ID: 1092748261

View in Genome Browser
Species Human (GRCh38)
Location 12:11693720-11693742
Sequence CTGGGGACAGAGATAGTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 402
Summary {0: 1, 1: 0, 2: 3, 3: 39, 4: 359}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092748261_1092748272 29 Left 1092748261 12:11693720-11693742 CCCTGCACTATCTCTGTCCCCAG 0: 1
1: 0
2: 3
3: 39
4: 359
Right 1092748272 12:11693772-11693794 GAAGCACTGGGGGAAGCTGCAGG 0: 1
1: 0
2: 4
3: 23
4: 411
1092748261_1092748273 30 Left 1092748261 12:11693720-11693742 CCCTGCACTATCTCTGTCCCCAG 0: 1
1: 0
2: 3
3: 39
4: 359
Right 1092748273 12:11693773-11693795 AAGCACTGGGGGAAGCTGCAGGG 0: 1
1: 0
2: 2
3: 56
4: 636
1092748261_1092748270 18 Left 1092748261 12:11693720-11693742 CCCTGCACTATCTCTGTCCCCAG 0: 1
1: 0
2: 3
3: 39
4: 359
Right 1092748270 12:11693761-11693783 TTTCTAGTGATGAAGCACTGGGG 0: 1
1: 0
2: 3
3: 15
4: 268
1092748261_1092748269 17 Left 1092748261 12:11693720-11693742 CCCTGCACTATCTCTGTCCCCAG 0: 1
1: 0
2: 3
3: 39
4: 359
Right 1092748269 12:11693760-11693782 CTTTCTAGTGATGAAGCACTGGG 0: 1
1: 0
2: 1
3: 9
4: 323
1092748261_1092748268 16 Left 1092748261 12:11693720-11693742 CCCTGCACTATCTCTGTCCCCAG 0: 1
1: 0
2: 3
3: 39
4: 359
Right 1092748268 12:11693759-11693781 GCTTTCTAGTGATGAAGCACTGG 0: 1
1: 0
2: 0
3: 9
4: 121
1092748261_1092748271 19 Left 1092748261 12:11693720-11693742 CCCTGCACTATCTCTGTCCCCAG 0: 1
1: 0
2: 3
3: 39
4: 359
Right 1092748271 12:11693762-11693784 TTCTAGTGATGAAGCACTGGGGG 0: 1
1: 0
2: 0
3: 12
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092748261 Original CRISPR CTGGGGACAGAGATAGTGCA GGG (reversed) Intronic
900634897 1:3658120-3658142 CTGGGGCCAGAGCAAGGGCACGG + Intronic
900733331 1:4277702-4277724 CTGGGTACAGAGAAAGTGCTTGG + Intergenic
900776629 1:4590532-4590554 CTGGGGAGAGAAAGAGAGCACGG - Intergenic
901091566 1:6645127-6645149 CTGGGGAGACAGAGGGTGCAAGG + Intronic
902442504 1:16440374-16440396 TGGAGGACAGAGATACTGCAGGG + Intergenic
902798638 1:18815771-18815793 CTAGGGACAGAGACAGCCCAGGG + Intergenic
903539117 1:24086890-24086912 CTGGGGACAGAGATCATGGGAGG - Intronic
903666657 1:25012106-25012128 CTGGGGACAGAGAATGATCAAGG - Intergenic
903682783 1:25108280-25108302 CTGGGGACAGGGACAGTGGCTGG + Intergenic
903874945 1:26467534-26467556 CTGGAGACAGACATGGAGCAGGG - Intronic
904613986 1:31740035-31740057 CTGGGGACAGAAAGTGTGTAAGG + Intronic
905335586 1:37242452-37242474 CTGGCGACAGAGAGAGAGAATGG - Intergenic
905342252 1:37287299-37287321 ATGGGGAAAGAGAGAGTGAAGGG - Intergenic
905389938 1:37629807-37629829 CTGGGGACAGAGAGGGTGTGGGG + Exonic
907465437 1:54632276-54632298 CAGGGGACAGACATTGTACAGGG - Intronic
908415402 1:63908732-63908754 CTGGGGAGTGAGGTAGTACAAGG - Intronic
909272723 1:73644581-73644603 ATGTGGACAGAAATAGTGTAAGG - Intergenic
909318316 1:74251715-74251737 TGGGGGAGGGAGATAGTGCAGGG - Intronic
909823463 1:80095921-80095943 CAGGAGAGAGAGAGAGTGCAGGG + Intergenic
910247014 1:85149610-85149632 CTGGCGATAGAGAGAGTGAAAGG - Intergenic
910394033 1:86774118-86774140 AGGGGGACAGAGGGAGTGCAGGG - Intergenic
910739882 1:90503600-90503622 GTGGGGACAGAGCCAGTGCTGGG - Intergenic
911752783 1:101516877-101516899 CAGGGGAGAGAGAGAGTGAAGGG + Intergenic
913509663 1:119550219-119550241 CTGGGGACAGAGAGATGACATGG - Intergenic
913513518 1:119583402-119583424 CTGGGGACAGAGAGATGACATGG - Intergenic
913517145 1:119614342-119614364 CTGGGGACAGAGAGATGACATGG - Intergenic
913557902 1:119987373-119987395 CTTGGGACAGAGATATTCAAGGG + Intronic
914767815 1:150654726-150654748 CGGGGGACAGATATTGTACAGGG - Intronic
915334207 1:155131129-155131151 CAGGAGACAGTGATGGTGCAGGG + Intronic
915729558 1:158043516-158043538 CTGGGAACACTGATAGTTCAGGG + Intronic
