATGATGG - Intronic
1178778754 21:35578895-35578917 AAGAGAGAGAAGAGAGAGGAAGG + Intronic
1178870100 21:36366421-36366443 ATGGAAGACAAGAATAAAGAGGG + Intronic
1179084892 21:38207710-38207732 AGGGGAGAGAAGGAGGAGGAGGG - Intronic
1179272984 21:39865914-39865936 GTGGGAGAGAAGGAGGAGGAGGG - Intergenic
1179296161 21:40064862-40064884 AAGGGAGAGAGGAAAAAGGAGGG + Intronic
1179634861 21:42702314-42702336 ATGGGAGATACGAAAAAGGAGGG - Intronic
1180266149 22:10527502-10527524 ATGGGAGAGAAGAAGGAGGGTGG + Intergenic
1180793967 22:18592831-18592853 AAGGGAGGGGAGAATGGGGAAGG + Intergenic
1181227773 22:21402489-21402511 AAGGGAGGGGAGAATGGGGAAGG - Intergenic
1181250879 22:21532350-21532372 AAGGGAGGGGAGAATGGGGAAGG + Intergenic
1181907336 22:26209769-26209791 GAGGGAGGGAAGAAGGAGGAAGG + Intronic
1182662254 22:31933374-31933396 GTGGGAGGGAAGAAGGAGCAAGG - Intergenic
1182917938 22:34052517-34052539 ATGGGAGAAATGAATGGGTATGG + Intergenic
1182973166 22:34596618-34596640 ATGGGACAGAAGAAAGAAAAAGG - Intergenic
1183245584 22:36690962-36690984 ATGGGAGAGGAGATAGGGGAAGG - Intronic
1183249479 22:36719784-36719806 TTGGGAGGAGAGAATGAGGACGG + Intergenic
1183687208 22:39368025-39368047 ATTGGAGACAAGAATGAGCCAGG - Intronic
1183690817 22:39387431-39387453 GAGAGAGAGGAGAATGAGGAAGG + Intergenic
1183781302 22:40000752-40000774 ATGGGAGAAAAGAGGGAGGCAGG - Intronic
1183828994 22:40408201-40408223 ATGGCAGAGAGGACAGAGGAGGG + Intronic
1184125211 22:42481957-42481979 AGGGGGGAGAAGAATGAGAGAGG - Intergenic
1184872420 22:47249434-47249456 ATGGGAGAGAAGTAGGGAGAGGG - Intergenic
1184961454 22:47932169-47932191 AGTAGAGAGAAGAAAGAGGAAGG + Intergenic
1185106949 22:48877194-48877216 GAGGGAGAGAGGAAGGAGGAAGG - Intergenic
1185411453 22:50685106-50685128 ATGGGAAAGCAGAATGGGGCTGG + Intergenic
1203289113 22_KI270735v1_random:17240-17262 ATGGGAGAAAAGAAGGAGGGCGG - Intergenic
1203324981 22_KI270738v1_random:4868-4890 ATGGGAGAGAAGAAGGAGAGTGG - Intergenic
949095839 3:84489-84511 ATGGCAGGGAAGAATGAAGGTGG + Intergenic
949250076 3:1973104-1973126 ATGGGTGAGAAGAAGAAGAAAGG + Intergenic
949343887 3:3058717-3058739 ATGGGAGAGAAGGGTGGAGAAGG - Intergenic
949887024 3:8703723-8703745 TGGGGACAGAGGAATGAGGAAGG - Intronic
950164026 3:10780150-10780172 AAGTGAGAGAGGAAGGAGGATGG - Intergenic
950401586 3:12773204-12773226 GAGGGAGAGAGGAAGGAGGAAGG + Intergenic
950832084 3:15885040-15885062 GTGGGAAGGAAGAAAGAGGAAGG + Intergenic
950853922 3:16088055-16088077 CTGGGAGCGAAGCAAGAGGAAGG + Intergenic
950904665 3:16527106-16527128 ATTGCAGAGAAGAAGGAGGAGGG + Intergenic
951194717 3:19811449-19811471 ATGGGAGAAAACAATAATGAGGG + Intergenic
951353422 3:21634309-21634331 AAGGGAGAAAGGAAAGAGGAAGG + Intronic
951607277 3:24449987-24450009 AAAGGAGGGAAGAAGGAGGAAGG + Intronic
951737413 3:25883161-25883183 ATGAGAGAGAGGAGTGAGAAAGG + Intergenic
952412636 3:33063425-33063447 AGGGGAGAGGAGGAGGAGGAGGG + Intronic
952499953 3:33951864-33951886 ATGGGAGTGAAGAAGGATGGTGG + Intergenic
952629501 3:35448462-35448484 CCTGGTGAGAAGAATGAGGAAGG + Intergenic
952834086 3:37589632-37589654 AGGGGAGAGAACCATGTGGAGGG + Intronic
952856849 3:37778813-37778835 ACAGGAGAAAAGAATGAGAAAGG - Intronic
953389963 3:42528213-42528235 GTGGGAGGGAAGAGGGAGGAGGG - Intronic
954082733 3:48222010-48222032 ATGGGAGAGAAGATGGCGGCAGG + Intergenic
954295305 3:49671297-49671319 AAGGGAGAGAGGGAGGAGGAAGG - Exonic
954967606 3:54625126-54625148 ATGGGGGAGAGGAATGCTGAGGG - Intronic
955034879 3:55257926-55257948 GTGGGAGAGAGGAAGGGGGAGGG - Intergenic
955035642 3:55264574-55264596 AGGAGAGAGAAGAAGGAGGGAGG + Intergenic
955252158 3:57294576-57294598 TTGGGAGGGGAGAATGAGAAGGG + Intronic
955470462 3:59281636-59281658 ATGGGGGAGAAGAAGGAGGAAGG - Intergenic
955523802 3:59800834-59800856 GGGGGAGAGAAGAAAGGGGAGGG + Intronic
955755413 3:62220528-62220550 CTGGAACAGAAGAATAAGGAAGG + Intronic
955853168 3:63243032-63243054 ATGGAAGAGAAGAAAAAGCAAGG + Intronic
955856777 3:63280591-63280613 TTGGGATAGAGGAAAGAGGAAGG - Intronic
955970162 3:64431042-64431064 AGGGTAGAGAAGAAAAAGGAGGG + Intronic
956121230 3:65967833-65967855 AAGGGAAGGAAGAGTGAGGAAGG + Intronic
956245076 3:67173905-67173927 ATGTGAGGTAAGAATGAGGTTGG + Intergenic
956493939 3:69804274-69804296 ATGGGAGAGAAGAGATGGGAGGG - Intronic
956724208 3:72143910-72143932 AAGGGAGGAAAGAATGTGGAAGG - Intergenic
956797336 3:72728804-72728826 ATTTGGGGGAAGAATGAGGAGGG - Intergenic
956971537 3:74532038-74532060 GAGGGAGAGAGGAAAGAGGAAGG + Intergenic
957773941 3:84730781-84730803 CTGTGTGAGAAGAAAGAGGAAGG - Intergenic
957969874 3:87368982-87369004 ATGGAAGATCAGAATCAGGAGGG - Intergenic
958016821 3:87946940-87946962 ATCAGAGAAAGGAATGAGGAAGG + Intergenic
958021183 3:87998127-87998149 AATAGAGACAAGAATGAGGAAGG - Intergenic
958163667 3:89851431-89851453 AGGGGAGAGGAGAAGGAGGAAGG + Intergenic
958834708 3:99131356-99131378 AAGGGAGAGAAGACTTAAGAAGG - Intergenic
958883483 3:99699416-99699438 ATGTGAGAGCAGGAAGAGGAAGG - Intronic
958906001 3:99942895-99942917 AGGGGAGAAAAGAAGAAGGAAGG + Intronic
959689955 3:109187947-109187969 AAGGGAGAGAGGAAGGAAGAAGG + Intergenic
959904371 3:111694168-111694190 CTGGGAGTGAAGGCTGAGGAGGG - Intronic
960157454 3:114310522-114310544 ATCACAGAGAAGATTGAGGAAGG + Intergenic
960486768 3:118262136-118262158 ATGTGATCCAAGAATGAGGATGG + Intergenic
960775132 3:121241698-121241720 AAGGAAGAGAAGAAAGAGGGTGG + Intronic
960997310 3:123348654-123348676 GTGGGAGAGAAGCAAGTGGAGGG + Intronic
961017251 3:123477975-123477997 ATGAGAGAGAAGAAAGGAGAGGG + Intergenic
961340184 3:126212503-126212525 AAGGGAGGAAGGAATGAGGAAGG + Intergenic
