ID: 1092736788

View in Genome Browser
Species Human (GRCh38)
Location 12:11590339-11590361
Sequence TTGCTTATGAATAAACAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 242}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092736785_1092736788 -5 Left 1092736785 12:11590321-11590343 CCCAAGAAGGCGAAATATTTGCT 0: 1
1: 0
2: 3
3: 13
4: 892
Right 1092736788 12:11590339-11590361 TTGCTTATGAATAAACAGGAAGG 0: 1
1: 0
2: 0
3: 21
4: 242
1092736786_1092736788 -6 Left 1092736786 12:11590322-11590344 CCAAGAAGGCGAAATATTTGCTT 0: 1
1: 0
2: 2
3: 23
4: 170
Right 1092736788 12:11590339-11590361 TTGCTTATGAATAAACAGGAAGG 0: 1
1: 0
2: 0
3: 21
4: 242

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092736788 Original CRISPR TTGCTTATGAATAAACAGGA AGG Intergenic
905211694 1:36378779-36378801 TCCCTTCTGAAAAAACAGGAAGG - Intronic
906301091 1:44682276-44682298 TGGCTCTTGAGTAAACAGGAAGG + Intronic
907091881 1:51732734-51732756 TTGTTTTTGGATAAAAAGGATGG - Intronic
907188182 1:52627613-52627635 TTACTTAGCAATAAAGAGGAAGG + Intergenic
908108877 1:60875011-60875033 TTGCTTAAGAATAAAGACTAGGG + Intronic
909752630 1:79181980-79182002 TTCTTTTTGAATAAACAGTATGG + Intergenic
912389735 1:109294663-109294685 TTACCTATAAATAAACCGGAGGG + Intronic
912895027 1:113577204-113577226 TTGCTTGTAACTAAACAGAAAGG + Intronic
915596314 1:156898277-156898299 TTCCTGATGAGTAAACAGGTCGG + Intronic
916393755 1:164362455-164362477 TTGCCTATGAATAAAAATGTCGG + Intergenic
917457064 1:175194003-175194025 TTTCTCCTGAATAAACAGAAAGG - Intergenic
917457201 1:175195117-175195139 TTCCTTATGAAAAAGCAGGTTGG + Intergenic
920224609 1:204429464-204429486 TTGCATATGGACAAATAGGAAGG + Intronic
922442347 1:225666355-225666377 TTGCTTAGGAATAAACACTTAGG + Intergenic
923231124 1:231987608-231987630 TTCCTTCTGAACAAACAAGAAGG + Intronic
1064531562 10:16315553-16315575 ATGCTAATGAATCAACAAGATGG - Intergenic
1065457305 10:25920664-25920686 TTGCTTCTGCATAAAAAGGTAGG - Intergenic
1065505240 10:26423907-26423929 TTGCTTATGCCAAAAAAGGAAGG - Intergenic
1066790782 10:39060747-39060769 TTTCTTATGATTCAACAGGGTGG - Intergenic
1066791869 10:39074097-39074119 TTTCTTTTGATTCAACAGGATGG + Intergenic
1067900727 10:50238707-50238729 TTCTTTAGGAATAAATAGGATGG - Intronic
1069146611 10:64900098-64900120 TTGTTTCTGAATAAAGAGGCAGG - Intergenic
1070405231 10:76088475-76088497 TTGGTTGCCAATAAACAGGAAGG + Intronic
1071007675 10:80901533-80901555 CTGCTTATGGATAAACATAATGG + Intergenic
1071049182 10:81425785-81425807 TTTCTTATGACAAAACAGAATGG - Intergenic
1073773241 10:106758492-106758514 TTGCTAATGAAAAAGCATGAGGG - Intronic
1075032325 10:119031897-119031919 TTGCTTATGGGTAAACTGGTGGG - Exonic
1081515106 11:43821099-43821121 CTGCTTATGATTAAACATCATGG - Intronic
