ID: 1092745873

View in Genome Browser
Species Human (GRCh38)
Location 12:11672078-11672100
Sequence CTTGTCACCTGCACTCCAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 147}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092745873 Original CRISPR CTTGTCACCTGCACTCCAGT GGG Intronic
905117924 1:35658649-35658671 GCTGTGATCTGCACTCCAGTTGG + Intergenic
905951941 1:41959231-41959253 CTTGTCACCATCAAGCCAGTTGG - Intronic
907722220 1:56982754-56982776 ATTTTCACCTGCAATCCACTTGG - Intergenic
908326560 1:63029110-63029132 CTGCTCACCTGCACCCCAGCTGG - Intergenic
909293330 1:73912386-73912408 CTTGTCTTCTGCACACCAGCAGG + Intergenic
912413305 1:109492198-109492220 CCTGTCACCTGCACACCTGGAGG - Intronic
913055682 1:115157134-115157156 TTTGTAACCTGCAATCCAGCAGG + Intergenic
915262406 1:154686635-154686657 CTTGTCTTCTGAACTCCAGATGG + Intergenic
919309128 1:195884481-195884503 CTATTCATTTGCACTCCAGTGGG + Intergenic
919805019 1:201376431-201376453 CTTGTCCCCAGCACTCGAATGGG + Intronic
922569096 1:226622688-226622710 TTGGTAACCTGCACTCCAGTTGG + Intergenic
922569099 1:226622707-226622729 TTGGTAACCTGCACTCCAGTTGG + Intergenic
922569102 1:226622726-226622748 TTGGTAACCTGCACTCCAGTTGG + Intergenic
922569105 1:226622745-226622767 TTGGTAACCTGCACTCCAGTTGG + Intergenic
922569108 1:226622764-226622786 TTGGTAACCTGCACTCCAGTTGG + Intergenic
922569111 1:226622783-226622805 TTGGTAACCTGCACTCCAGTTGG + Intergenic
922569114 1:226622802-226622824 TTGGTAACCTGCACTCCAGTTGG + Intergenic
923009636 1:230078056-230078078 ATTGTGAGCTGCATTCCAGTCGG + Intronic
924394760 1:243606982-243607004 CTTGTCTTCTGCACACCAGCAGG - Intronic
924556381 1:245122500-245122522 CATGCCACCTGCATTCCAGCTGG - Intronic
1064733967 10:18361655-18361677 CATGCCACTTGCACTCCAGCCGG - Intronic
1066140255 10:32498296-32498318 ATGGTCTCCTGCACACCAGTGGG + Intronic
1066543058 10:36469942-36469964 CTGGTCACCAGGACTACAGTGGG + Intergenic
1074596399 10:114871765-114871787 ATTGTCACCTGCACCCCATCAGG + Intronic
1077831915 11:5882061-5882083 CTTTTCAGATGGACTCCAGTAGG + Intronic
1080840234 11:35977222-35977244 CATGTCATCTGAATTCCAGTTGG + Intronic
1085049562 11:73373236-73373258 CTTGACACCTCCACCCCAGTGGG + Intergenic
1086942668 11:92814702-92814724 CTTGTCCCCTACACTCCAACAGG - Intronic
1088075657 11:105845436-105845458 CTTGACCCCTGCAGTTCAGTGGG + Intronic
1088830425 11:113531998-113532020 CTTCTCAACTGCCCTCTAGTAGG - Intergenic
1088843289 11:113644377-113644399 CTTGGCATCTCCACTTCAGTAGG + Intergenic
1089094107 11:115904136-115904158 CATGTCACCTTCTCTGCAGTTGG - Intergenic
1090447551 11:126776874-126776896 CCGGTCTCCTGCACTCCATTTGG - Intronic
1090458168 11:126867310-126867332 CTCATTACCTGCACTCCAATGGG + Intronic
1092745873 12:11672078-11672100 CTTGTCACCTGCACTCCAGTGGG + Intronic
1099498458 12:83381233-83381255 CGTGCCACTTGCACTCCAGCTGG - Intergenic
1100130504 12:91487287-91487309 CATCCCACCTGCACTCCTGTGGG - Intergenic
1101288095 12:103337273-103337295 CTTGTCCCCAGAACTCCAGTGGG - Intronic