916499378 1:165373804-165373826 CTGGGGCCAGAGATGGTGGGAGG - Intergenic
917799616 1:178558985-178559007 CAGGGGACAGACATTGTACAGGG + Intergenic
918746177 1:188203189-188203211 CTAGGAACAGAGATAGTTCAGGG - Intergenic
922554639 1:226523590-226523612 CTGGGGAAAGGGATAATGTAAGG - Intergenic
922744497 1:228036669-228036691 CAGGGGACAGAGAAGCTGCACGG - Intronic
923339439 1:232995168-232995190 CGGGGGGCAGAGAAAGAGCAGGG + Intronic
1063937025 10:11088753-11088775 CAGGGCACAGAGATGGTGGATGG + Intronic
1064959604 10:20948931-20948953 TTGAGGACAGAGCTAGTGAAAGG - Intronic
1064989901 10:21247047-21247069 CAGGGGAGAGAGAGAGTGAAGGG - Intergenic
1066995704 10:42561032-42561054 CTGGAGACTGAGATGCTGCAGGG - Intergenic
1067059212 10:43069329-43069351 CTGGGGCCACAGACATTGCAAGG + Intergenic
1067142771 10:43670420-43670442 CTTGGGAAAGAGACACTGCATGG - Intergenic
1068166601 10:53339667-53339689 CAGGGGACAGACATTGTACAGGG + Intergenic
1069487304 10:68832166-68832188 CTGGGGAAGGAGGTACTGCAGGG + Intronic
1069574466 10:69516930-69516952 CTGGGGGCCCAGACAGTGCAGGG - Intergenic
1070283182 10:75065036-75065058 CTGGGGCCAGTGACAGTGCCAGG - Intergenic
1070660252 10:78300585-78300607 CTGGGGAAACAGAAAGTGAAGGG - Intergenic
1070816437 10:79327590-79327612 CTGGGCTCAATGATAGTGCAAGG + Intergenic
1072596864 10:96881085-96881107 GTGGGGACAGAGATTGTATATGG + Intronic
1073630289 10:105141397-105141419 GTGGGGACAGAGAGGGTGGAGGG + Intronic
1074980233 10:118613708-118613730 CAGGGGACAGATATTGTACAGGG + Intergenic
1075208875 10:120473764-120473786 CAGGGGAGAGAGAGAGTGAAGGG - Intronic
1075488721 10:122848074-122848096 CAGGGGACAGAGACAGTGCCCGG + Intronic
1076051397 10:127336459-127336481 CTGACGACTGAGAAAGTGCAGGG - Intronic
1076391897 10:130109721-130109743 GTGAGGAAAGAGATGGTGCAGGG + Intergenic
1076416393 10:130292807-130292829 CAGGGGACAGACATTGTACAGGG - Intergenic
1077274875 11:1699968-1699990 GTGGGGGCAGAGGTAGTGCAGGG + Intergenic
1077467363 11:2739796-2739818 CAGGGGACAGAGAGAGGGGAGGG + Intronic
1078633122 11:13023375-13023397 CTGGTGAATGAGATAGTCCATGG - Intergenic
1079351183 11:19693358-19693380 TTGGAGACAGAAATAGGGCATGG - Intronic
1081083968 11:38776069-38776091 AAGAGAACAGAGATAGTGCAGGG + Intergenic
1081431296 11:42979296-42979318 CAGGGAAGAGAGATTGTGCAGGG - Intergenic
1081759188 11:45565135-45565157 CTGGGGGCCGAGGTTGTGCATGG - Intergenic
1081860418 11:46330498-46330520 CTGAGCACAGAGATAATGAATGG + Intergenic
1081968748 11:47184876-47184898 CTGGGGCCAGAGAGAGGGAAGGG - Intronic
1083148757 11:60776872-60776894 ATGGGGACAGAGTAAGTGTAAGG - Intergenic
1084066687 11:66708307-66708329 GTGGGGACAGGGTTAGTGGAAGG + Intronic
1086972742 11:93101265-93101287 CAAGGCAAAGAGATAGTGCAGGG + Intergenic
1088492093 11:110398225-110398247 CAGGGGACAGACATTGTACAGGG - Intergenic
1088821192 11:113458893-113458915 CTGGGGGCAGCGATGGGGCAGGG + Intronic
1089561108 11:119343623-119343645 CTGGGGACAGGGAGAGTGTGGGG + Intronic
1090409460 11:126497850-126497872 CTTGGCACAGAGAAAGTGCTTGG - Intronic
1090606158 11:128424825-128424847 CGGGAGACAGAGAAAGGGCAGGG - Intergenic
1090976518 11:131684518-131684540 CAGAGGACAGAGACAGTCCAAGG - Intronic
1091076999 11:132628659-132628681 CTGGGGACACAGGTGGTGTAAGG - Intronic
1091661809 12:2389838-2389860 CAGGGGACAGAGGGAGTGAAAGG - Intronic
1092079903 12:5707197-5707219 CAGGAGAGAGAGAGAGTGCAGGG - Intronic
1092748261 12:11693720-11693742 CTGGGGACAGAGATAGTGCAGGG - Intronic
1092995531 12:13946839-13946861 CTGGAGACAGAGATAGTCTATGG + Intronic
1093469892 12:19489314-19489336 GTGGTGGCAGAGAGAGTGCAGGG + Intronic
1093919925 12:24848497-24848519 CTGGGGACACAGAAATTGCAGGG - Intronic
1094349734 12:29510892-29510914 CTAGGGTCAGAGAGGGTGCAGGG - Intronic
1094483072 12:30900387-30900409 CTGGGGACACAGAAAAAGCAAGG - Intergenic