1082013415 11:47466784-47466806 CTGCTTCTCAATACACAGGAAGG + Intronic
1086862491 11:91941377-91941399 TTGCTTGTGAATGAAGGGGAAGG - Intergenic
1087076403 11:94130203-94130225 GTGTTTATGAACCAACAGGAAGG + Intronic
1087535039 11:99432088-99432110 TTGCTTAGGAATAAAAGGGAAGG + Intronic
1088291815 11:108246964-108246986 GTGCTTATGAATCAACAAAATGG + Exonic
1090319255 11:125827862-125827884 TTGCTTATGGGTAAACAGAAGGG + Intergenic
1090905537 11:131071328-131071350 TTGCTAATGAATAAAGGAGAAGG + Intergenic
1091307250 11:134544138-134544160 TTCCCTGTGAAGAAACAGGAAGG + Intergenic
1092736788 12:11590339-11590361 TTGCTTATGAATAAACAGGAAGG + Intergenic
1093563275 12:20569763-20569785 TTGCTTATGAACAAATACGCAGG - Intronic
1093710037 12:22320012-22320034 TTGCTTAAGATGAAACAGAATGG + Intronic
1094049827 12:26206747-26206769 TTTCTCATGAATCAACAGGAGGG - Intronic
1094133415 12:27098887-27098909 TTCCTTATGAAAAATAAGGAAGG - Intergenic
1094236921 12:28178452-28178474 TTGCTTCTGCAAAAATAGGATGG + Intronic
1095667588 12:44820269-44820291 TGGCATCAGAATAAACAGGAGGG + Intronic
1096449222 12:51723174-51723196 TTGCTTTTAAATAAAAGGGAAGG - Intronic
1097244499 12:57599758-57599780 TTGCTTAAGAAGACACAGGCCGG + Intronic
1097296814 12:57974380-57974402 TTATTTATGTATAAAAAGGAAGG + Intergenic
1097429119 12:59481399-59481421 TTTCTTATTAATTAACAAGAAGG + Intergenic
1098443718 12:70545130-70545152 TTGCTGATGAATATAGAGTATGG + Intronic
1098886288 12:75963961-75963983 TTGGTTATCAACAAACAAGATGG + Intergenic
1099121533 12:78695635-78695657 TTGCATATGAATGAACAGTGGGG - Intergenic
1099762025 12:86935796-86935818 TTTCTTACTGATAAACAGGAAGG - Intergenic
1099947509 12:89261386-89261408 TTGCTTTTTAGTAAACAAGAGGG - Intergenic
1103257406 12:119553901-119553923 TTCCATATGAATGCACAGGAGGG + Intergenic
1104528449 12:129546912-129546934 TAGCTTATTAATAAACTGTATGG - Intronic
1105697961 13:22909214-22909236 TTGCTACTGAATCAACAGAAAGG + Intergenic
1109694699 13:65938988-65939010 TTACTTATGAATGAAAAGAAAGG - Intergenic
1110385870 13:74910018-74910040 TTGCTTATGATTAAATTTGAAGG - Intergenic
1110483289 13:76008448-76008470 AAGCTTATGATTAAAAAGGAGGG + Intergenic
1110485737 13:76039449-76039471 CTGCTTATGAATAAAAACAAAGG + Intergenic
1110925678 13:81148530-81148552 TTGCTTTCAAATAAACAGTAGGG - Intergenic
1111482426 13:88848501-88848523 TTGGCTATGAAGAAAAAGGAAGG + Intergenic
1111578214 13:90187076-90187098 TTTCTTATCAATAAATTGGAAGG - Intergenic
1112158263 13:96841219-96841241 TTGCTAATGCATAAAAAGTACGG - Intergenic
1113192487 13:107765667-107765689 TTTATTATAAATAAAAAGGATGG - Intronic
1114766303 14:25374457-25374479 ATGCTTATGAATTAATAGGGTGG - Intergenic
1115076444 14:29398009-29398031 TTACTCATCAATAAAAAGGAAGG - Intergenic
1116170507 14:41395712-41395734 TAGCTTAAGAAGAAACAGAAAGG - Intergenic