1101781756 12:107844178-107844200 GTCGTCACCTGCACTCCAGGCGG + Intergenic
1108783295 13:53863848-53863870 TTTGTCTCCTTCACTCCATTGGG + Intergenic
1111082085 13:83323745-83323767 GTTGTCAACTGTACTCCTGTGGG + Intergenic
1115845966 14:37534827-37534849 ATTGTCCCCTGGATTCCAGTTGG - Intronic
1124654829 15:31499651-31499673 CATGGCACCTGCCCTGCAGTGGG + Intronic
1128373107 15:67055182-67055204 CTCTTCACCTGCCCTCCTGTAGG - Intergenic
1128527592 15:68423019-68423041 CTTTGCACATGCACTCCAGGAGG - Intronic
1128684550 15:69674164-69674186 CTTTTCTCCTGTACTCCAGGAGG + Intergenic
1128717442 15:69918900-69918922 CAGGTCGCCTGCAATCCAGTGGG - Intergenic
1129824141 15:78623632-78623654 CTTTTCTCCTTCACTACAGTCGG - Intergenic
1131402181 15:92134047-92134069 CATGGGACCTGCACCCCAGTAGG + Intronic
1132904218 16:2273921-2273943 CTTTTCCCCTGCCCTCCCGTGGG + Intergenic
1146273135 17:31497612-31497634 CTTGTCATGTGCACCCCTGTAGG - Intronic
1147458639 17:40554423-40554445 CTTGGCCCCTTCACTCCAGCAGG + Exonic
1147617659 17:41839393-41839415 ATTGTCATCTGAAATCCAGTAGG - Intronic
1148326802 17:46788003-46788025 CTGGTCACCTGCACTGAGGTGGG - Intronic
1148756198 17:49974173-49974195 CTGGACACCTTCACTCCAGCTGG + Exonic
1149734183 17:58976721-58976743 CTTTTCACCTGCTCTACTGTTGG - Intronic
1151980416 17:77505190-77505212 CTTGTCACCTGGGCTGCAGTTGG + Intergenic
1152438676 17:80291858-80291880 ATTGGCACCTGCACTCCGGAGGG - Intronic
1153926935 18:9842655-9842677 ACTGTCACATGCACTGCAGTTGG - Intronic
1155065677 18:22266997-22267019 ACTGTCACCTTCACTCCAGAAGG - Intergenic
1155303144 18:24451789-24451811 CTTTCCATCTGCACTCCAGACGG + Exonic
1156261559 18:35449084-35449106 TCTGTCACCTGCACTCCTGAAGG - Intronic
1160990505 19:1858461-1858483 CTGCACCCCTGCACTCCAGTGGG + Intronic
1163366769 19:16879856-16879878 CCTGGCCCCTGCACACCAGTAGG + Exonic
1163861560 19:19745769-19745791 CCTGTCTGCTGCGCTCCAGTGGG - Intergenic
1164720712 19:30429905-30429927 CTTGTCACCTGCAAAGCATTGGG + Intronic
1165391329 19:35540637-35540659 CCAGCCACCTGCACTCCAGCAGG + Intronic
924975956 2:175550-175572 CTTGTCACCTGCACAGCTGGAGG + Intergenic
925359640 2:3268350-3268372 CTCCCCACCTGCACTCCAGAGGG + Intronic
926183207 2:10664583-10664605 ATTGTGCCCTGCACTCCAGCTGG - Intronic
927202799 2:20588948-20588970 CTTGTCTCATGATCTCCAGTGGG + Intronic
927356754 2:22182205-22182227 CTTGTAACCTGGTCCCCAGTGGG - Intergenic
929159102 2:38813813-38813835 TTTGTTACCTGCACTACATTTGG + Exonic
929178575 2:39008121-39008143 CTTCTCAGCTGCACTCAACTGGG - Intronic
933162422 2:79040159-79040181 TTTGTCTCCTGCAGTCCAGATGG - Intergenic
934963792 2:98702116-98702138 GTTCTCACCTGGAGTCCAGTGGG - Intronic
936087611 2:109479957-109479979 CATGTCACCTGCATACCACTGGG - Intronic
936143214 2:109959149-109959171 CATGTGACCTGGACTTCAGTAGG + Intergenic
936179903 2:110257115-110257137 CATGTGACCTGGACTTCAGTAGG + Intergenic
936201473 2:110412318-110412340 CATGTGACCTGGACTTCAGTAGG - Intronic
937761061 2:125604089-125604111 CTTGTCCTCTGCACACCAGCAGG - Intergenic
