ID: 1092749368

View in Genome Browser
Species Human (GRCh38)
Location 12:11704289-11704311
Sequence AAGGAGAAGAAGGAAGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3634
Summary {0: 1, 1: 2, 2: 46, 3: 497, 4: 3088}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092749368 Original CRISPR AAGGAGAAGAAGGAAGTGGA GGG Intronic
Too many off-targets to display for this crispr