961347727 3:126274900-126274922 ATGGGAGGCAAGAAAGAAGAGGG - Intergenic
961561332 3:127732478-127732500 AGGGGACTGAAGATTGAGGAGGG + Intronic
961945400 3:130681951-130681973 ATGGGAGATAAGTAGGAGAAAGG + Intronic
961985485 3:131128306-131128328 GAGGGAGGGAAGAATGAGTAAGG - Intronic
962165219 3:133040535-133040557 AGGGGAGAAAAGAATGCTGAGGG + Intronic
962319829 3:134381476-134381498 TTGGGAGAGCAGAATGAGGAGGG + Intergenic
962365038 3:134773163-134773185 ATGGGGGAGGAGAACCAGGAAGG - Intronic
962611102 3:137076889-137076911 ATGGGAGAAAAAAATGAGGAGGG + Intergenic
962754377 3:138456989-138457011 ATGGGAGAGCAGAGGGAGGGGGG - Intronic
963091217 3:141485939-141485961 CTGGGAGATAAGAAATAGGACGG - Intergenic
963115849 3:141728329-141728351 ATGGGAAAGAATATGGAGGAGGG + Intergenic
963275566 3:143326440-143326462 GAGGGAGAGAAGAGGGAGGAAGG - Intronic
963301606 3:143603346-143603368 ATGTGAGAGAGGAATGTAGAGGG - Intronic
963355781 3:144207770-144207792 ATGGGAGAGTTGAATCGGGATGG + Intergenic
963583736 3:147158573-147158595 AAGGAAGAAAAGAAAGAGGAAGG + Intergenic
963656401 3:148056934-148056956 ATGGGATAGCAGCAAGAGGAGGG - Intergenic
963727812 3:148941523-148941545 ATGGGAGGAAAAAATGAGGAGGG - Intergenic
963773889 3:149418974-149418996 ATGGGAAAGAAGGATGACAAAGG + Intergenic
964179826 3:153869483-153869505 ATGGGTGAGAAGAATCAATATGG - Intergenic
964296441 3:155239471-155239493 ATGGCACATTAGAATGAGGATGG - Intergenic
964368903 3:155978481-155978503 ACGGGAGAGAAGAATATGGATGG - Intergenic
965365603 3:167795532-167795554 TTGGGAAAGAAATATGAGGAGGG - Intronic
965444108 3:168753177-168753199 ATGTGAGAGAATGGTGAGGAAGG - Intergenic
965737583 3:171837918-171837940 AAGGGAGAGAGGAATGATGAAGG - Intergenic
966396327 3:179507405-179507427 AAGGAAGGGAAGAAGGAGGAAGG + Intergenic
966734797 3:183179956-183179978 ATGGGTGAGAATCCTGAGGAGGG + Intronic
967035419 3:185645631-185645653 AAGGGAGAGAAGGGAGAGGAAGG + Intronic
967139027 3:186537809-186537831 CTTGAAGAGAAGAATGAAGAAGG - Intergenic
967627126 3:191699735-191699757 AAGGAAGAGAAAAAGGAGGAGGG + Intergenic
967752286 3:193128429-193128451 ATGGGAGAAAAGAATGAGTTGGG + Intergenic
967864933 3:194182291-194182313 AAGGAAGAGCAGAAGGAGGAGGG - Intergenic
968144815 3:196289123-196289145 GTGGCTGAGAAGAAAGAGGATGG + Intronic
968185613 3:196632070-196632092 ATTGGCGAGATGAATGAGCAGGG + Intergenic
1202738551 3_GL000221v1_random:33529-33551 CTGGGAAATAAGAATGGGGAGGG + Intergenic
968383612 4:116496-116518 AAAGGAGAGGAGAAAGAGGAGGG - Intergenic
968424728 4:515452-515474 AGGGGAGCGCAGAATGAGGCAGG - Intronic
968909040 4:3467276-3467298 GCGGGAGGGAAGAAGGAGGAGGG - Intronic
969165883 4:5312018-5312040 AATGGAGAGAAGAATGAAGAAGG - Intronic
969334452 4:6499363-6499385 AAGGGAGAGAAGGATGGGGTGGG - Intronic
969540317 4:7784519-7784541 AAGGGAGAGAGGACTGAGGAGGG + Intronic
969564307 4:7968673-7968695 GGGGGAGAGAGGAATGGGGAGGG + Intronic
970365501 4:15354142-15354164 ATGGGACAGAAGGATGAAAAGGG + Intronic
970555091 4:17223576-17223598 TTGGCAGAGAAGAGAGAGGATGG + Intergenic
971021600 4:22542295-22542317 TAAGGAGAGAAAAATGAGGATGG - Intergenic
971283664 4:25265430-25265452 ATAGGAGAAAAGAATAATGATGG - Intronic
971408258 4:26342520-26342542 ATGGGAGAAAGGAATGAGGAGGG - Intronic
971586758 4:28414496-28414518 AAGGGGGAGGAGAAAGAGGAAGG - Intergenic
971646456 4:29212206-29212228 ATAGGAAAGAAAAATGAGAAGGG - Intergenic
972027283 4:34398777-34398799 ATGGTAGAGTAGAAGGAGGAAGG + Intergenic
972138136 4:35918819-35918841 ATGGGAGGGCATAATGAGTATGG + Intergenic
972289570 4:37678904-37678926 ATGGGAGAGGAGGATCAGGTAGG + Intronic
972356255 4:38281774-38281796 AGGAGAGAGAGGAAAGAGGAGGG - Intergenic
973128324 4:46617322-46617344 GTGGAAAAGAAGAATGAGGAAGG + Intergenic
974154099 4:58047977-58047999 ATGGGAGAGCAGAGTGTGGGAGG - Intergenic
974318932 4:60318348-60318370 AGGGGTGGGAAGAATGGGGAGGG + Intergenic
974513272 4:62873545-62873567 AGAGGAGGGAAGAATGAGGAGGG + Intergenic
975029626 4:69599562-69599584 ATGGAAGAAAGGAAGGAGGAAGG + Intronic
975108728 4:70599592-70599614 ATGGAAGAGAGGAATGTGGTGGG - Exonic
975276581 4:72508411-72508433 ATTGGAGAAAACAATGAGTATGG + Intronic
975466574 4:74716009-74716031 ATGAGAGAGAAGAAATAGAAAGG - Intergenic
975478721 4:74853997-74854019 AGGGGAGATAAGCATCAGGAAGG + Intergenic
975483344 4:74906465-74906487 AGGGGAGAAAAGGATGAGAAAGG + Intergenic
975580655 4:75904359-75904381 ACGGGAGAGAACACTGAGGTTGG - Intergenic
975794712 4:77994964-77994986 GTGGAAGAGAAGAAAGGGGAAGG + Intergenic
975825340 4:78314031-78314053 AAGGGAGAGAAAAAAGAGCATGG - Intronic
975986443 4:80204968-80204990 AGGGAAGAGTAGAAAGAGGAGGG - Intergenic
976081135 4:81356156-81356178 AGGGGAGAGAAAAACAAGGAAGG + Intergenic
976822765 4:89225557-89225579 ATGGGAGAACAGAATTTGGAGGG + Intergenic
976907918 4:90263166-90263188 ATGGGACAAAAGAATCCGGATGG - Intronic
977261433 4:94801464-94801486 ATGGTAGGGAAGATAGAGGAGGG - Intronic
977279500 4:95022030-95022052 TTGGGAGAGAAGAAATAGGACGG + Intronic
977373839 4:96174350-96174372 AGGGAGGAGAAAAATGAGGAGGG - Intergenic
977376585 4:96212703-96212725 ATTGAAGAAAAGAAAGAGGAAGG + Intergenic
977491194 4:97713946-97713968 AGAGGAGAGAAGACTTAGGAAGG + Intronic
978021839 4:103824134-103824156 ATGTCAGAGAAAAATGAGCAAGG + Intergenic
978063061 4:104362577-104362599 ATGGAAGAGAAAATTGAGTATGG + Intergenic
978196470 4:105978271-105978293 ATGGAAGAAAGGAAGGAGGAAGG + Intronic
978422189 4:108544431-108544453 CTGGGAGAAGAAAATGAGGAAGG + Intergenic
978487807 4:109276012-109276034 ATGGAGGAGAAGAGTGAGCAGGG - Intronic