940252227 2:151691468-151691490 CTTGTCTCCTCCACTCCAGTGGG + Intronic
942318338 2:174714545-174714567 AATGTCACCTGCATTTCAGTGGG + Intergenic
942708474 2:178804130-178804152 CTGGACACCTGAACTTCAGTTGG - Intronic
946289421 2:218732686-218732708 TTTGTCACTTGCATTCCTGTAGG + Intronic
946965068 2:225028511-225028533 CTTCTCACCTACACTACGGTAGG + Intronic
947642609 2:231715373-231715395 CTTTTAACCTGGGCTCCAGTGGG - Intergenic
948243000 2:236454079-236454101 CTTATCACTTGCATTCCAGTGGG + Intronic
1169081230 20:2798758-2798780 CTTGTGACCCCCACTCCAGCAGG - Exonic
1170338206 20:15294575-15294597 CTTTTCACCTGTAATCCAGTGGG + Intronic
1170938547 20:20830055-20830077 CTTGTCTTCTGCACACCTGTAGG - Intergenic
1171816121 20:29787495-29787517 TCCCTCACCTGCACTCCAGTGGG - Intergenic
1173330858 20:42075332-42075354 CTTCTAACCTACCCTCCAGTTGG + Exonic
1174324812 20:49770769-49770791 CTTGAGACCTTAACTCCAGTTGG + Intergenic
1177206974 21:18021488-18021510 CTAGTCTACTTCACTCCAGTGGG - Intronic
1180319578 22:11308059-11308081 TCCCTCACCTGCACTCCAGTGGG - Intergenic
1182009433 22:26988002-26988024 CTTCTCAAATGCACACCAGTAGG - Intergenic
1182759177 22:32708345-32708367 CTTCTTGCCTGCACTCCAGGCGG + Intronic
1185094686 22:48799927-48799949 CTTGTCACCTAATCCCCAGTAGG - Intronic
949176829 3:1073635-1073657 CTTTTCACTTGCACTCCAGATGG + Intergenic
950707373 3:14791483-14791505 CCTGTCACCTCCAGTCCACTGGG + Intergenic
951202240 3:19888577-19888599 CTTGTCATCTAAACTCAAGTTGG + Exonic
953631044 3:44617933-44617955 CTTGTCACTTGCCCTCCAGTTGG - Intronic
955498502 3:59561397-59561419 CCTGTCTCCTGCACTGCATTAGG - Intergenic
957202888 3:77159808-77159830 CTTTTCAGCTGCACACAAGTAGG - Intronic
960319551 3:116217939-116217961 CTTTTCACCTGAACCACAGTGGG - Intronic
960729179 3:120706003-120706025 TTTGTCACCAAGACTCCAGTTGG + Exonic
961061228 3:123830982-123831004 CTGGTCACCTGCACTCTGTTTGG - Intronic
964489267 3:157217596-157217618 CTTGCCACCTGCACTCCAGGTGG + Intergenic
965173162 3:165294538-165294560 CTTTCCATCTGCACTCCAGTTGG + Intergenic
966650650 3:182297103-182297125 GTTGTCACCTGCAATCAAGAGGG - Intergenic
968753661 4:2403301-2403323 CTTGTCACTGCCACTCAAGTGGG + Intronic
969559795 4:7939703-7939725 CTGTTCAGCTGCGCTCCAGTCGG - Exonic
973571550 4:52244885-52244907 CATGCCACGTTCACTCCAGTTGG + Intergenic
973759049 4:54100541-54100563 CTTCGCACCTGCACTCCTCTCGG + Exonic
975998022 4:80339019-80339041 CCAGCCCCCTGCACTCCAGTTGG - Intronic
978300988 4:107269667-107269689 CTTGTCACCTGCAATGTGGTGGG + Intronic
980792049 4:137632575-137632597 CTTGGCCCCTCCAGTCCAGTAGG + Intergenic
981649519 4:147040006-147040028 CTTCTCTCCTGCACTCAACTTGG + Intergenic
981877550 4:149566151-149566173 CATTTCACCTGCATTCCACTTGG - Intergenic
982044117 4:151424674-151424696 CTTCTCAACTGTACTCAAGTTGG - Intronic
986198686 5:5561392-5561414 CTTCTCACCTTCTCCCCAGTGGG + Intergenic
987537766 5:19209482-19209504 CTTGTCACCTGCAATGTGGTGGG - Intergenic
989704645 5:44314204-44314226 CTTGTTCCTTGTACTCCAGTTGG - Intronic
989741120 5:44773505-44773527 CTAATCACATGCAGTCCAGTAGG + Intergenic