1095734064 12:45537033-45537055 CTGGGTACACAGATAGTGCTCGG - Intergenic
1097159044 12:57032970-57032992 CAGAGCACACAGATAGTGCAAGG - Intronic
1098715313 12:73822428-73822450 CAGGAGAGAGAGAGAGTGCAGGG + Intergenic
1098721201 12:73900532-73900554 CTGGGGACATACATTGTACATGG - Intergenic
1099011701 12:77298885-77298907 GTGGGGATAGAGATAGTGGAAGG - Intergenic
1099433400 12:82616289-82616311 CAGGGGTCAGAGATTGTACAAGG - Intergenic
1100414514 12:94357576-94357598 CAGGGGACAGACATTGTACAGGG - Intronic
1100732388 12:97486673-97486695 CTGGGGACAGAGAGAATAGAGGG + Intergenic
1101843764 12:108345666-108345688 CTGGGGACAGGGATTGGGCCAGG + Intergenic
1102780951 12:115563845-115563867 CTAGGGACAGAGCCAGTTCAAGG - Intergenic
1103487867 12:121295547-121295569 CTGGGGGCAGAGCTAGGGGAGGG + Intronic
1103917187 12:124381978-124382000 CTCGGGCCAGACCTAGTGCAAGG + Intronic
1104056395 12:125234152-125234174 CTGTGGCCAGGGATAGTGCTGGG + Intronic
1104065406 12:125301403-125301425 CTGGGCACAGGGCTGGTGCACGG - Intronic
1105710849 13:23007573-23007595 CGGGGGACAGACATTGTACAGGG - Intergenic
1106346776 13:28886994-28887016 CAAGGTACAGAGCTAGTGCAAGG + Intronic
1107017713 13:35721099-35721121 CTGGGGACTGGGATGATGCACGG + Intergenic
1107778725 13:43876417-43876439 TTGAGGGCAGAGATAGTGCCTGG - Intronic
1108827331 13:54429656-54429678 CTGGAGACAGAGATAGTGAAAGG - Intergenic
1109431281 13:62238806-62238828 TTTAGGACAGAGATAGAGCATGG + Intergenic
1110783700 13:79497683-79497705 CTAGGGAGAGAGTTAATGCAAGG - Intronic
1110879961 13:80559407-80559429 CTTGGGACAGAGATTGAGCCTGG + Intergenic
1111144357 13:84161178-84161200 CTTGTCACAGAGATAGTGCATGG - Intergenic
1113035791 13:106047346-106047368 CAGGTGAGAGAGAGAGTGCAGGG - Intergenic
1113462823 13:110493707-110493729 CTGGAGACAGTGATAGCGCTTGG + Intronic
1114362841 14:21994435-21994457 TAGGGGACAGAGATTGGGCATGG + Intergenic
1116182775 14:41556211-41556233 CAGGGGACAGAGGTAGGTCATGG + Intergenic
1116238547 14:42312162-42312184 CAGGGGACAGACATTGTACAGGG + Intergenic
1116254997 14:42542199-42542221 CTGGGGACTGAGACAATCCAAGG - Intergenic
1117600324 14:57367303-57367325 CGGGGGACAGACATTGTACAGGG - Intergenic
1118634746 14:67737420-67737442 CAGGAGAGAGAGAGAGTGCAGGG + Intronic
1119123144 14:72098332-72098354 CAGGGGACAGAGAAAAAGCAAGG - Intronic
1121123766 14:91392982-91393004 CTGGGGAAGGAGAAACTGCAAGG + Intronic
1121150452 14:91628616-91628638 CAGGAGAAAGAGACAGTGCAGGG - Intronic
1121811629 14:96896385-96896407 CTGGGTGCAGAGAGAGCGCATGG - Intronic
1122203751 14:100138025-100138047 CTGTCCACAGAGGTAGTGCAGGG + Intronic
1122272991 14:100576655-100576677 CAGGGGACACAGATGGTACAGGG + Intronic
1122652941 14:103236020-103236042 CGGGGGACAGACATTGTACAGGG - Intergenic
1124208156 15:27740805-27740827 GTAGGGACAGAGACAGAGCAGGG - Intergenic
1124713147 15:32031167-32031189 CTGGGGACAGACTCAGAGCATGG - Intronic
1124973986 15:34516551-34516573 CTGGGAAAAGAGATCGTGCCCGG + Intergenic
1125507848 15:40277356-40277378 CTGGGGGCAAAGAAATTGCAAGG + Exonic
1125720990 15:41845087-41845109 CTGGGGGCAGAGCCAGGGCAAGG + Intronic
1126340789 15:47639001-47639023 CAGGAGACAGACATAGTGCACGG - Intronic
1128699942 15:69796804-69796826 CTTGGGACAGAGATGGGGCAGGG - Intergenic
1129532027 15:76275120-76275142 ATGGGGACAGACATAATGAAGGG - Intronic
1129670937 15:77607386-77607408 CTGGGGTCACATATAGGGCATGG + Intergenic
1131038130 15:89239005-89239027 CGGGGGACAGACATTGTACAGGG + Intergenic
1131062841 15:89414756-89414778 CAGGGGACAGAGATAAGGCTGGG + Intergenic
1133651281 16:7816231-7816253 CTGGGCACAGAGACCGGGCAGGG - Intergenic
1133960829 16:10492078-10492100 CTGGGGGAAGAGACAGTGGAAGG - Intergenic
1134005933 16:10818769-10818791 CTGCGGACAGAGATAGTGGGAGG + Exonic
