ID: 1092740338

View in Genome Browser
Species Human (GRCh38)
Location 12:11622529-11622551
Sequence GGTACCAGGCCAATATTTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092740338_1092740346 18 Left 1092740338 12:11622529-11622551 CCTTGAAATATTGGCCTGGTACC No data
Right 1092740346 12:11622570-11622592 ACCTAACAGGTGAGTAAAAAAGG No data
1092740338_1092740348 29 Left 1092740338 12:11622529-11622551 CCTTGAAATATTGGCCTGGTACC No data
Right 1092740348 12:11622581-11622603 GAGTAAAAAAGGTCACTTCTTGG No data
1092740338_1092740343 5 Left 1092740338 12:11622529-11622551 CCTTGAAATATTGGCCTGGTACC No data
Right 1092740343 12:11622557-11622579 AACAGGGTTCCCAACCTAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092740338 Original CRISPR GGTACCAGGCCAATATTTCA AGG (reversed) Intergenic
No off target data available for this crispr