978739287 4:112119134-112119156 AGGGGAGAGAAGAGAGGGGAGGG + Intergenic
978752621 4:112268806-112268828 ATGTGAAGGAAGCATGAGGAGGG + Exonic
979029417 4:115621880-115621902 ACGGTAGAGCAGAATGAGGGAGG - Intergenic
979233721 4:118375661-118375683 ATAGGAAAGAAGAAGGAGAATGG - Intergenic
979399422 4:120230070-120230092 CTAGGAGGGAAGAGTGAGGAGGG + Intergenic
979558945 4:122080470-122080492 AGGGGAAAGAAGAAAGAGGAGGG + Intergenic
979733386 4:124052443-124052465 AAGGGAGAGAAGCACAAGGAAGG + Intergenic
979948051 4:126859495-126859517 AAGGGAGAGAAGAGTGAAGGAGG + Intergenic
981467677 4:145092757-145092779 ATGGGAGAGAAGGGTTTGGAAGG - Intronic
981578453 4:146228856-146228878 AGGGGAGAGATGAGTGAGAATGG - Intronic
981643945 4:146976804-146976826 ATTGGAGTGAAGACTGAAGAGGG + Intergenic
982154080 4:152498041-152498063 AAGGGAGAAAAGTATGGGGAGGG + Intronic
982324791 4:154119293-154119315 ATGTGAGATAACAATGATGATGG - Intergenic
982710263 4:158750937-158750959 CTGGGTGAGAAGAATCAGTATGG + Intergenic
982856724 4:160392173-160392195 CTGGGAGATAAGGATGTGGAAGG + Intergenic
982917714 4:161233528-161233550 ATGGGAGAGAAACCTGAGGAAGG + Intergenic
982932744 4:161429128-161429150 ATGGGAGGGAAGACTGGGAAGGG + Intronic
982948029 4:161651516-161651538 AAGGAAGAGAAGAAAGGGGAAGG + Intronic
982951111 4:161697191-161697213 ATGGGACTGAGGAATGGGGACGG + Intronic
983027269 4:162754367-162754389 ATGGGAGAGTTGAATGGGGATGG - Intergenic
983511219 4:168611244-168611266 ATTAGAGGGAAGAAAGAGGAAGG - Intronic
984225778 4:177033078-177033100 CCGGGAGAGAAGGATGTGGAGGG + Intergenic
984226369 4:177040042-177040064 ATGGGAGAGGAAACTGACGAGGG + Intergenic
984703430 4:182833006-182833028 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703447 4:182833055-182833077 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703483 4:182833155-182833177 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703489 4:182833174-182833196 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703505 4:182833227-182833249 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703523 4:182833278-182833300 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703553 4:182833357-182833379 AGGGGAGAGGGGAAGGAGGAGGG - Intergenic
984703561 4:182833376-182833398 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703567 4:182833395-182833417 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703578 4:182833430-182833452 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703627 4:182833556-182833578 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703633 4:182833575-182833597 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703639 4:182833594-182833616 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703650 4:182833629-182833651 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703699 4:182833755-182833777 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703705 4:182833774-182833796 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703711 4:182833793-182833815 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703724 4:182833832-182833854 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703730 4:182833851-182833873 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703736 4:182833870-182833892 AGGGGAGGGGAGAAGGAGGAGGG - Intergenic
984703744 4:182833889-182833911 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703755 4:182833924-182833946 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703768 4:182833959-182833981 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703774 4:182833978-182834000 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703780 4:182833997-182834019 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703800 4:182834048-182834070 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703837 4:182834145-182834167 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703843 4:182834164-182834186 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703849 4:182834183-182834205 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703855 4:182834202-182834224 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703866 4:182834237-182834259 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703915 4:182834363-182834385 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703921 4:182834382-182834404 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703927 4:182834401-182834423 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703933 4:182834420-182834442 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703939 4:182834439-182834461 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703952 4:182834478-182834500 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703958 4:182834497-182834519 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703964 4:182834516-182834538 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703970 4:182834535-182834557 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703976 4:182834554-182834576 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703982 4:182834573-182834595 AGGGGAAAGGAGAAGGAGGAGGG - Intergenic
984819217 4:183865560-183865582 ATAGGATACAGGAATGAGGATGG + Intronic
984925321 4:184801361-184801383 ATGGGGGTGCAGAATGAGGGTGG + Intronic
984989387 4:185364239-185364261 ATGGGGGAGCGGAAAGAGGAGGG + Exonic
1202767360 4_GL000008v2_random:159722-159744 CTGGGAAATAAGAATGGGGAGGG - Intergenic
985666014 5:1181840-1181862 ATGGGAGAGAAGAGGGAGTGGGG - Intergenic
985805060 5:2037703-2037725 ATGGGAGAGGGGAGAGAGGAGGG - Intergenic