1116922238 14:50591046-50591068 TTCCTTATCAATAAACCTGATGG + Exonic
1117797243 14:59407023-59407045 ATGGTGATGAATAAAAAGGAAGG + Intergenic
1118581195 14:67300105-67300127 TTCCATATGTATAAACAGGACGG - Intronic
1118661791 14:68021918-68021940 TGGCTTCTGACTAAACAGGCTGG + Intronic
1118686230 14:68294122-68294144 TTGCTTAAGATAAACCAGGAAGG - Intronic
1121861114 14:97319567-97319589 TTACTTATGAATAAAGAAGTAGG - Intergenic
1122368876 14:101216419-101216441 TTTTTTGTTAATAAACAGGAAGG + Intergenic
1131858917 15:96630413-96630435 TTGCTTATGAATCTTCAGAATGG - Intergenic
1133080302 16:3313516-3313538 TTGCTAATGAATTAACAGTGGGG - Intronic
1133080538 16:3315531-3315553 TTGCTAATGAATTAACAGTGGGG - Intronic
1133420844 16:5645495-5645517 ATGCTTATGAATATACTGAATGG + Intergenic
1135569434 16:23537009-23537031 TTGCACATGAGTGAACAGGAGGG + Intronic
1137072791 16:35920830-35920852 TTTCTTTTGATTAAACAGGTTGG - Intergenic
1137073409 16:35930558-35930580 TTGCTTTTGATTAATCAGGTTGG - Intergenic
1139085221 16:63576623-63576645 TCCCTTATAAATAAAAAGGATGG + Intergenic
1141261175 16:82455016-82455038 GTGCTTATAACTGAACAGGATGG + Intergenic
1141409509 16:83822884-83822906 TTGCTTATGAAAAAAAAAAAAGG - Intergenic
1142715873 17:1746726-1746748 TTGCATAAGAATCACCAGGAGGG - Intronic
1144419286 17:15081336-15081358 TTCTTTATGAAGAAAAAGGACGG - Intergenic
1146218993 17:31002191-31002213 TTCCTTATGCATCAACAGGAAGG - Intergenic
1146621901 17:34405135-34405157 ATGCTCATGAATAAACAGAGAGG - Intergenic
1149553112 17:57554728-57554750 TTTCTGATGAAGAAACAGAAGGG + Intronic
1150093403 17:62350654-62350676 TTCCTTAGGAATTAAGAGGATGG - Intergenic
1150495814 17:65607132-65607154 GTTCTTAGGAATACACAGGAAGG - Intronic
1153446436 18:5178187-5178209 ATGCATATCAATAAGCAGGAGGG - Intronic
1155494063 18:26425634-26425656 TTTCTTATGAAAAAAAAGGGGGG - Intergenic
1155608681 18:27637385-27637407 TTGTTTTTGAATAAGAAGGAGGG - Intergenic
1156043235 18:32847889-32847911 TTGCTTAAGGATAAACAGGTTGG - Intergenic
1162142550 19:8593286-8593308 CTGCTGAGGAATGAACAGGAAGG + Intronic
1162220955 19:9175854-9175876 TTGCTTCTTAATACAAAGGATGG - Intergenic
1164335583 19:24316214-24316236 ATACTTCTGAATAAAAAGGAAGG - Intergenic
1164802934 19:31092683-31092705 TGGCTCTTGAATATACAGGAAGG + Intergenic
1167931743 19:52871539-52871561 TTGCTCAGGAATATACAAGATGG - Intronic
1167932508 19:52877666-52877688 TTGTTTAGGAATAAAATGGAAGG + Exonic
1167996993 19:53413893-53413915 TTGTTTAAGAATAAAATGGAAGG - Intronic
926457656 2:13087904-13087926 CTGCTTAGGAACAAAAAGGAAGG - Intergenic
926494851 2:13573454-13573476 TTGCATTTCAATAAAAAGGAAGG - Intergenic
926534478 2:14093738-14093760 TTGCTGAAGAATACACAGGTAGG - Intergenic
926548811 2:14275791-14275813 TTGTTTATAAATAAGCTGGAGGG + Intergenic
