ID: 1092738593

View in Genome Browser
Species Human (GRCh38)
Location 12:11607292-11607314
Sequence TCCTTGGATGGCTGACTCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092738593_1092738602 18 Left 1092738593 12:11607292-11607314 CCCCAGAGTCAGCCATCCAAGGA No data
Right 1092738602 12:11607333-11607355 GACACTGGTGATAAGGGTCTGGG No data
1092738593_1092738601 17 Left 1092738593 12:11607292-11607314 CCCCAGAGTCAGCCATCCAAGGA No data
Right 1092738601 12:11607332-11607354 AGACACTGGTGATAAGGGTCTGG No data
1092738593_1092738598 3 Left 1092738593 12:11607292-11607314 CCCCAGAGTCAGCCATCCAAGGA No data
Right 1092738598 12:11607318-11607340 CACACACACTCTGCAGACACTGG No data
1092738593_1092738599 11 Left 1092738593 12:11607292-11607314 CCCCAGAGTCAGCCATCCAAGGA No data
Right 1092738599 12:11607326-11607348 CTCTGCAGACACTGGTGATAAGG No data
1092738593_1092738600 12 Left 1092738593 12:11607292-11607314 CCCCAGAGTCAGCCATCCAAGGA No data
Right 1092738600 12:11607327-11607349 TCTGCAGACACTGGTGATAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092738593 Original CRISPR TCCTTGGATGGCTGACTCTG GGG (reversed) Intergenic
No off target data available for this crispr