985851610 5:2392548-2392570 ATGGAAGAGAAGAAAGAAGGAGG - Intergenic
985993767 5:3584889-3584911 ATGGGAGAAAGGAAGGAGGGAGG + Intergenic
985993802 5:3585033-3585055 ATGGGAGAAAGGAAGGAAGAAGG + Intergenic
986118309 5:4803041-4803063 AAGAGAGAAAAGAAAGAGGAAGG + Intergenic
986178800 5:5374329-5374351 ATGTGAGAGGAGAAAGGGGATGG + Intergenic
986317460 5:6600089-6600111 TTGGGAGAAAAGAAGAAGGAAGG - Exonic
986445086 5:7814604-7814626 AGGGGAGAGGAAAATGAAGAAGG - Intronic
986558539 5:9037452-9037474 ATGTTACAGAAGCATGAGGAAGG - Exonic
986803252 5:11283367-11283389 ATGGGAGGAAAAAAAGAGGAGGG + Intronic
986832438 5:11595192-11595214 ATGGGAAAACAGGATGAGGAAGG + Intronic
987113767 5:14711195-14711217 ATGAGAGAGGAGAATGAATAAGG - Exonic
987155078 5:15081262-15081284 ATGGAAGGGAAGAATGAATAAGG - Intergenic
987206415 5:15631558-15631580 ATGGGACAGGAGGCTGAGGAAGG + Intronic
987224957 5:15830788-15830810 AAGGGAGAGAAGATGGTGGAGGG + Intronic
987323529 5:16792456-16792478 ATGTGAGAGCTGATTGAGGATGG - Intronic
988197652 5:28025909-28025931 ATGGCAGGGGAGAGTGAGGAGGG + Intergenic
989299763 5:39876972-39876994 ATGGCAGAGAAAAAAGAGGAAGG + Intergenic
989410472 5:41114088-41114110 ATAGGAGGAAAGAAGGAGGATGG - Intergenic
989609015 5:43273662-43273684 CTGGAAAAGCAGAATGAGGAGGG - Intronic
989748830 5:44866297-44866319 ATGGGAGAGCAGAGGAAGGAGGG - Intergenic
989791033 5:45402110-45402132 ATTGTAGAGAAGAAACAGGAGGG + Intronic
990105395 5:52252249-52252271 ATGGTAGAAAACAATGGGGAAGG + Intergenic
990499908 5:56385752-56385774 ATGGGAGAGGAGGAAGAGGAGGG - Intergenic
990628446 5:57640856-57640878 AAGGAAGAGAAGAAGGATGATGG - Intergenic
990742923 5:58930626-58930648 ATGGGAGTAGAGAAAGAGGACGG - Intergenic
990809083 5:59702017-59702039 ATGACAGAAAAGAATGAAGAGGG + Intronic
991247995 5:64528224-64528246 ATTGGAGAGAATAATGAGAGAGG + Intronic
991515246 5:67427973-67427995 AAGGGAGAGAAGAGAGAGGAAGG - Intergenic
991557930 5:67916647-67916669 ATGGAAGAGAAGAGTGAGATGGG - Intergenic
992052911 5:72956800-72956822 AGGGGTGGAAAGAATGAGGAAGG - Intronic
992226293 5:74622335-74622357 GTGTGGGAGAAGAATGAGAAAGG - Intergenic
992422641 5:76621972-76621994 ATGGAAAAGAGGGATGAGGAAGG - Intronic
992699576 5:79328503-79328525 ATGGGAGAGGAGTAAGGGGAGGG + Intergenic
992947689 5:81825436-81825458 ATGAGAGAGAAGAGTCTGGAAGG + Intergenic
993322467 5:86489068-86489090 AATGGAGAGGAGAATGAGGGAGG + Intergenic
993551422 5:89278430-89278452 ATGGCAGAAAAGAAAGAGGGAGG - Intergenic
993775722 5:91993274-91993296 AAGGGAGAAAAGAGAGAGGAAGG + Intergenic
994045186 5:95300894-95300916 AAGGGAGAGAGGAATGGAGATGG - Intergenic
994226115 5:97253590-97253612 AGGAGAGAGAAGAATAAAGAGGG + Intergenic
995321508 5:110839637-110839659 AAGGGAAAGAAGGAAGAGGAAGG - Intergenic
995621705 5:114032718-114032740 ATAAGAGAGAAGAAAGAGTATGG + Intergenic
995953427 5:117744779-117744801 ATGCGAGACAAAAATGAGGCAGG + Intergenic
996337521 5:122400962-122400984 TTGGGTGAGAAGAGTGAAGAGGG - Intronic
996405598 5:123099629-123099651 GCGGGAGACAAGAAGGAGGAAGG - Intronic
996793979 5:127324240-127324262 AAGGTTGAGAAGAATGAGTAGGG + Intronic
996883331 5:128326292-128326314 GAGGGAGAGAAGATTGAGAATGG + Intronic
997915375 5:137919482-137919504 AGAGGAGAAAAGAATGAGAATGG + Intronic
998416527 5:141950228-141950250 ATGGGAGAGAGGGACCAGGATGG - Intronic
998519963 5:142791326-142791348 ATGGGAGAGGAGATGGAGGCTGG - Intronic
998929319 5:147163144-147163166 AAGGAAGAGAAGAAGGGGGAAGG - Intergenic
999189220 5:149733696-149733718 GTGGGAGAGAGGAATGCAGAGGG + Intronic
999195033 5:149776038-149776060 ATGGCAGAGAAGGAGGTGGAGGG - Intronic
999233630 5:150077719-150077741 TTGGGAGAGAGGGAGGAGGAGGG - Intronic
999729050 5:154462063-154462085 ATGGGAGAGGAGAAGGATGTGGG - Intergenic
999833321 5:155341598-155341620 CAGAGAGAGAAGGATGAGGAAGG + Intergenic
1000155965 5:158552078-158552100 GTTGGAGAGGAGAATCAGGAGGG + Intergenic
1000674155 5:164100280-164100302 ATAAGAGAGAAGATTGAGGTAGG + Intergenic
1001720222 5:173851042-173851064 AAGGGAGGGAGGAAAGAGGAAGG + Intergenic
1001918329 5:175580622-175580644 ATGGGACAGGAGAGTCAGGAGGG + Intergenic
1002048150 5:176553563-176553585 ATGAGAGAAAAAAGTGAGGAGGG + Intronic
1002156623 5:177286604-177286626 AAGGGAGAAAAGAATGAGAGAGG - Intronic
1002189180 5:177469948-177469970 AAGGGAGAAGAGAAAGAGGAGGG + Intronic
1002969138 6:1996155-1996177 ATGAGAAAGAGGAAGGAGGAAGG - Intronic
1003004266 6:2366414-2366436 AAGGAAGGGAAGAAAGAGGAAGG + Intergenic
1003005606 6:2378204-2378226 GAGGGAGAGAGGAAAGAGGAAGG + Intergenic
1003253066 6:4449443-4449465 GTGGAAAAGAAGGATGAGGAAGG + Intergenic
1003384667 6:5656133-5656155 ATGGAAGACAAGGAAGAGGACGG + Intronic
1003476887 6:6491720-6491742 AGGGCAGAGAACAATGAGGAGGG - Intergenic
1003573689 6:7273803-7273825 AAGGGTGAGAAGTATCAGGAAGG + Intronic
1003737778 6:8896863-8896885 AAGGAAGAAAAGAAAGAGGAAGG - Intergenic
1003759693 6:9162778-9162800 AAGAGAGAGAAGAAGGAGGGAGG + Intergenic
1004211625 6:13651906-13651928 GTGGTAGAGAGGAGTGAGGAGGG - Intronic
1004847490 6:19661588-19661610 ATGGGTTAGAGGAAAGAGGAAGG + Intergenic
1005213165 6:23493125-23493147 TTGGAAGAGTAGAATGATGAAGG - Intergenic
1005828993 6:29655573-29655595 ATGGGAGATCAGGATGAGGGTGG - Intergenic
1006006131 6:31003185-31003207 ATGGAAGAGAAGAATTAGAAGGG + Intergenic
1006079569 6:31557675-31557697 ATGGGAATAAAGAATAAGGATGG + Exonic
1006173757 6:32109725-32109747 ATGGGAGAGGAGCATGGGGGAGG - Intronic
1006192246 6:32216831-32216853 ATGTGAGAATAGAATGAGAATGG - Intronic
1006713555 6:36097616-36097638 ATGGAAGAGAAGACTAAGAAAGG - Intronic
1007191823 6:40025822-40025844 ATGGGAGGGGAGCATTAGGAAGG - Intergenic
