ID: 1092737731

View in Genome Browser
Species Human (GRCh38)
Location 12:11599122-11599144
Sequence GTGTCCAACTCAGGGTCAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092737731_1092737739 27 Left 1092737731 12:11599122-11599144 CCACTTGACCCTGAGTTGGACAC No data
Right 1092737739 12:11599172-11599194 AGCCGTGTCCAACACACTGTAGG No data
1092737731_1092737736 2 Left 1092737731 12:11599122-11599144 CCACTTGACCCTGAGTTGGACAC No data
Right 1092737736 12:11599147-11599169 GATGGTGTCCATCCTGTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092737731 Original CRISPR GTGTCCAACTCAGGGTCAAG TGG (reversed) Intergenic
No off target data available for this crispr