ID: 1092752597

View in Genome Browser
Species Human (GRCh38)
Location 12:11732689-11732711
Sequence CTCTAGAGGCAGAAGGAGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 723
Summary {0: 1, 1: 0, 2: 5, 3: 58, 4: 659}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092752597 Original CRISPR CTCTAGAGGCAGAAGGAGGA CGG (reversed) Intronic
900084076 1:878840-878862 CTCTGGAATCAGATGGAGGAAGG - Intergenic
900394232 1:2446567-2446589 CATTGGAGGCAGAGGGAGGAAGG + Intronic
900394305 1:2446868-2446890 CTGCAGGGGCAGGAGGAGGAAGG - Intronic
900547125 1:3235434-3235456 TTCCGGAAGCAGAAGGAGGAAGG + Intronic
900565677 1:3330853-3330875 GGCTGGAGGCAGAGGGAGGAGGG - Intronic
901267589 1:7923485-7923507 CTCTAGGGAAGGAAGGAGGATGG - Intronic
901434842 1:9241018-9241040 GTCTGGAAGCAGCAGGAGGAAGG - Intronic
901674548 1:10875256-10875278 TTCTTGAGGCAGGAGGAAGAGGG - Intergenic
901674852 1:10877156-10877178 TTCTTGAGGCAGAAGGAGGAGGG + Intergenic
901886654 1:12228308-12228330 CTCCACAGACAGAAGGAGGAAGG - Intergenic
902225841 1:14996060-14996082 CTCCAGAGGCAGAAGGGGCTGGG - Intronic
902430962 1:16362733-16362755 CTCAGGAGGCTGAAGCAGGAGGG + Intronic
902515859 1:16989317-16989339 CTCAAGAGGCTGAGGCAGGAGGG - Intronic
902974480 1:20079000-20079022 CTCGAGAGGCAGAGGCAGGAGGG + Intronic
903260083 1:22126923-22126945 CTGGTGAGGCAGATGGAGGAAGG - Intronic
903282407 1:22257460-22257482 CTCTGGATCGAGAAGGAGGAAGG - Intergenic
903476236 1:23620800-23620822 CTGCGGAGGCAGGAGGAGGAAGG - Intronic
904041836 1:27589939-27589961 CTCTGGAGGCAGAATGAGCCTGG - Intronic
904161125 1:28522705-28522727 CTCTGGAGGCTGAGGCAGGAGGG + Intronic
904291698 1:29490390-29490412 CTCTAGGGGAAGGAGGAGGTGGG + Intergenic
904633827 1:31864213-31864235 GTCAAGAGGCAGAAGGAGCAGGG + Intergenic
904794046 1:33045433-33045455 CTCTTGAGGGAGAGAGAGGAAGG + Intronic
904836323 1:33339579-33339601 CTCTAGAGGCAGAGGCAGGGAGG + Intronic
905174251 1:36126005-36126027 GTCTAGGAGAAGAAGGAGGACGG + Intergenic
905341390 1:37280409-37280431 CCCTAGAGGAAGGAGAAGGAAGG - Intergenic
905476999 1:38236025-38236047 CTCTAGAGTAAGAAGGAGAAGGG - Intergenic
906124154 1:43416345-43416367 TTCAAGAGGAAGAAGCAGGAGGG + Intronic
906357890 1:45123108-45123130 CTCTTGTGGCAGAGGTAGGAAGG - Intronic
906441036 1:45844934-45844956 CTCACGTGGCAGAAGGTGGAAGG + Intronic
907011259 1:50965599-50965621 CTCCAGAGGCTGAGGTAGGAGGG + Intronic
907104228 1:51866112-51866134 CTCCAGAGGCTGAGGCAGGAGGG + Intronic
907298708 1:53471784-53471806 CTCCGGAGGCTGAAGCAGGAGGG - Intergenic
907626461 1:56035231-56035253 CTCTAGAGGGTGTTGGAGGAGGG - Intergenic
907831040 1:58064513-58064535 CCCTAGAGGACGAAGGAGGAAGG + Intronic