1007253809 6:40514773-40514795 GTGGGAGAGAGAAATGAGAAGGG - Intronic
1007377440 6:41466538-41466560 AAGAGAGGGAAGAAGGAGGAAGG + Intergenic
1007402166 6:41609007-41609029 AAGCAAGAGAAGGATGAGGAAGG - Intergenic
1007477557 6:42129055-42129077 GTGGGAGAGAAGGCTCAGGACGG - Intronic
1007509758 6:42365975-42365997 ATGGGAAACAAGATTGAAGAAGG - Intronic
1007553451 6:42746944-42746966 AGGGCAGGGAAGAAAGAGGAAGG - Intronic
1007599427 6:43072528-43072550 ATGGGTGAGAGGAGTGAGGTTGG + Intronic
1007618356 6:43196035-43196057 ATGTGAAAGCAGAGTGAGGAGGG - Intronic
1007634808 6:43292961-43292983 GTGGAAGAGAAGAGTGAGGAGGG + Intergenic
1007649673 6:43411406-43411428 ATGTGAAAGAAGAATGTGAAGGG + Intergenic
1007681920 6:43639980-43640002 GTGGGAGAGAAGAACAAGGCAGG - Intronic
1007735736 6:43981248-43981270 AGGGGAGAGAGGAAGAAGGAAGG + Intergenic
1007963775 6:45985162-45985184 GTGGGAGAGAAGAAAGAGCCTGG + Intronic
1008016429 6:46525630-46525652 AAGGAAGAGAAGAAGGGGGAGGG + Intergenic
1008265135 6:49415655-49415677 ATGAGAGAGTAGAAAGAGGAAGG + Intergenic
1008666796 6:53724652-53724674 AGGGGAGAGAAGGGAGAGGAGGG + Intergenic
1009040101 6:58165794-58165816 ATTGGAGAGAAGAATAAGGAGGG + Intergenic
1009215993 6:60920650-60920672 ATTGGAGAGAAGAATAAGGAGGG + Intergenic
1009425281 6:63506962-63506984 AGGGAGTAGAAGAATGAGGAAGG + Intergenic
1010549012 6:77197898-77197920 ATGGGGGAGAAGAATGCAAATGG + Intergenic
1010715277 6:79221799-79221821 ATGGAAGACAAGAAAGAGGAGGG + Intronic
1010922808 6:81704816-81704838 AAGGGAGGGAAGAAAGAGTAGGG + Intronic
1010995861 6:82531677-82531699 GTGGGAGAAAAGAAGGAGGATGG + Intergenic
1011484757 6:87830004-87830026 AAGGGAGAGGAGAAGGAGGAAGG - Intergenic
1011823432 6:91279038-91279060 ATGGAAGAGAAGAAGGAGAGAGG - Intergenic
1011924175 6:92621823-92621845 ATGAGACAGAAGAATTAGAAGGG + Intergenic
1012075906 6:94685607-94685629 ATGGAACAGAAAACTGAGGAAGG - Intergenic
1012304168 6:97629607-97629629 AGGGGAGACAAGAATAATGAAGG - Intergenic
1012417820 6:99028667-99028689 ATGGGAGAGAAGAGATAGCAGGG - Intergenic
1012445087 6:99298935-99298957 ATGGGAGAGAAGTTTCAGCAGGG - Intronic
1012660871 6:101889776-101889798 AGGGGAGAGAGGATTCAGGAAGG - Exonic
1012863348 6:104588524-104588546 ATGGGAGAGAAGAATGGAATGGG + Intergenic
1012923237 6:105241567-105241589 ATGGGAGGGAAGAGTGCGGGGGG + Intergenic
1013068983 6:106711188-106711210 ATGGGAAAGAAGAAGGGGCAGGG - Intergenic
1013537249 6:111074697-111074719 AAGGGAGAGAGGAAGGAGGTAGG + Intergenic
1013588569 6:111601117-111601139 TTGGGAGGGAAGAAAGGGGATGG + Intronic
1013999886 6:116352912-116352934 AAGAGAGAGAGGAAGGAGGAGGG - Intronic
1014647110 6:123987780-123987802 ATATGAGAGAAGAAGGGGGAGGG - Intronic
1014818505 6:125959982-125960004 ATGGCAGAAAATAAAGAGGAAGG + Intronic
1014888768 6:126816148-126816170 ATGGAAGGAAAGAAAGAGGAAGG - Intergenic
1015190192 6:130463976-130463998 ATGGAAGGGAAGGAAGAGGAGGG - Intergenic
1015487482 6:133789121-133789143 AAGAGAGAGAACAATGATGAAGG + Intergenic
1015629370 6:135215944-135215966 ATGGGACAAAAGAATAAGAAAGG - Intronic
1015726608 6:136305994-136306016 AGGGGAGAGGAGGAAGAGGATGG - Intergenic
1015778426 6:136838753-136838775 ATGGGACAGAAGAAACATGATGG + Intronic
1016137169 6:140558182-140558204 ATTGGAGAGATTAATGATGACGG - Intergenic
1016261934 6:142182327-142182349 ATAGGAGATGAGAATGAGGGTGG + Intronic
1016466611 6:144331839-144331861 GTGGTAGAGAGGAATGTGGAAGG + Intronic
1016544139 6:145201704-145201726 CTGGGAAAGAAGAAAGAAGAAGG - Intergenic
1016640150 6:146338870-146338892 AGAGAAGAGAAGAAGGAGGAAGG - Intronic
1017042189 6:150316476-150316498 CTGGAAGAGAAAAGTGAGGAGGG + Intergenic
1017096904 6:150812716-150812738 ATGGCAGGGAAGGAGGAGGAAGG + Intronic
1017103482 6:150867062-150867084 ATGGGAGAGCAGAGGGAGGAAGG - Intronic
1017154335 6:151309410-151309432 ATGGGAGAAAATAATGAACAAGG + Intronic
1017301657 6:152868121-152868143 AGATGGGAGAAGAATGAGGAAGG + Intergenic
1017356202 6:153512356-153512378 GTGGGAGAGGAGAATGAAGTAGG + Intergenic
1017554082 6:155544332-155544354 TTGGGAGAGGACAATGTGGATGG + Intergenic
1017650684 6:156578752-156578774 ATAGAAGAGAAGACTGTGGATGG - Intergenic
1018005217 6:159615794-159615816 TGGGGAAATAAGAATGAGGAAGG + Intergenic
1018058350 6:160071105-160071127 CTGGGAGGGAAGGATGAGGGTGG + Intronic
1018176542 6:161183025-161183047 ATGGGAGAAGAGGATGAGGAAGG + Intronic
1018185466 6:161262486-161262508 CTATGAGAGAATAATGAGGAGGG - Intronic
1018249872 6:161858695-161858717 ATGGGTTAGAATAAGGAGGAAGG - Intronic
1018336956 6:162802650-162802672 ATGGGTGAGAAATATGAAGAAGG - Intronic
1018377122 6:163223511-163223533 ATGGGAAAGCAGAAGAAGGATGG + Intronic
1019327598 7:445967-445989 AAGGGAGAGAGGAGGGAGGATGG + Intergenic
1019517418 7:1446173-1446195 TAGGGAGAGAAGAGTGAAGAGGG + Intronic
1019517475 7:1446317-1446339 TAGGGAGAGAAGAGTGAAGAGGG + Intronic
1019517514 7:1446423-1446445 TAGGGAGAGAAGAGTGAAGAGGG + Intronic
1019549245 7:1594006-1594028 GAGGGAAAGAAGAAGGAGGAGGG - Intergenic
1019738956 7:2663424-2663446 ATGGGAGGGCAGAGTGGGGAGGG + Exonic
1019805043 7:3117534-3117556 AGGGGAGAGAGGAAAGAGAAAGG + Intergenic
1019846789 7:3510636-3510658 ATGGGAGGGAAGAAGGGGGGAGG + Intronic
1020671196 7:11115089-11115111 ATGTGAGATAAGGATGGGGAAGG - Intronic
1020691624 7:11361856-11361878 ATGAGAGCGAAGAAAAAGGAAGG - Intergenic
1021035134 7:15788687-15788709 AGGAGAGAGAAGAGTGAGCAGGG + Intergenic
1021071196 7:16243195-16243217 AGGTGAGAGAAGAATGAAGGAGG - Intronic
1021269413 7:18566904-18566926 AGGTGAGAGAAGACAGAGGAAGG + Intronic
1021772687 7:24021145-24021167 CTGGGAGAGGCGAGTGAGGAGGG + Intergenic