927338954 2:21958578-21958600 TTGCTTATAAAGAAAAAAGATGG + Intergenic
928072190 2:28227923-28227945 TTGCTTAAGAATAATCTGGAGGG - Intronic
929781795 2:44961782-44961804 ATTCTTATGAATAGGCAGGATGG + Intergenic
933123312 2:78570906-78570928 ATGCATTTGAATAAACAGCAAGG - Intergenic
937839327 2:126509924-126509946 TTGCTTAGGAGCAAACAGAAAGG - Intergenic
938764725 2:134453148-134453170 TTATTTTTGAATCAACAGGAAGG - Exonic
940415693 2:153417411-153417433 TAGGTTAAGAATAAACAGTAGGG + Intergenic
941754053 2:169165646-169165668 TTTCTTATGAGAAAAGAGGAGGG + Intronic
942165252 2:173234913-173234935 TGGGTTTTGAAAAAACAGGAGGG + Intronic
943184439 2:184588457-184588479 TTGTTTATGAATACAGAGGCAGG + Intergenic
946818421 2:223605092-223605114 TTGATTTTGAAAAAACAGGCTGG - Intergenic
947453974 2:230236173-230236195 TTGATTAAGAATACACAAGAAGG - Intronic
1169269797 20:4190414-4190436 GTGCTTTTGTATAAAAAGGAGGG - Intergenic
1170945578 20:20888194-20888216 TTCCTACTGAAGAAACAGGAGGG - Intergenic
1174218051 20:48932298-48932320 TTGGTTGTGAGTAAAGAGGACGG + Intronic
1174913002 20:54626564-54626586 TTGCTAATAAAGAGACAGGAGGG - Intronic
1176195535 20:63835092-63835114 TGGCTGGTGAATAAACAGGCAGG - Intergenic
1176629452 21:9123430-9123452 GGACTTATGAATAACCAGGATGG + Intergenic
1177384798 21:20394812-20394834 CTGCTTTTGAACAAACAGGGTGG - Intergenic
1177575863 21:22955066-22955088 TTGTTTATAAATAAATAGTAAGG + Intergenic
1178104334 21:29300742-29300764 TTGGTTATGAGTACACAGAAGGG + Intronic
1182389760 22:29983214-29983236 CTGCTTATGTATAAACTGCAGGG - Intronic
1184061612 22:42085940-42085962 TTGCATGTCAGTAAACAGGAAGG - Exonic
1184103971 22:42356824-42356846 TTGCTGATGAAGAAACAGAGAGG + Intergenic
950271784 3:11622240-11622262 TGGCTTATCAAGAAACCGGATGG - Intronic
951664824 3:25111138-25111160 TTGCATCTGAAAAAACAAGATGG - Intergenic
953349621 3:42205613-42205635 TTGGTTATGATTAAGCAGAAAGG - Intronic
956188351 3:66583795-66583817 GTGATCATGAATAAACAGAATGG - Intergenic
956660165 3:71589535-71589557 TTCTTTCTGAATAAACATGAAGG + Intergenic
956889692 3:73600043-73600065 TTTCTTATAAAAAAACAGGGAGG + Intronic
957025080 3:75172618-75172640 TTGCTTAGTAATTAACTGGATGG + Intergenic
957119756 3:76074581-76074603 TTGATTATGAGTAAAAAGAAAGG + Intronic
957400318 3:79703777-79703799 TTGCTTATAATTAAACTAGATGG + Intronic
959358742 3:105365271-105365293 CATCTTATGAATCAACAGGAAGG - Intergenic
960201227 3:114839067-114839089 TTGCTAATGTATATACAGGGAGG - Intronic
960448061 3:117772348-117772370 TGGCTTATGAATAAAAAGAAAGG + Intergenic
960634014 3:119765704-119765726 ATGCTTGTCAATACACAGGATGG - Exonic
961337336 3:126188974-126188996 TTGCATATGAATAAATACGTCGG - Intronic
961338565 3:126201191-126201213 TTATTTATTAATAAAAAGGAAGG + Intergenic
961716874 3:128863921-128863943 TTGCTTAAGATCACACAGGAAGG + Intergenic