1134846273 16:17443465-17443487 CTGGAGAGAGAGACAATGCAGGG - Intronic
1136655199 16:31705484-31705506 TTGGGGCCAGAGATTGGGCAGGG + Intergenic
1138273574 16:55713775-55713797 CTGGGGAATGAGACACTGCATGG - Intergenic
1138386632 16:56639769-56639791 CTGGGGACAGAGCTTGGGCCAGG + Intronic
1138462216 16:57156602-57156624 GTGGCTACAGAGATAGAGCAAGG + Intronic
1139599271 16:67976818-67976840 CTGGGGACAGGGCTGGTGCCAGG - Intronic
1139751925 16:69114159-69114181 CTGGGGACAGGGATTGTGTGTGG + Intronic
1141827071 16:86488045-86488067 ATGGGCACAGAGAAAGGGCACGG - Intergenic
1143238495 17:5423558-5423580 CAGGATACAGTGATAGTGCATGG + Intronic
1143423175 17:6812137-6812159 CAGGAGACAGAAAGAGTGCAGGG - Intronic
1144118496 17:12125989-12126011 CAGGGGAGAGAGAGAGTGAAGGG + Intronic
1144662151 17:17078088-17078110 CTGGGGACAGGGAGTGGGCAAGG - Intronic
1145219728 17:21078312-21078334 CAGGGGACAGACATTGTACAGGG + Intergenic
1145888935 17:28401355-28401377 CTGGGCACAGAGAAAGTGCTGGG + Exonic
1145889055 17:28402237-28402259 CTGGTGAGAGAGACAGAGCAGGG - Exonic
1145971197 17:28957439-28957461 CTGGTCACAGATATATTGCACGG + Exonic
1145984919 17:29039208-29039230 GTGGGGACAGAGATAGAGGAGGG - Intronic
1146279768 17:31537581-31537603 CTGGGGGCAGAGACAGTGCACGG - Exonic
1147154256 17:38535629-38535651 CTGGGGGCACAGAGAGGGCAGGG - Intronic
1147479466 17:40745446-40745468 CTGGGGACCAAGTTGGTGCAAGG + Intergenic
1148102280 17:45099538-45099560 CAGGGGGCAGAGAGAGGGCAAGG + Intronic
1150123043 17:62619109-62619131 CTGGGGATGGAGAGAGGGCACGG + Intergenic
1151009267 17:70474525-70474547 CAGGAGACAGAGAGAGAGCAAGG + Intergenic
1151350692 17:73530331-73530353 CAGGAGAGAGAGAGAGTGCAGGG + Intronic
1151360116 17:73583738-73583760 CTGGGGGCAGGGAGAGTGCCAGG + Intronic
1151478012 17:74354678-74354700 CTGGGGACAGAGACTGTGGAGGG - Intronic
1151714205 17:75823209-75823231 CTGGGGACAGGGGCAGGGCAGGG + Intronic
1152245257 17:79182116-79182138 CTGGAGAGAGAGAGAGTACAGGG - Intronic
1152405761 17:80096976-80096998 CTGGGGACAGACCCACTGCACGG + Intronic
1153059637 18:982008-982030 GTGGGGAGAGAGAAAGTGGAAGG - Intergenic
1153666582 18:7371910-7371932 GTGAGGTCAGAGAGAGTGCAGGG + Intergenic
1157293704 18:46427144-46427166 CTGGGGATGGAGATGGTGGAGGG + Intronic
1157880853 18:51319839-51319861 CTGGAGACAGAGAGAGTGAAGGG + Intergenic
1158415105 18:57243471-57243493 GTGGGGCCAGGGATGGTGCAGGG + Intergenic
1158827781 18:61242870-61242892 CTGGGGACAGAGGTGTTTCATGG - Intergenic
1160866821 19:1259849-1259871 CTAGGGACAGAGAGAGGGAAGGG - Intronic
1162283131 19:9716506-9716528 CAGGGGACAGATATTGTACAGGG + Intergenic
1162577659 19:11508103-11508125 CTGGGGACAGAGAAACAGAAAGG + Intronic
1162778387 19:12993963-12993985 CTGGGGGGAGAGGTAGTGCTGGG - Intergenic
1163871467 19:19824809-19824831 CTGGGGAGAGACAGAGAGCATGG + Intergenic
1163907827 19:20162512-20162534 CTGGGGAGAGAAAGAGAGCATGG + Intergenic
1163934912 19:20434011-20434033 CTGGGGAGAGAAAGAGAGCATGG + Intergenic
1163949149 19:20568076-20568098 CTGGGGAGAGAAAGAGAGCATGG + Intronic
1164032106 19:21417002-21417024 CGGGGGACAGACATTGTACAGGG + Intronic
1164261968 19:23575962-23575984 CGGGGGACAGACATTGTACAGGG + Intronic
1164591527 19:29510244-29510266 GTGGGGACAGTGATAGAGGACGG - Intergenic
1164628867 19:29747830-29747852 CTGAGGGCAGAGATTGAGCATGG + Intergenic
1164693507 19:30227406-30227428 CTGGGGGCCGAGAAAGAGCAGGG + Intergenic
1164908363 19:31985695-31985717 CTGGGGACAGTGATGGTGGCAGG + Intergenic
1165473609 19:36017148-36017170 CTGGGGACAGGGATAGTCACTGG - Intronic
1165638766 19:37365983-37366005 ATGGAGACAGGGATAGTCCATGG + Intronic
1165783960 19:38450149-38450171 CAGGGGACAGAGCCAGAGCAGGG + Intronic
1165866064 19:38939796-38939818 CAGGGGACAGACATTGTACAGGG + Intronic