1022779641 7:33567014-33567036 AAGGGAGATAGGAATGATGATGG + Intronic
1023057978 7:36304858-36304880 AAGGGAGAGAGGAAGGGGGAGGG + Intergenic
1023115706 7:36859946-36859968 ATGAGGGAGAAGGAAGAGGACGG - Intronic
1023183933 7:37513972-37513994 ATGAGTTAGAAGAATGAGTAAGG - Intergenic
1023371746 7:39518842-39518864 AAGGGAGAGAAGAAGGCGGTGGG - Intergenic
1023584894 7:41718983-41719005 CTGGGAGACATGGATGAGGATGG - Intergenic
1023824645 7:44000875-44000897 GAGAGAGAGAAGAATGGGGAGGG + Exonic
1023966143 7:44963961-44963983 AGGGGAGAGAAGACTGAGGCAGG + Intronic
1024109783 7:46133618-46133640 GAGGGAGAGAAGGAGGAGGAGGG - Intergenic
1024233104 7:47377770-47377792 ATGGGGGAGAAGGAGAAGGAGGG - Intronic
1024359121 7:48449295-48449317 AGAGGAGAGAAGAAAAAGGAAGG - Intronic
1024469530 7:49752667-49752689 ACAGGAGAGAAGAAGGAGGATGG + Intergenic
1024525288 7:50343236-50343258 AAGGGAAAGAAAAAGGAGGAAGG - Intronic
1024610416 7:51059539-51059561 ATGGGAGAGAACAGGGAGAAGGG + Intronic
1024916654 7:54507735-54507757 ATGAGAGAGAAGCAGCAGGAAGG + Intergenic
1025149474 7:56537655-56537677 ATGGGCGAGAAGAAAGCGCAGGG + Intergenic
1025320381 7:58088080-58088102 ATGGGAGAGAAGAAGGAGAGCGG + Intergenic
1025553369 7:62275626-62275648 ATGGGAGGGAAGAAGGAGAGCGG - Intergenic
1025840385 7:65141208-65141230 ATGGGAGAGAAGAAGGAGGGCGG + Intergenic
1025878329 7:65508956-65508978 ATGGGAGAGAAGAAGGAGGGCGG - Intergenic
1025882672 7:65554756-65554778 ATGGGAGAGAAGAAGGAGGGCGG - Intergenic
1025890771 7:65647847-65647869 ATGGGAGAGAAGAAGGAGGGCGG + Exonic
1026088194 7:67279627-67279649 GAGAGAGAGAAGAATGGGGAGGG + Intergenic
1026206297 7:68260709-68260731 AAGGGAAAGAAGAAGGAGGATGG - Intergenic
1026223791 7:68423155-68423177 ATGGGGGAGAAGAGAGAGGTGGG + Intergenic
1026319264 7:69254773-69254795 AAGGGAGAGAGGAAGGAGAAAGG + Intergenic
1026394396 7:69936873-69936895 AAGGGAGAGAAAAAGGAGAAAGG - Intronic
1026588900 7:71679921-71679943 AAGGGAGAGAGGGAGGAGGAAGG - Intronic
1026588953 7:71680076-71680098 AAGGGAGAGAGGGAGGAGGAAGG - Intronic
1026726050 7:72870639-72870661 GAGAGAGAGAAGAATGGGGAGGG - Intergenic
1027117793 7:75494965-75494987 GAGAGAGAGAAGAATGGGGAGGG + Intergenic
1027274012 7:76540515-76540537 GAGAGAGAGAAGAATGGGGAGGG - Intergenic
1027327456 7:77059567-77059589 GAGAGAGAGAAGAATGGGGAGGG - Intergenic
1027453959 7:78364035-78364057 ATTATAGAGAAGAAGGAGGAGGG - Intronic
1027464967 7:78503692-78503714 GGAGGAGAGAAGAATGAGGGAGG - Intronic
1027528139 7:79296733-79296755 AGGAGAGGGGAGAATGAGGAAGG + Intronic
1027560413 7:79721711-79721733 ATGGGAAAGAAGAGAGATGAGGG - Intergenic
1027840936 7:83310534-83310556 ATTTGAGAAAAGAAGGAGGATGG + Intergenic
1027959136 7:84920920-84920942 ATGGCAGAGGACAAAGAGGAAGG + Intergenic
1028189338 7:87826875-87826897 AAGGGAGAAAAGAATGAAGTTGG + Intronic
1028445405 7:90916188-90916210 TTGGAAGTGAAGAATGAGGCTGG + Intronic
1028687606 7:93609654-93609676 GTGGGGCAGGAGAATGAGGATGG + Intronic
1028977659 7:96932085-96932107 CTGGGAGTCAAGAATGAAGAGGG - Intergenic
1029719705 7:102355090-102355112 GAGAGAGAGAAGAATGGGGAGGG - Intergenic
1029752908 7:102554168-102554190 GAGAGAGAGAAGAATGGGGAGGG + Intronic
1029770860 7:102653260-102653282 GAGAGAGAGAAGAATGGGGAGGG + Intronic
1030290058 7:107863466-107863488 AGGGGAGAGAAGAAAGCAGAGGG - Intergenic
1030305725 7:108017398-108017420 AGGGGAGAGAAGAAACAGGGTGG + Intergenic
1030431542 7:109455269-109455291 ATGGGAGGGAAGAGTGAAAAAGG - Intergenic
1030609558 7:111673942-111673964 ATGGGAGAGATGACAGAAGAAGG + Intergenic
1031137966 7:117906559-117906581 ATGGGAGAGAAAAATGAAAAGGG - Intergenic
1031350721 7:120727829-120727851 AGGGGAGAGTAGAAAGAGTATGG + Intronic
1031443116 7:121817382-121817404 ATTGGAGAGGAGAAATAGGATGG + Intergenic
1031494562 7:122430884-122430906 ATGGAAGAGAACTATGATGATGG + Intronic
1031697397 7:124874847-124874869 AAGGGAGAGAGGAATGGGAAGGG + Intronic
1032165214 7:129539922-129539944 ATAGGAGAGAGGGATGAGGAGGG + Intergenic
1032450435 7:132025834-132025856 AGGGTAGAGAAAGATGAGGATGG + Intergenic
1032839113 7:135700156-135700178 CAAGGAGAAAAGAATGAGGAAGG - Intronic
1033435439 7:141329382-141329404 ATGGGAAAGAATAATGAGAATGG - Intronic
1033442828 7:141395768-141395790 ATGGGAGAGAAGGATGGGCATGG + Intronic
1033525351 7:142207949-142207971 TAGGGAGAGAAGAATGGTGAAGG + Intronic
1033602097 7:142895884-142895906 ATGAGAGAGAAGAGTGTGGGAGG + Intergenic
1033636679 7:143218408-143218430 ATGGAAGACAAGAAGGAGAAAGG - Intergenic
1033669996 7:143482567-143482589 AATGGAGAGAAGAATGAAGAAGG - Intergenic
1033763018 7:144457238-144457260 ACAGGAGAGAAGCATGAGGTGGG + Intronic
1034066134 7:148138588-148138610 AGAGGAGAGCAGATTGAGGAGGG - Intronic
1034112267 7:148548426-148548448 ATGGAAGAGAACAAGGATGAGGG - Intergenic
1034427922 7:151024215-151024237 GTGGGAGGGGAAAATGAGGAGGG + Exonic
1034470916 7:151253931-151253953 AGAGGAGAGGAGAGTGAGGATGG - Intronic
1034488169 7:151379202-151379224 TGGGGAGAGAAGAATGGGGGCGG + Intronic
1034735330 7:153424021-153424043 AGGGGAGAAGAGAATGAGGTAGG + Intergenic
1034902923 7:154918735-154918757 GTGTGAATGAAGAATGAGGAGGG + Intergenic
1035278568 7:157763284-157763306 AAGGGAGAGAAAAATGAGGAGGG - Intronic
1036405458 8:8450896-8450918 ATGGGAGATGAGAAGGGGGAGGG + Intergenic
1036487229 8:9190218-9190240 ATGGGAGGGAGGAAAGAGGAAGG - Intergenic
1036497235 8:9280355-9280377 CTGGGGGAGCAGAATGAGGGAGG + Intergenic
1036644053 8:10601218-10601240 AGGAGAGAGAAGGAGGAGGAGGG + Intergenic
1037394155 8:18424362-18424384 ATGGGACAGGAAAATGAGGTGGG + Intergenic
1037454210 8:19047494-19047516 CTGGGAGGTAAGAATGTGGAGGG + Intronic