908512771 1:64862518-64862540 CTGTGGAGGGAGCAGGAGGAGGG - Intronic
908561770 1:65313158-65313180 CTCAAGAGGCTGAGGCAGGAGGG - Intronic
908872244 1:68626731-68626753 CTCAGGAGGCTGAAGCAGGAGGG - Intergenic
909224979 1:73007946-73007968 CTCATGTGGCAGAAGGTGGAAGG + Intergenic
909316338 1:74223981-74224003 CTCTATAATCAGCAGGAGGAGGG - Intronic
909457371 1:75865514-75865536 GTCGAGAGGCAGAAGGAGCAAGG + Intronic
910672132 1:89784060-89784082 CTCAGGAGGCAGAGGAAGGATGG + Intronic
911101513 1:94099315-94099337 CTCTGGAGGCTGAAGGAGGCAGG + Intronic
911650368 1:100381193-100381215 CTCTGGAAGCAAAAGGAGAAAGG - Intronic
912314459 1:108654402-108654424 CTCTAAAGGGAGATGGAGGAGGG + Intronic
912432559 1:109636740-109636762 GTCTAGAGGCAGAAGGGTCATGG + Intergenic
912467463 1:109883823-109883845 CCCCAGAGGCTGAAGGAGGAAGG + Intergenic
912534737 1:110358216-110358238 CTCTGGAGGCTGAGGGAGTATGG + Intergenic
912649014 1:111421782-111421804 CCCCACAGGCAGAAGGAGCAGGG - Intronic
913023765 1:114813782-114813804 CTCAAGAAGCTGAAGTAGGAGGG - Intergenic
913048453 1:115093720-115093742 CTCCAGAGGCTGAAGTGGGAGGG + Intergenic
913224506 1:116687168-116687190 CTCCACAGGCAGAATGGGGAGGG - Intergenic
914668037 1:149848496-149848518 TTCAAGAGGCAGCAGGAGGATGG - Intronic
914693943 1:150058399-150058421 CTCAGGAGGCTGAGGGAGGAGGG + Intergenic
915152261 1:153843400-153843422 CTCTAGTGGCTGAGGTAGGAGGG - Intronic
915407583 1:155673121-155673143 CTCAGGAGGCAGTGGGAGGATGG - Intronic
916270111 1:162931744-162931766 CTATACAGGCAGAATGAGCAGGG - Intergenic
916616377 1:166445531-166445553 CACTAGAAGAAGAAGAAGGAAGG + Intergenic
916707316 1:167364680-167364702 CTCCAGAGGCTGAGGGAGAATGG - Intronic
917148214 1:171915504-171915526 GGATAGAGGTAGAAGGAGGATGG + Intronic
919001040 1:191831769-191831791 CTCAAGTGGCAGAAGGTGGAAGG + Intergenic
919781645 1:201225066-201225088 CTCCTGAGGCAGAAGGACAATGG - Intronic
920044946 1:203127111-203127133 ATGAAGAGGAAGAAGGAGGAAGG + Exonic
920376828 1:205513277-205513299 CTCTGGAGGCAGGAGGATGGGGG + Intronic
920386602 1:205574335-205574357 CTCAGGAGGCAGAAGTGGGAGGG + Intronic
920606703 1:207396033-207396055 AGCCAGAGGCAGAAGGAAGATGG + Intergenic
921269890 1:213458146-213458168 TTGTAGAGGGGGAAGGAGGATGG - Intergenic
922569994 1:226628944-226628966 CACTAGAGGCAGCAGGCGAAGGG + Intergenic
922671635 1:227512512-227512534 CTCTGGAACCAGATGGAGGAAGG - Intergenic
922939700 1:229451289-229451311 CTCCAGAGGCTGAGGTAGGAGGG + Intronic
923031232 1:230250434-230250456 CTAAAGAGGCAGAAAGAAGAGGG - Intronic
923072014 1:230574351-230574373 CTCTAAAGGCAGGAGAATGATGG - Intergenic
923152925 1:231250321-231250343 CTCGAGAGGCTGAGGCAGGAGGG + Intronic
923405572 1:233655690-233655712 CTCACAAGGCAGAAGGAGGAAGG - Intronic
