ID: 1092737852

View in Genome Browser
Species Human (GRCh38)
Location 12:11600302-11600324
Sequence AAAATGACTTCAATTCCCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092737852_1092737853 -3 Left 1092737852 12:11600302-11600324 CCTTTGGGAATTGAAGTCATTTT No data
Right 1092737853 12:11600322-11600344 TTTAGATCTGCTGTCTTAACAGG No data
1092737852_1092737854 9 Left 1092737852 12:11600302-11600324 CCTTTGGGAATTGAAGTCATTTT No data
Right 1092737854 12:11600334-11600356 GTCTTAACAGGAAATACAAGTGG No data
1092737852_1092737855 18 Left 1092737852 12:11600302-11600324 CCTTTGGGAATTGAAGTCATTTT No data
Right 1092737855 12:11600343-11600365 GGAAATACAAGTGGACAGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092737852 Original CRISPR AAAATGACTTCAATTCCCAA AGG (reversed) Intergenic
No off target data available for this crispr