1037491082 8:19397696-19397718 GTGGGAGAGAAGAATCTAGATGG - Intergenic
1037739644 8:21597992-21598014 ATGGGAGAGAGGCAGGAGGGAGG + Intergenic
1037753453 8:21697079-21697101 ATGGGACAGAGGAAAGGGGAAGG + Intronic
1038311513 8:26449366-26449388 AGGGGAGAGGAGAAGGAGGGAGG + Intronic
1038487677 8:27948441-27948463 ATGGAAGAGAAGATAGGGGAAGG - Intronic
1038570467 8:28657918-28657940 ATGGGAAGGCAGAAAGAGGAAGG - Intronic
1038679332 8:29652425-29652447 GAGGAAGAGAAGAAAGAGGAAGG + Intergenic
1038948674 8:32390105-32390127 ATGGGAAAGCAGAGTGAAGAGGG - Intronic
1039252738 8:35684559-35684581 CTGAGAGAGAAAAATGGGGAGGG - Intronic
1039839549 8:41284198-41284220 ATGGAAGAGGAGAAGGAGAACGG + Intronic
1040576303 8:48654382-48654404 ATGGAAGAGAGGAAGAAGGAAGG - Intergenic
1041646054 8:60253728-60253750 ATGGGAAAGTAGCATGAGGCAGG - Intronic
1042155879 8:65842777-65842799 ATGGGTGAAAAGAATGAGAAAGG + Intergenic
1042289067 8:67148562-67148584 ATGGGAGTTCAGAATCAGGAAGG - Intronic
1042360388 8:67876323-67876345 AGGGTAGAGAGGAAAGAGGAGGG + Intergenic
1042517439 8:69674299-69674321 ATGGGAGGGAGGAGGGAGGAAGG + Intronic
1042836012 8:73079638-73079660 TTGGGGGAGAAGGAGGAGGAGGG - Intronic
1043438195 8:80254383-80254405 ATAGAGGAGAAGAATGAGGGTGG + Intergenic
1043476500 8:80610791-80610813 AGGGGAGGGAACAATGAGAAAGG - Intergenic
1043800260 8:84600682-84600704 ATGACTGAGAGGAATGAGGAGGG + Intronic
1044552343 8:93526211-93526233 ATGGAAGAGTAGAAAAAGGAGGG - Intergenic
1044655832 8:94547443-94547465 CAGGGATAGAAGAATAAGGAAGG - Intronic
1044729042 8:95215654-95215676 ATGGGAGGGAAGGATGGGGAAGG - Intergenic
1044731341 8:95230975-95230997 CTGAGAGAGAAGAATGAGGCAGG + Intergenic
1044953153 8:97452915-97452937 ATTGGAAAGAAGAAAGAAGAAGG + Intergenic
1045274280 8:100688319-100688341 AAGGGAGAGAGGAAAGAGAAGGG + Intronic
1046088686 8:109470909-109470931 TGGGGAGAGAGAAATGAGGAAGG + Intronic
1046525712 8:115379995-115380017 GAGAGAGAGAAGAAGGAGGAAGG + Intergenic
1046671857 8:117064797-117064819 CTGGGAGAGGAGGAAGAGGAGGG + Intronic
1046702279 8:117414857-117414879 ATGGTAGGGAAGGATGAAGAAGG - Intergenic
1047083720 8:121493479-121493501 ATGTTGGAGAAAAATGAGGATGG + Intergenic
1047256695 8:123218763-123218785 GTGAGACAGAAGAATGTGGAAGG + Intergenic
1047703998 8:127479193-127479215 AGGGGAGAGAAAAAGGAGGAAGG + Intergenic
1047732186 8:127736816-127736838 ATGGGAGAGGAGAAGGCAGAGGG + Intronic
1047908487 8:129499541-129499563 AGGAGAGAGAAGAATGAAGGAGG + Intergenic
1048182058 8:132204476-132204498 ATGGGGGACCAGAATGAGGCTGG - Intronic
1048187609 8:132256405-132256427 AGGGGAGAGGAGATAGAGGAAGG + Intronic
1048357034 8:133661982-133662004 ATGGGAAAAAAGAACGAGGGTGG + Intergenic
1048369278 8:133763652-133763674 ATGTGAGAGCAGAATGTGGTGGG + Intergenic
1048369284 8:133763704-133763726 ATGTGAGAGCAGAATGTGGTGGG + Intergenic
1048537585 8:135312000-135312022 GTGAGAGAGAAGAATGAAGGAGG + Intergenic
1048537801 8:135313796-135313818 GTGAGAGAGAAGAATGAAGGAGG + Intergenic
1048629027 8:136220370-136220392 GGGGGAGAAAATAATGAGGAGGG + Intergenic
1048772179 8:137906534-137906556 ATGGTAGAGAAGAATTTGTATGG + Intergenic
1048840032 8:138557607-138557629 GAGGGAGGGAAGAAAGAGGAAGG + Intergenic
1048841287 8:138568673-138568695 AAGGGAGGGAGGAAGGAGGAAGG + Intergenic
1048884161 8:138895713-138895735 CAGGGAGAGAAGAAAGAGTACGG + Intronic
1048919288 8:139213360-139213382 CTGAGAGAGAAGGAAGAGGAGGG - Intergenic
1049361048 8:142212781-142212803 ATTGGAGAGAAGGAGGAGGAGGG - Intronic
1049361095 8:142212919-142212941 ATGGGAGAGAGGGAGGGGGAGGG - Intronic
1049566505 8:143341854-143341876 AAGGGGGAGGAGAAAGAGGAAGG - Intronic
1049904431 9:202880-202902 ATAGGGAAGAAAAATGAGGAAGG + Intergenic
1050022499 9:1299126-1299148 ATAGGAGAGAAGAGGTAGGAAGG + Intergenic
1050297665 9:4222250-4222272 ATAGGAGAAGAGAAAGAGGAAGG - Intronic
1050375706 9:4970673-4970695 ATGGGAGAGAAGAATTCTCATGG + Intergenic
1050686682 9:8178408-8178430 AGAGGAGAAAAGAAAGAGGATGG + Intergenic
1051150285 9:14072330-14072352 AGGGGAGAGGAGAGTGAAGAGGG + Intergenic
1051979200 9:22993366-22993388 GTGTGAGAGAAGGAAGAGGAAGG + Intergenic
1052395638 9:27934809-27934831 ATGGCAGAGTGGAAAGAGGATGG + Intergenic
1052531180 9:29686289-29686311 AAGGAAGAGAAGGAGGAGGAGGG + Intergenic
1053014482 9:34654202-34654224 AAGGGGGAGCAGAAGGAGGAAGG - Intronic
1053139655 9:35674592-35674614 ATGGGAGAGAAGGGGGAGGCTGG + Intronic
1053499563 9:38574061-38574083 CTGGGAAATAAGAATGGGGAGGG - Intronic
1053576294 9:39359268-39359290 CTGGGAAAGAAGATTGAAGATGG - Exonic
1053727003 9:41014454-41014476 ATAGGGAAGAAAAATGAGGAAGG + Intergenic
1053840805 9:42187193-42187215 CTGGGAAAGAAGACTGAAGATGG - Exonic
1054097863 9:60917959-60917981 CTGGGAAAGAAGATTGAAGATGG - Intergenic
1054119265 9:61193589-61193611 CTGGGAAAGAAGATTGAAGATGG - Exonic
1054460253 9:65458668-65458690 ATGGGAGAGAGGTGTGAGGGGGG - Intergenic
1054588488 9:66988973-66988995 CTGGGAAAGAAGATTGAAGATGG + Intergenic
1055018225 9:71642191-71642213 ATGGGGGAGCAGGAAGAGGAGGG + Intergenic
1055052363 9:71993505-71993527 TTGGGAGAAAAGCATGAGAAGGG + Intergenic
1055371227 9:75601764-75601786 CAGGGAGAGAGGAATGGGGAAGG + Intergenic
1056568444 9:87795527-87795549 AGGGGAGAAAGCAATGAGGATGG - Intergenic
1057521356 9:95762993-95763015 ATAGGAGAGAAGAAAAATGATGG + Intergenic
1057781994 9:98057322-98057344 ATGTCAGAGAAGAATTATGACGG - Intronic
1058102379 9:100931679-100931701 ATGGGAATGAAGAACTAGGAGGG + Intergenic
1058718792 9:107744945-107744967 ATGGGATGAATGAATGAGGATGG + Intergenic
1058719085 9:107747341-107747363 ATGAGAAAGGAGGATGAGGAGGG + Intergenic