963555881 3:146787828-146787850 TTTCTAATGAATATACTGGAAGG + Intergenic
964103309 3:153013136-153013158 TTGTGCATGAATAAACAGAAAGG + Intergenic
964137618 3:153362632-153362654 TTGCTTATGACTACATAGCAAGG + Intergenic
964773690 3:160252774-160252796 TTACTTAGGAATAAAATGGAAGG + Intronic
967420308 3:189265143-189265165 TTGTATATGAATAAGGAGGAAGG + Intronic
970947541 4:21712832-21712854 ATGCTTAGAAATAAAAAGGAGGG - Intronic
970973184 4:22009705-22009727 GTGCTTATGTATAAACATGTAGG - Intergenic
971511453 4:27430313-27430335 TAGCATATGAATGGACAGGAAGG + Intergenic
971893718 4:32561861-32561883 TTGCTTTTGAAATAACAGCAGGG + Intergenic
974060202 4:57026374-57026396 TTGCTTAAAAATAATCAAGAGGG - Intronic
974186718 4:58456718-58456740 TTACATGTGAATAAGCAGGAGGG - Intergenic
974613150 4:64242625-64242647 TTGCTTGTCAATATACAGGGAGG - Intergenic
975112337 4:70642059-70642081 TTTCTTCTGAATAATAAGGAGGG - Exonic
976912698 4:90326968-90326990 TTGCTTATGAAAAATGAAGATGG - Intronic
977133506 4:93271656-93271678 TTGCTTAAAAATACACAGAAAGG + Intronic
977810580 4:101350610-101350632 CTGCTTATCAAGAAATAGGAGGG + Intergenic
979511074 4:121554348-121554370 TTGCTGCTCAATAAACAGAAGGG + Intergenic
979529778 4:121757532-121757554 TTGCTTATCATGAAACATGAGGG + Intergenic
979805293 4:124962655-124962677 TTGCATATGAATAAGCATGTAGG + Intergenic
980298587 4:130957571-130957593 ATGCTTCTGAGGAAACAGGACGG + Intergenic
982041992 4:151406611-151406633 TGGGTTAAGAATAAACAGTAGGG - Intergenic
982434002 4:155360649-155360671 TAGCATATTAATAAACAGAATGG + Intronic
983616724 4:169714200-169714222 TGGATTATGCATAAACTGGATGG + Intronic
984157995 4:176215344-176215366 TTTTTCCTGAATAAACAGGAGGG + Exonic
984414160 4:179435588-179435610 TTGCCTCTGAATACACTGGATGG - Intergenic
988019247 5:25602335-25602357 TTTCTTATGCATACACATGAAGG - Intergenic
988933193 5:36057177-36057199 TTGCAAATAAATAAACAGTATGG + Intronic
990540868 5:56771313-56771335 TTTCTTATGAATAAAGATAAGGG + Intergenic
991111051 5:62899893-62899915 TTGCTCAGGAATGAAGAGGATGG + Intergenic
992447519 5:76847198-76847220 TTGCTTCAGAATAAACGGGATGG - Intergenic
993547748 5:89233337-89233359 TTGCAAAAGAATAAACACGAAGG - Intergenic
993612357 5:90070989-90071011 TTCATTTTGAATAAACAGAAGGG + Intergenic
994305544 5:98199636-98199658 TTGCAAATGAATTAACAGTAAGG + Intergenic
995424722 5:112007695-112007717 TTGTTTTTTAATAAAGAGGAAGG + Intergenic
996642922 5:125778797-125778819 TTGCTTTTGATAAAAAAGGAAGG - Intergenic
997095691 5:130908442-130908464 TTGCTGATGAATAAAACTGATGG + Intergenic
998397205 5:141826372-141826394 TTGCTTGCAAATAAACAGGAGGG - Intergenic
998744751 5:145245670-145245692 TTTCTTTTGAATCAACAGGAAGG - Intergenic
999410344 5:151344883-151344905 TGACTTCTGAATAAACAGGTCGG + Intronic
1000451201 5:161389841-161389863 TTCTTAATGAGTAAACAGGATGG + Intronic