1166555252 19:43695192-43695214 ATGGGGACAGAAATAGGGCTTGG + Intergenic
1167115964 19:47489225-47489247 CTGGGAACAGAGAAAGGGAAGGG + Intronic
1167736448 19:51297262-51297284 CAGGGCACACAGAGAGTGCATGG - Intergenic
1167740908 19:51324498-51324520 CTGGAGACAGAGAGAATCCAGGG + Intronic
1167917446 19:52753516-52753538 CGGGGGACAGACATTGTACAGGG + Intergenic
1167932443 19:52877146-52877168 CTGGGGACAGGGAGAGTCTAAGG + Exonic
1168310786 19:55459567-55459589 CTGAGGACAGAGAGAATCCACGG - Intronic
925719675 2:6814706-6814728 CTGGGGATAGAGAGAGGGTAGGG + Intergenic
927107635 2:19841620-19841642 CTGGGGAGACAGATAGTGTAAGG + Intergenic
928216982 2:29370010-29370032 TTGGGGAGAGAGAGTGTGCAGGG + Intronic
928320971 2:30282554-30282576 CAGGTGACAGAGATGGAGCAAGG + Intronic
928612944 2:33008880-33008902 GTGGGGACACAGCCAGTGCAAGG + Intronic
929063688 2:37950193-37950215 CTGGTGAGAGAGATGGTCCAAGG + Intronic
929635134 2:43511933-43511955 CTGGGGAAAGAGCTAGGTCAAGG + Intronic
930183356 2:48386429-48386451 CAGGGGACAGACATTGTACAGGG - Intergenic
930918317 2:56721013-56721035 CAGGGGACAGACATTGTACAGGG - Intergenic
931781261 2:65580928-65580950 CAGGGGACTGAGGTAGGGCAGGG + Intergenic
931934841 2:67185709-67185731 CTGTGGACAGAGATTGGGCATGG - Intergenic
932580651 2:72990935-72990957 CTGGGGGCAGGGATGGTTCAAGG - Intronic
932584644 2:73019976-73019998 GTGGGGACAGAAAACGTGCAGGG + Intronic
932619439 2:73257138-73257160 CTGAGGACAGGGCTGGTGCAGGG + Exonic
933102722 2:78281299-78281321 CTGGTGAGAGAGATTGTACAGGG - Intergenic
934524271 2:95042008-95042030 ATGGGGACTGAGAGGGTGCATGG - Intronic
935915708 2:107947362-107947384 CAGGGGACAGACATTGTACAAGG + Intergenic
936836676 2:116718553-116718575 CTGGGGACAGAAAGACAGCATGG + Intergenic
937354245 2:121188031-121188053 CCAGGGACAGTGCTAGTGCATGG - Intergenic
937413685 2:121697699-121697721 CTGTGGACAGGGAGAGGGCAGGG + Intergenic
938070193 2:128304365-128304387 CCAGGGACAGAGATGGTGCATGG + Intronic
939079015 2:137638100-137638122 CTGGGCACAGAGCTCTTGCATGG - Intronic
939798575 2:146678924-146678946 CTGGAGACAGACGTACTGCAGGG - Intergenic
940301480 2:152180235-152180257 CAGGGGACAGACATTGTACAGGG + Intergenic
941052719 2:160752713-160752735 CTGGTGACAGAGAGACTGGAAGG + Intergenic
941937316 2:170994684-170994706 CTGGGGACAGAGCCAGTGCCTGG - Intronic
943062401 2:183052584-183052606 CGGGGGACAGACATTGTACAGGG + Intergenic
943090729 2:183371769-183371791 CTGTAGACAGAGTTGGTGCAGGG - Intergenic
943262329 2:185682099-185682121 GTGTGGAATGAGATAGTGCAGGG - Intergenic
943782990 2:191845610-191845632 CTGGGGACAGGGAGATTGCGTGG - Intronic
944386193 2:199167671-199167693 CTGGGGACAGGGTTAGCACACGG - Intergenic
945475054 2:210272239-210272261 CAGGAGAGAGAGAGAGTGCAGGG + Intergenic
946127609 2:217577870-217577892 CCGGGGACAGAGGTAATGAAGGG - Intronic
947587082 2:231362997-231363019 CAGGGCACAGAGAGCGTGCAGGG + Intronic
947883595 2:233544236-233544258 ATGGAGACAGACATAGGGCAAGG + Intronic
947938298 2:234026128-234026150 CAGGGGACAGAGCTATTGCTTGG - Intergenic
948302804 2:236920554-236920576 CTGGGGATAGAGACAGCGCTAGG + Intergenic
948377451 2:237530817-237530839 CTCGGGACACAGAAACTGCAGGG - Intronic
948789215 2:240368742-240368764 CTGGGGACAGAGTAAGCTCAGGG + Intergenic
948904939 2:240975291-240975313 CTGGGGCCAGACAGAGGGCAGGG - Intronic
1169191687 20:3662163-3662185 CTGGAGACAGAGAAGGTGCCTGG + Intronic
1169403684 20:5305251-5305273 CAGGGGACAGACATTGTACAGGG - Intronic
1171400072 20:24867432-24867454 CTGGGGGCAGACAGAGTCCATGG + Intergenic
1171467491 20:25340549-25340571 CTGGGAACAGAAAGAGTGCCAGG + Intronic
1171536162 20:25892577-25892599 CTGGAGACAGAAATAGAGGAAGG + Intergenic
1171882905 20:30631351-30631373 CTGGGAGAAGAGAGAGTGCAGGG + Intergenic
1173502678 20:43565502-43565524 TTGGGAACAGAGAAAGTGAAGGG - Intronic