1059354279 9:113687234-113687256 AAGGCAGAGAAGAGGGAGGAGGG + Intergenic
1059453593 9:114386342-114386364 TTGGGGGAGAAGACTGGGGAGGG + Intronic
1059931088 9:119261872-119261894 GAGGAAGAGAAGAAGGAGGAGGG - Intronic
1060134978 9:121144817-121144839 CTGGGACAGAAGTATGAGAAAGG - Intronic
1060222438 9:121771877-121771899 TTTGGAGAGAAGAATGTGGGTGG - Intronic
1060809049 9:126599264-126599286 AGGAGAGAGAAGAGTGAGGAAGG + Intergenic
1061258794 9:129467817-129467839 GTGGGAGGGAAGAAGGAGGCAGG - Intergenic
1061313616 9:129779965-129779987 AGGGGAGGGAGGAAGGAGGAAGG + Intergenic
1061792873 9:133067673-133067695 ATGGGAGATAAGAATAAAGAAGG - Intronic
1062182282 9:135196821-135196843 ATGGGAAAGAAAAATGGGAAGGG - Intergenic
1062249188 9:135585839-135585861 CTGGGAGGGAAGATGGAGGAGGG - Intergenic
1062362622 9:136194797-136194819 AGGGGAGGGAAGAGTGGGGAGGG - Intergenic
1062727068 9:138080532-138080554 ATGGGTGAGAAGGTTCAGGAAGG + Intronic
1203707283 Un_KI270742v1:63976-63998 CTGGGAAATAAGAATGGGGAGGG + Intergenic
1203613294 Un_KI270749v1:28339-28361 ATGGGAGAGAAGAAGGAGGGTGG + Intergenic
1185954894 X:4478462-4478484 AGGGGAGGGAAGAGAGAGGATGG + Intergenic
1186058882 X:5681854-5681876 AAGGGAAAGAAAAAAGAGGAAGG + Intergenic
1186116171 X:6307167-6307189 TCGGGAGAGAAGGTTGAGGAAGG - Intergenic
1186757289 X:12685352-12685374 ATGAGAGAGAAGAAAGAGGGAGG - Intronic
1186915037 X:14209684-14209706 GTCAGAGAGAAGAAAGAGGAAGG + Intergenic
1186977980 X:14928650-14928672 ATGGGATTGAACAATGAAGAGGG - Intergenic
1186986499 X:15020498-15020520 ATGAGAGGGAAGACTGAAGATGG - Intergenic
1187378698 X:18780746-18780768 ATGGGAGAGCTGAAAGAGGAGGG + Intronic
1187421687 X:19139851-19139873 AAGGGAGAGAAGAATGTGAATGG + Intergenic
1187468744 X:19549633-19549655 TGGGGAGAGGAGAATGAGGCTGG - Intronic
1188796188 X:34468496-34468518 AGGAGACAGAAGAATGAAGAAGG - Intergenic
1189248355 X:39580824-39580846 ATGAGAGAGGAGAGAGAGGAGGG - Intergenic
1189274238 X:39773182-39773204 AGGGGAGGGGAGAATGAAGAGGG - Intergenic
1189352249 X:40284486-40284508 AGGGGAGGGAATAATGAGGAGGG - Intergenic
1190022338 X:46890597-46890619 ATGGGAGAAAAGACTGAAGATGG + Intronic
1190056090 X:47181802-47181824 GTGGGAGAGCAGAACTAGGATGG - Exonic
1190071315 X:47282179-47282201 AAGGGAGAAAGGAAGGAGGAAGG - Intergenic
1190399331 X:50015911-50015933 CTGGGAGAGAAGAAGGACCAAGG - Intronic
1190439496 X:50463276-50463298 GAGGGAGAGAGGAAGGAGGATGG - Intronic
1190515892 X:51223274-51223296 AAAGGAGGGAAGAAAGAGGAGGG - Intergenic
1190650162 X:52561791-52561813 AGGAGAGAGAAGAATGATCAAGG - Intergenic
1190753551 X:53381888-53381910 AAAGGGGAGGAGAATGAGGAAGG + Intronic
1191054341 X:56227038-56227060 AAGGGAGAGAATAAAGAGGGTGG - Intergenic
1191108379 X:56786596-56786618 AGGAGAAAGAAGAAGGAGGAGGG - Intergenic
1191730094 X:64324385-64324407 AGAGAAGAGAAGAAAGAGGACGG + Intronic
1191759250 X:64628986-64629008 ATGGGAGAGTTGAATTGGGATGG - Intergenic
1191779011 X:64847032-64847054 ATGGGAATGAAGAATGTGGTAGG - Intergenic
1192069679 X:67923632-67923654 AGGGGAGAGAAGAGTGGGAAAGG + Intergenic
1192140170 X:68640099-68640121 ATGGGAAACTAGAATGAGAAAGG - Intergenic
1192143953 X:68668206-68668228 AAGAGAAAGAAGAAGGAGGAGGG - Intronic
1192317208 X:70062351-70062373 AAGGCAGAGAAGAATGCGAATGG + Intergenic
1192855908 X:75011714-75011736 ATGGGAGGGAAGAGTGGGAAGGG - Intergenic
1192929985 X:75796333-75796355 AAAGGAGAGAAGAATGAGACAGG - Intergenic
1193664650 X:84300504-84300526 AGGGGAGGGAAGCATGGGGAAGG + Intergenic
1194087952 X:89552256-89552278 AAGAGAGAGAAGAGTGAGCAAGG + Intergenic
1194092657 X:89598320-89598342 ATGGTATAGAAGAATATGGAAGG - Intergenic
1194375082 X:93122454-93122476 AAGGGAGAGTAGAGTGAGTAGGG - Intergenic
1195004823 X:100675530-100675552 ATTGGAGAGGAGAAAGAGGAAGG + Exonic
1195457888 X:105090016-105090038 ATGGGAGAGAGTAAGGAAGAGGG + Intronic
1196005886 X:110836761-110836783 ATGAAAAAGAGGAATGAGGAGGG + Intergenic
1196181102 X:112690491-112690513 GAGGAAGAGAAGAAGGAGGAGGG + Intergenic
1196634816 X:117990259-117990281 TTATGATAGAAGAATGAGGATGG + Intronic
1197144876 X:123160232-123160254 GAGGGAGAGAAGAATGAAGAAGG + Intergenic
1197622662 X:128768223-128768245 ATGAGAAAGAAGAATAAGCATGG + Intergenic
1198383422 X:136105258-136105280 GAGGGAGGGAAGAAAGAGGAGGG + Intergenic
1198383427 X:136105276-136105298 GAGGGAGGGAAGAAAGAGGAGGG + Intergenic
1198409409 X:136350519-136350541 AAGGCAGAAAAGAATGAAGAAGG + Intronic
1198478858 X:137022432-137022454 ATGGGAGATTGGAATGAGGAGGG + Intergenic
1198676995 X:139141637-139141659 CTGGGATGGAAGAATGTGGAGGG - Intronic
1199347140 X:146754802-146754824 ATGGGAGAGGAGAATCTGGGAGG + Intergenic
1199767920 X:150954059-150954081 CTGGCAGTGAAGAATGGGGAAGG - Intergenic
1199907737 X:152251565-152251587 ATGGAAGAGAAGCAAGAGGAAGG - Intronic
1200322530 X:155204546-155204568 ATGCAAGAAAAGAATGTGGATGG - Intronic
1200440668 Y:3208545-3208567 AAGAGAGAGAAGAGTGAGCAAGG - Intergenic
1200788524 Y:7279616-7279638 ATTGGAGAGAGGAGAGAGGAGGG + Intergenic
1201412532 Y:13714876-13714898 ATGGGAGAGAAGAGTTTAGAAGG - Intergenic
1201794365 Y:17879012-17879034 ATTGTAGTGAAGAAAGAGGATGG - Exonic
1201807189 Y:18026973-18026995 ATTGTAGTGAAGAAAGAGGATGG + Exonic
1201897177 Y:19004376-19004398 CTGGGAAAGCAGAGTGAGGAGGG + Intergenic
1202234144 Y:22690690-22690712 AAGGGAGAGAGGAAGGAAGAAGG + Intergenic
1202309014 Y:23505476-23505498 AAGGGAGAGAGGAAGGAAGAAGG - Intergenic
1202355742 Y:24046811-24046833 ATTGTAGTGAAGAAAGAGGATGG - Exonic
1202515036 Y:25623298-25623320 ATTGTAGTGAAGAAAGAGGATGG + Exonic
1202561786 Y:26165112-26165134 AAGGGAGAGAGGAAGGAAGAAGG + Intergenic