1003320129 6:5043914-5043936 TTCCTTGGGAAGAAACAGGAAGG - Intergenic
1007541908 6:42654157-42654179 ATGCTTATAGATAAATAGGAGGG - Intronic
1008557215 6:52685073-52685095 TTGTGTATAAAAAAACAGGAAGG + Intronic
1010275584 6:73965192-73965214 TTGCATGAGAAGAAACAGGATGG + Intergenic
1012147593 6:95705022-95705044 TTGCTTATTCATGAATAGGAAGG - Intergenic
1012424719 6:99101250-99101272 ATGATTCTGGATAAACAGGAAGG + Intergenic
1013640174 6:112067517-112067539 TTACATATGAAAAAACAGAATGG - Intronic
1013880402 6:114892474-114892496 CTGCTTATGTATAAAATGGATGG - Intergenic
1014994870 6:128130128-128130150 TTGCTTAAGTCTAAACAGTAAGG + Intronic
1016020385 6:139230748-139230770 TGGCTTCTGAACAAACAGGCAGG - Intergenic
1017618468 6:156270277-156270299 TGACTTAAGAATAAACAGTAGGG - Intergenic
1018701823 6:166433262-166433284 TTGCATATGTCTAAACAGCAAGG - Intronic
1019077842 6:169404501-169404523 TTGTTTATGAATAAATAAAAAGG - Intergenic
1020331456 7:7021382-7021404 TGGCTGATGAAAAAAGAGGAGGG - Intergenic
1021633674 7:22670386-22670408 GTGCTTATGAATAATCATGAAGG + Intergenic
1022334610 7:29410685-29410707 TTGTTTTTGAAGAAACTGGAGGG + Intronic
1023662086 7:42480247-42480269 TTGCTTGGGAATGATCAGGAAGG - Intergenic
1024779517 7:52831169-52831191 TTTCTTATGAATCAACATTATGG + Intergenic
1027593853 7:80147726-80147748 TTACTTATCACTAAACATGAAGG - Intronic
1028052097 7:86201574-86201596 TTTCTTATGTATAAACAGTATGG - Intergenic
1028715998 7:93969495-93969517 GTGGATATGAATAATCAGGAAGG + Intronic
1028728727 7:94120422-94120444 TTGCTTATAAATAAATAGCAGGG + Intergenic
1028789709 7:94840170-94840192 TGACATACGAATAAACAGGAAGG - Intergenic
1029211006 7:98908390-98908412 TTGCTCAAAAATAAATAGGACGG - Intronic
1029353592 7:100033247-100033269 TTTCTTTTGAATATACAGGTGGG - Intronic
1031155664 7:118108464-118108486 ATTCTTATGCATAAACAGCATGG + Intergenic
1031160547 7:118162246-118162268 TTGCTTAGGAACAAAAAGAAAGG + Intergenic
1031167789 7:118250874-118250896 TTGCTTATGAATCAAAAACACGG - Intergenic
1032621172 7:133534467-133534489 TTGCTGATTAGTAAAGAGGATGG + Intronic
1032863950 7:135907311-135907333 TAGCATCTGAAGAAACAGGAGGG - Intergenic
1033309816 7:140252977-140252999 TCACCCATGAATAAACAGGAAGG + Intergenic
1033556677 7:142494164-142494186 TTTCTAATGAACAAATAGGAAGG + Intergenic
1035592765 8:829445-829467 TTACTTATAAATAAACACGATGG - Intergenic
1036421258 8:8598012-8598034 TGGCTTTTTAATATACAGGATGG - Intergenic
1036975026 8:13401227-13401249 TTGTTTATCATTAAACAGGAAGG - Intronic
1037244598 8:16818562-16818584 TTGCTTAAGAATAAAGATAATGG + Intergenic
1037676884 8:21058857-21058879 TTCCTTATTGATAAACAGAAGGG - Intergenic
1038277242 8:26131911-26131933 TTTCTTCTGAATAAAAAGGCAGG - Intergenic
1038823507 8:30975718-30975740 TAGCTTCTTAATAAATAGGAGGG + Intergenic