1175511116 20:59526693-59526715 CTGGGGACAGCGAGAGTGCTGGG + Intergenic
1175873405 20:62218853-62218875 CAGGGGACACAGATAGTGCTGGG - Intronic
1176255111 20:64147658-64147680 CTGGGGAAGGAGATAGTGGGTGG + Intergenic
1178365542 21:31986354-31986376 ATGGAGACAGAGAGAGTGCAGGG - Intronic
1178944708 21:36937166-36937188 CTGGGGACAGTGACAGGGGAGGG - Exonic
1178995517 21:37395657-37395679 GAGGGGACACAGATAATGCAGGG - Intronic
1179025360 21:37674996-37675018 TTGGGGACAGGGGCAGTGCAGGG - Intronic
1180035318 21:45245404-45245426 CTGGGGATGGAGATGGTGTACGG - Intergenic
1180695046 22:17746533-17746555 CTGGTGACACAGTTAGTGCTGGG + Intronic
1180943207 22:19673842-19673864 CTGGGGACAGAGTTAGTCATAGG + Intergenic
1181616745 22:24060188-24060210 ATGGGGACAGGGATCTTGCATGG + Intronic
1182841949 22:33398251-33398273 TTGGGGATAGAGATGGGGCATGG - Intronic
1182948117 22:34344163-34344185 CTGGGGACAGTGACAGTGGGTGG + Intergenic
1183097719 22:35563354-35563376 CTGGAGACAGAGGAAGTGCTGGG + Intergenic
1183353936 22:37348685-37348707 CTGAGGACAGAGAGAGGGAAGGG - Intergenic
1183383619 22:37502860-37502882 CTGGGCTCAGAGATAGGTCAGGG + Intronic
1183602187 22:38846225-38846247 CTGGGGATAGAGATGGGCCAAGG - Intergenic
1184247443 22:43242731-43242753 CTGGGGACAGAGAGACTGGAGGG - Intronic
1185065224 22:48628686-48628708 CTGGAGCCAGAGACAGGGCATGG + Intronic
949869302 3:8574231-8574253 CTGGGCACAGAGATTGGTCAAGG - Intergenic
949899208 3:8795797-8795819 ATGGGGACAGAGAGAGTGGTCGG + Intronic
951270524 3:20618451-20618473 CGGGGGACAGACATTGTACAGGG + Intergenic
954532786 3:51335321-51335343 ATGGACACAGAGATAGGGCATGG - Intronic
955065024 3:55526643-55526665 CTTGGGACAGAGTTACTTCATGG - Intronic
955214080 3:56970588-56970610 CTGAGCACAGAGACAGTGCAGGG - Intronic
956848699 3:73207900-73207922 CTGAGGAAAGAGATAGTCCCAGG - Intergenic
961327676 3:126118887-126118909 TTGGGGACAGGGTTTGTGCAGGG - Intronic
961534292 3:127560197-127560219 CTGGGGACACAGGAAGTGCAGGG - Intergenic
961831743 3:129626728-129626750 CTGGGGACAGAGCTGGGGCGGGG + Intergenic
962755315 3:138461617-138461639 CGGGGGACAGGGATGGTGCCTGG - Intronic
963380093 3:144518418-144518440 CTGGAGAAAAAGATATTGCAAGG + Intergenic
966439526 3:179928422-179928444 GTGGGGACTGAGAGAGTGCTAGG + Intronic
966978396 3:185106666-185106688 CGGGGGACAGACATTGTACAGGG - Intronic
967079095 3:186032576-186032598 CTGGCCACAGGGATAGGGCATGG + Intergenic
967293582 3:187944900-187944922 CTGAGAACAGAGACAGTGCACGG - Intergenic
967308260 3:188080720-188080742 CTGGGGAGAGAGGTAGGACAAGG + Intergenic
968417449 4:452517-452539 CTGGGGACAGAAAGAGAGCGTGG + Intronic
968566190 4:1314574-1314596 GTGGGGACAGAGATGGTGCGGGG + Intronic
970659069 4:18264251-18264273 CTGGAGACACAGAGAGTGAAGGG + Intergenic
971002488 4:22338583-22338605 CTGGGGAGAGAAAGAGAGCATGG - Intergenic
971606238 4:28661528-28661550 GTGTGGAAAGAGAGAGTGCAGGG - Intergenic
971889981 4:32507590-32507612 CAGGAGACAGAGAGAGTGCAGGG + Intergenic
973010627 4:45068694-45068716 CAGGAGACAGAGAGAGTGAAGGG - Intergenic
973221394 4:47731177-47731199 CTGGGAGAAGAGAAAGTGCATGG + Intronic
975352217 4:73359156-73359178 ATGGGGACAGATATTGTACAGGG - Intergenic
975832119 4:78380342-78380364 CTGGCGACAGAGAGAGAGGATGG + Intronic
976202389 4:82592343-82592365 TTGGGGCCAGAGAGATTGCAAGG + Intergenic
976587117 4:86811372-86811394 CTGGGGACAGAGTTTGAGAATGG + Intronic
977066606 4:92324309-92324331 CTGGGGACAGAGAGAAAGGATGG - Intronic
977797115 4:101179545-101179567 CTGGGGACAAAGAGACAGCATGG - Intronic
978086157 4:104657724-104657746 CAGGAGACAGAGAGAGTGAAGGG - Intergenic
982065238 4:151649398-151649420 GTGGGGACAAAGGTAGTGGATGG - Intronic
983306728 4:165999417-165999439 CAGGAGAGAGAGAGAGTGCAGGG + Intronic
983797087 4:171877506-171877528 CTGGGGACAGGTATAATGAAGGG - Intronic