990766510 5:59189677-59189699 GTTGCCGCGTGCACTCCAGTGGG + Intronic
993267099 5:85740193-85740215 CTTGTCTTCTGCACACCTGTAGG + Intergenic
995933120 5:117474925-117474947 CCTTTGACCTGCACTCCACTGGG - Intergenic
997441153 5:133909393-133909415 CGTGGCAACTACACTCCAGTGGG + Intergenic
1000047932 5:157536738-157536760 CTGGACACTTGCACTCCAGCAGG + Intronic
1002441134 5:179265159-179265181 ACTGTCCCCTGCACTCGAGTTGG + Intronic
1002560084 5:180075485-180075507 CTTCTCCCCAGAACTCCAGTGGG + Intergenic
1006947648 6:37795809-37795831 CTTATCACTTACACTCCTGTGGG - Intergenic
1007304330 6:40892368-40892390 CTTTGCACCTGCACTTCTGTTGG - Intergenic
1009452465 6:63817788-63817810 CTTGCCGCCTGCCCTGCAGTTGG + Intronic
1013296542 6:108762696-108762718 CTTGTCATGGGAACTCCAGTGGG + Intergenic
1014539198 6:122653445-122653467 ATTGGCACCTGCAATCCTGTCGG - Intronic
1017874662 6:158514783-158514805 CCTGTGCACTGCACTCCAGTGGG + Intergenic
1018099933 6:160428369-160428391 CTGGTCACCTGCAGCCCAGGTGG - Intronic
1018203185 6:161413693-161413715 CTTCTCAGCTGGACTCCTGTGGG - Intronic
1019497210 7:1346246-1346268 CCTGTCCCCTGCACCCCAGTCGG + Intergenic
1023988945 7:45116573-45116595 CTATTCACCTTCCCTCCAGTTGG + Intergenic
1028198336 7:87933227-87933249 CTCACCACTTGCACTCCAGTTGG + Intergenic
1028447899 7:90945669-90945691 CTTGTCCCCTGGCCTCAAGTTGG - Intronic
1032919166 7:136526807-136526829 CATGTCACCTGCAGTGGAGTGGG + Intergenic
1035392244 7:158512358-158512380 CCTGTAACCTCCACTCCAATAGG - Intronic
1035482517 7:159198693-159198715 CTTCTCTCCAGCACTTCAGTGGG - Intergenic
1039368171 8:36955280-36955302 ATTTTCACCTGCACTCAAGGAGG - Intergenic
1039834869 8:41248160-41248182 CAGGCCACCTGCACTCCAGCTGG + Intergenic
1044296065 8:90528806-90528828 ATTGTCATGTGCACTCCACTTGG - Intergenic
1047858643 8:128939939-128939961 CTCCTCACCTGTACTCCACTGGG + Intergenic
1049626315 8:143623719-143623741 ATTGGCCACTGCACTCCAGTGGG - Intergenic
1050191680 9:3033169-3033191 CTTGTCAGCTGCTCTACAGAGGG - Intergenic
1050796628 9:9553878-9553900 CTTTCCTCCTTCACTCCAGTAGG - Intronic
1062183604 9:135204507-135204529 CTTCTGACCTGCACGGCAGTGGG - Intergenic
1062623173 9:137431644-137431666 CTGGTCACTCGCACCCCAGTGGG - Intronic
1203367809 Un_KI270442v1:273809-273831 TCCCTCACCTGCACTCCAGTGGG - Intergenic
1187290971 X:17952777-17952799 CTTGTCACCTGACAACCAGTTGG - Intergenic
1190689705 X:52903337-52903359 CTTGTCACCACCACCACAGTCGG + Intronic
1190696278 X:52952455-52952477 CTTGTCACCACCACCACAGTCGG - Intronic
1192592205 X:72369673-72369695 CTGGTCTCCTGCTCCCCAGTAGG + Intronic
1192785316 X:74329051-74329073 CTTGTCACCTACACTCAAAAAGG - Intergenic
1199139423 X:144292181-144292203 CCTGTCACCTGTGCTCCATTAGG - Intergenic
1200054091 X:153449671-153449693 CTTGGCCCCTGTACTCCAGATGG + Intronic
1201070887 Y:10146466-10146488 TCCCTCACCTGCACTCCAGTGGG + Intergenic
1201124719 Y:10902345-10902367 CTTGTCCACTCCACTCCAATGGG + Intergenic
1201631771 Y:16077755-16077777 CCTGTCACCTTAACTGCAGTTGG - Intergenic