1038884712 8:31650464-31650486 TGGCATATGTAAAAACAGGAGGG - Intronic
1039131682 8:34272061-34272083 TTGGTTAGGAATAAATAGGAAGG + Intergenic
1040112607 8:43575362-43575384 TTTCTTTTGATTAAACAGGTTGG + Intergenic
1040327398 8:46358344-46358366 TTGCTTTTGATTCAGCAGGATGG - Intergenic
1041760207 8:61358012-61358034 TTTCTTATGTATAAAGATGAAGG + Intronic
1041767757 8:61437042-61437064 TAGTTTATAAATAAACAGTAGGG + Intronic
1043920328 8:85975207-85975229 TTTTTTTTTAATAAACAGGAGGG - Intergenic
1044477367 8:92644038-92644060 TTGCTTATGCATAAGCACCAGGG + Intergenic
1045299857 8:100901690-100901712 TAGCTTATGAACAGAGAGGAGGG - Intergenic
1045498339 8:102726919-102726941 TTGCATTTGAAAACACAGGAGGG + Intergenic
1047677979 8:127223792-127223814 TTGCTGATGAGTAAAGTGGAGGG - Intergenic
1047680692 8:127251433-127251455 TTGCTCAAGATTACACAGGAAGG + Intergenic
1047976387 8:130134700-130134722 CTGCTTTTGAATAAACAGTGAGG + Intronic
1050496469 9:6247511-6247533 TTTCTTGTGAGTAAATAGGAAGG - Intronic
1050545803 9:6707736-6707758 TTGCTTATGGATAGGCAGCAAGG - Intergenic
1050837036 9:10095490-10095512 TTGATTATGAGTAATCAGAAGGG - Intronic
1051808628 9:21025228-21025250 TTGCTTATTAAGTAACAGTAGGG - Intronic
1055507987 9:76967238-76967260 TTGGCTATAAATGAACAGGAGGG + Intergenic
1056529670 9:87476139-87476161 TTGCTCATGTTTATACAGGAAGG + Intergenic
1056942306 9:90966035-90966057 TTGCATATGGAAAATCAGGAAGG + Intergenic
1057050525 9:91920204-91920226 GTGCTTAAGAATAAACACGATGG + Intronic
1058380814 9:104375233-104375255 TTGCTTATGAAAAAAAAAGTTGG - Intergenic
1058607899 9:106743230-106743252 TTTCTTTTGAATAATCAGGATGG - Intergenic
1186013177 X:5160883-5160905 TTGCATATTGATACACAGGAGGG - Intergenic
1186152810 X:6693051-6693073 TTTATTATGAATAGAAAGGAAGG + Intergenic
1186709221 X:12175162-12175184 TTTCTGATGAAAAAACAAGATGG + Intronic
1188226691 X:27608477-27608499 TTTCTTTTGAATACACATGATGG + Intronic
1189990440 X:46588946-46588968 TGACTTAGGAATAAACAGAAGGG + Intronic
1194423507 X:93707271-93707293 CTGCCTATAAATAAAGAGGAAGG + Intronic
1194541792 X:95182175-95182197 TTTTTTATGAATAAAGAGGCTGG + Intergenic
1194751016 X:97683946-97683968 TAGCTTAGGAAAAAAAAGGAGGG + Intergenic
1196076489 X:111583270-111583292 TAGCAGATGAATAAACAGGAAGG + Intergenic
1197332208 X:125167559-125167581 ATGTTTATGAATTAACAAGAAGG - Intergenic
1198384324 X:136114106-136114128 TTACTTATTAATTAACAGGAAGG + Intergenic
1199224794 X:145359834-145359856 TTGATTTTTAATAAAAAGGAAGG + Intergenic
1199726755 X:150590715-150590737 TGGCCCATGAATAAACAGGGTGG + Intronic
1199769965 X:150969060-150969082 GTGCTTAGAAATAAAGAGGAGGG + Intergenic
1199803620 X:151275487-151275509 TTGCTTCTTAATAAAGAGGCCGG + Intergenic
1199827277 X:151513004-151513026 TTGCTTAGGAACAAAAAGAAAGG + Intergenic