984571725 4:181403485-181403507 CTGGAGACAGAGAGAGGGCAGGG + Intergenic
985098040 4:186432114-186432136 CTGGGGGCTGAGATAGCGAAGGG + Intronic
985356630 4:189126764-189126786 CTGGAGAGAGAGAGAGTGAAGGG + Intergenic
985913450 5:2900533-2900555 CTGGGGAGGGAGAAAGTGGAGGG - Intergenic
986107727 5:4675937-4675959 ATGGGGACAGAGAGAGTACCTGG + Intergenic
990306967 5:54503389-54503411 CAGGGGACAGACATTGTACAGGG + Intergenic
992089852 5:73307219-73307241 AGGGGGACAGAGCCAGTGCATGG + Intergenic
993702580 5:91135819-91135841 CTGTGAACAGGGATTGTGCAGGG + Intronic
997050690 5:130376262-130376284 CTGAGGACAGAGGAAGTTCAAGG + Intergenic
997250791 5:132387125-132387147 CTCGGGTCAAAGATAGTGGAAGG - Exonic
998080908 5:139274206-139274228 CTGGGGAAAGAAGCAGTGCAGGG + Intronic
998471927 5:142390271-142390293 CTGGGGAGAGGGAGAGTGCAGGG + Intergenic
999198155 5:149796924-149796946 CCGAGGACAGAGTTAATGCATGG + Intronic
999300620 5:150487927-150487949 CAGGGGGCAGAGGTAGGGCAAGG + Intronic
999772733 5:154787696-154787718 CTGGGAGCAGAGAAAGAGCAGGG + Intronic
999792094 5:154950143-154950165 CAGGAGAGAGAGACAGTGCAGGG + Intronic
1002001315 5:176197784-176197806 CAGAGGACAGAGGTGGTGCAGGG - Intergenic
1002061492 5:176628414-176628436 CTGGGGACAGAAAAACTGCAGGG - Intronic
1002253024 5:177941185-177941207 CAGAGGACAGAGGTGGTGCAGGG + Intergenic
1006038546 6:31234045-31234067 CGGGGGACAGATATTGTACAAGG + Intergenic
1006066928 6:31468762-31468784 TTGGGGACAGAGAAAGTCCATGG - Intergenic
1007603555 6:43099563-43099585 CTAGGGATATAGATAGAGCAGGG + Intronic
1007702803 6:43774318-43774340 CTGAGGACAGAAAGAGAGCAAGG - Intronic
1008120570 6:47611755-47611777 CTGGGGACAGAAGGAGTGGAAGG - Intronic
1008312418 6:49992290-49992312 CAGGGGACAGAGTTAAGGCATGG + Intergenic
1009527250 6:64763382-64763404 CTGGAGAGAGAGACAGAGCAAGG + Intronic
1009955444 6:70447583-70447605 CGGGGGACAGACATTGTACAGGG + Intronic
1012525961 6:100177974-100177996 CTGGGGAAATACATAGTACAGGG + Intergenic
1014419847 6:121229941-121229963 CTGGAGAGAGAGAGAGTGAAGGG - Intronic
1015186033 6:130416958-130416980 CTTGAAACTGAGATAGTGCAGGG - Intronic
1015417471 6:132966120-132966142 CTGGGGACAGAAATCCTGAAAGG - Intergenic
1015483133 6:133737907-133737929 CTGAGTAGAGATATAGTGCAAGG - Intergenic
1016740439 6:147522909-147522931 CTGGGGACAGAGACTGTGAGGGG + Intronic
1018130281 6:160723731-160723753 CTGGGGAAAGAAAAACTGCAGGG + Intronic
1019885364 7:3899728-3899750 CTGGGGAGAGAGATGCAGCATGG - Intronic
1021577368 7:22116554-22116576 CTGAGGACTGAGCTAGTGCAGGG - Intergenic
1023221992 7:37929018-37929040 CTGGTGACAGAGATAAGGTAGGG - Intronic
1023507024 7:40910413-40910435 CTGGGTCAAGAGATATTGCAAGG + Intergenic
1023512272 7:40966253-40966275 CAGGACACAGAGATAGTGAAAGG + Intergenic
1023659694 7:42459366-42459388 CTGGGGCCAGAGCTGCTGCATGG - Intergenic
1023804613 7:43863697-43863719 CGGGGGACAGACATTGTACATGG + Intergenic
1024015512 7:45311214-45311236 CTGGGGACAGAGATGGGGATTGG + Intergenic
1024911301 7:54450182-54450204 CAGGGGACAGACATTGTACAGGG - Intergenic
1025102442 7:56146871-56146893 CGGGGGACAGACATTGTACAGGG - Intergenic
1026477596 7:70750223-70750245 GTGGGCACAGGGATAGTGCATGG + Intronic
1028780183 7:94727272-94727294 CAGGGGACAGATATTGTACAGGG + Intergenic
1028932419 7:96427922-96427944 CTGGGCACAGAGGGAGTGCGTGG + Intergenic
1029111375 7:98214492-98214514 CTTGGGACAGAGAGAGCCCAGGG + Intergenic
1030483258 7:110131260-110131282 CTGGGGACAGTGATTGTGACTGG - Intergenic
1032191449 7:129768139-129768161 CGGGGGACAAAGATGATGCAAGG + Intergenic
1032452407 7:132044640-132044662 TTGGGGACAGACCTACTGCAGGG - Intergenic
1033471823 7:141656936-141656958 CTGGAAACAGAGAGAGAGCACGG + Exonic
1034526784 7:151669136-151669158 CTGGGGAAAGAGTGAGTGCAGGG - Intronic
