ID: 1092745873

View in Genome Browser
Species Human (GRCh38)
Location 12:11672078-11672100
Sequence CTTGTCACCTGCACTCCAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 147}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092745873 Original CRISPR CTTGTCACCTGCACTCCAGT GGG Intronic