ID: 1092745569

View in Genome Browser
Species Human (GRCh38)
Location 12:11669334-11669356
Sequence CAGGAGGACGGGAGGAAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3162
Summary {0: 1, 1: 0, 2: 19, 3: 367, 4: 2775}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092745569 Original CRISPR CAGGAGGACGGGAGGAAAGG AGG (reversed) Intronic
Too many off-targets to display for this crispr