1034581103 7:152043391-152043413 CGGGGGACAGACATTGTACAGGG + Intronic
1034942753 7:155242161-155242183 CGGGGGACAGACATTGTACAGGG + Intergenic
1036696381 8:10977691-10977713 TCGGGGATAGAGACAGTGCAGGG + Intronic
1037419356 8:18685896-18685918 GTGGGGATAAAGACAGTGCACGG + Intronic
1039948800 8:42152438-42152460 CTGGGAACTGAGATTGTGGAGGG + Intergenic
1040388732 8:46932277-46932299 CAGGGGACCGAGAGAGTCCAGGG - Intergenic
1042209539 8:66366129-66366151 ATGGAGACAGAGATAGTACATGG - Intergenic
1042446467 8:68890658-68890680 CAGGGGACAGACATTGTACAGGG - Intergenic
1042810992 8:72824779-72824801 CTGGGAAGAGAGAGAGTGGATGG + Intronic
1042816904 8:72887826-72887848 CTGGGCAGAGAGAAAGTGTAGGG - Intronic
1043127496 8:76418064-76418086 CTGGAGAAAGAGAGAGTGAAGGG - Intergenic
1043285559 8:78525151-78525173 CTGGGTAAACAGATGGTGCATGG - Intronic
1043678847 8:82996572-82996594 CTGGGGACAGAGAATGCCCACGG - Intergenic
1044448238 8:92302828-92302850 CTGGTGACAGTGATACGGCAGGG - Intergenic
1045687078 8:104723183-104723205 CTTGTGAAAGAGACAGTGCAGGG - Intronic
1046343413 8:112889207-112889229 TTTGGGACAGAAATAGAGCAGGG - Intronic
1047051466 8:121117761-121117783 CTAGGCACAGAGCTACTGCAGGG + Intergenic
1047220831 8:122917008-122917030 CTGGGGACAGAGGTGCTGGAGGG - Intronic
1047410663 8:124621843-124621865 CTGGGGAAAGAGATAGGGGCTGG - Intronic
1048122616 8:131598802-131598824 CTGGGGACAGGGAAAGTGGTAGG - Intergenic
1048223348 8:132563231-132563253 CTGGGGAGAGGGATGTTGCAGGG + Intergenic
1049213867 8:141398952-141398974 ATGGGGACAGGGACAGGGCAGGG - Intronic
1049461924 8:142734246-142734268 CTGGGGACAGAGAGAGATCTAGG - Intronic
1050675943 9:8053328-8053350 CAGGTGACAGTGTTAGTGCAGGG + Intergenic
1050726142 9:8651385-8651407 GTGTGGACAGAGTTAGTTCATGG - Intronic
1052920173 9:33959121-33959143 CTGGTGACAGAGCGAGAGCAAGG + Intronic
1056090809 9:83203791-83203813 CTGGGGTGAGAGGAAGTGCATGG + Intergenic
1056898359 9:90573357-90573379 CTGGAGACAGAGGTTGTGAATGG - Intergenic
1057181996 9:93035350-93035372 CTGGGGAGAGGGATGGTGCGGGG - Exonic
1057285932 9:93754322-93754344 CAGGGGACAGACATTGTACAGGG + Intergenic
1057804268 9:98209381-98209403 CTGGGGGCCTAGATAGTGCCTGG + Intronic
1058894592 9:109388353-109388375 CCAGGGCCAGAGATAGTGAAGGG + Intronic
1060797829 9:126524642-126524664 CTGGAGACAGGGACAGTGGAGGG - Intergenic
1061051247 9:128197067-128197089 CTGAGGACAGAAATAGTGCAAGG - Intronic
1061099150 9:128478944-128478966 ATGGGGGTAGTGATAGTGCATGG + Intronic
1061274648 9:129562449-129562471 GTGTGCACAGAGATTGTGCATGG + Intergenic
1062150612 9:135016930-135016952 CTGGGGGCCCAGATTGTGCAGGG + Intergenic
1062510939 9:136905655-136905677 CTGGGAACAGAGAAAGGGAATGG - Intronic
1203562135 Un_KI270744v1:66209-66231 CTGGGGAGGGAGACAGGGCACGG + Intergenic
1186385315 X:9105039-9105061 ATGGGGACATAGACATTGCATGG + Intronic
1188821786 X:34784979-34785001 CTGGAGACAGAGATAGGGAAAGG + Intergenic
1189068166 X:37834083-37834105 CAGAGGACAGAGATGGTGAAGGG - Intronic
1189102159 X:38201917-38201939 CTGGGTACAGAGAGAGTTCCAGG + Intronic
1189355047 X:40304271-40304293 CAGGGGACAGAGATAAGGAAGGG + Intergenic
1189748894 X:44198519-44198541 CATGGGAGAGAGATTGTGCATGG + Intronic
1191149674 X:57207872-57207894 CAGGGGACAGACATTGTACAGGG + Intergenic
1191978139 X:66896196-66896218 CTGAGGACAGGGCTAGTTCATGG - Intergenic
1192150404 X:68708807-68708829 CTGGATACAGAGGTAGGGCAAGG + Intronic
1193048726 X:77079190-77079212 CGGGGGACAGACATCGTACAGGG - Intergenic
1194395324 X:93376540-93376562 CTGGGGATAAAGATTGTTCATGG + Intergenic
1195993278 X:110704664-110704686 CTGGGGACAGTGATTGAGCAGGG + Intronic
1197441421 X:126495284-126495306 CTGGCGAGAGAGCTTGTGCAGGG - Intergenic
1200354632 X:155535187-155535209 CATGGGACAGAGATTGTACATGG + Intronic