923904010 1:238362343-238362365 CTCAAGAGGCTGAGGCAGGAGGG + Intergenic
924244075 1:242064459-242064481 CTCTGGAACCAGATGGAGGAAGG - Intergenic
924250150 1:242124421-242124443 CTTTGGAGGAAGAAGGAGAAGGG + Intronic
1062763170 10:43096-43118 CTCTGGAATCAGATGGAGGAAGG + Intergenic
1063616820 10:7607477-7607499 CTCTACAGAAAGAAAGAGGAGGG + Intronic
1064279753 10:13940956-13940978 CTATAAAGGAAGAAGCAGGATGG + Intronic
1065156010 10:22870860-22870882 CTCTGGAGGGTGAAGGAGGGAGG - Intergenic
1065736560 10:28758296-28758318 AAGTAGAGACAGAAGGAGGAAGG - Intergenic
1065789609 10:29248759-29248781 CTCAGGAGGCTGAAGCAGGAGGG + Intergenic
1066233908 10:33467193-33467215 TTTTAGAGTCAGAGGGAGGAGGG + Intergenic
1068203106 10:53809852-53809874 GTCTAGTGACAGAAGAAGGAAGG - Intronic
1069777182 10:70933999-70934021 CTCTAGGAGCAGGAGGAAGAAGG + Intergenic
1070605923 10:77898550-77898572 CTCTATTGGCAGGAGGAGGCAGG - Intronic
1070797689 10:79226391-79226413 GGCTAGAGGCAGATGCAGGAAGG - Intronic
1070808565 10:79285743-79285765 CTCCTGAGGCAGAAGGGAGAAGG + Intronic
1070825149 10:79386457-79386479 CTCTGCAGAGAGAAGGAGGAAGG + Exonic
1071087447 10:81879054-81879076 CTTTAAAGGCAGGAGGAGAAAGG + Intronic
1071255658 10:83869626-83869648 CTCTAGAGGATGGAGGGGGATGG - Intergenic
1071923119 10:90374043-90374065 CACTAGAGGAAGGTGGAGGAGGG - Intergenic
1072285281 10:93908534-93908556 CTCTAGGAGGGGAAGGAGGAAGG - Intronic
1072677486 10:97479090-97479112 GTATAGAGGCAGAGGGAGGGAGG - Intronic
1072870229 10:99111446-99111468 ATCTAGAGGGAGAAGGCAGAGGG + Intronic
1072999013 10:100272029-100272051 CTCAGGAGGCTGAAGCAGGAGGG + Intergenic
1074202938 10:111256058-111256080 CTCTAGAAGGAGGAGGAAGAGGG + Intergenic
1075358073 10:121801821-121801843 CTCTAGCAGGAGTAGGAGGATGG - Intronic
1075716811 10:124560603-124560625 CTCTAGAGGCAGAATCACCACGG - Intronic
1076429354 10:130391000-130391022 CTCCAGAGGCAGAGGGAGTGAGG + Intergenic
1076812790 10:132897994-132898016 CTCCAGTGGGAGGAGGAGGACGG - Intronic
1077043334 11:534081-534103 CTCTAGAGGAAGCAGGAGACAGG + Intronic
1077303237 11:1856652-1856674 CTCCAGATTCTGAAGGAGGAAGG + Intronic
1077590806 11:3489613-3489635 CTCAGGAGGCTGAAGCAGGAGGG - Intergenic
1077887240 11:6395210-6395232 CAGCAGGGGCAGAAGGAGGAAGG - Exonic
1078481892 11:11684284-11684306 CTCTAGAGGCTGGAGGATTAGGG + Intergenic
1078567266 11:12426907-12426929 TTCTGGGGGCAGAATGAGGATGG + Intronic
1078908770 11:15711737-15711759 ATTTAGAGGCAGGAGGAGCAAGG - Intergenic
1079010783 11:16826438-16826460 TTCGAGAGGCAGGAGCAGGAGGG - Exonic
1079619815 11:22540174-22540196 CTCTAGTGGTAGAAGGAGATAGG + Intergenic
1080401614 11:31941612-31941634 GTCAAGAGGCAGAGGGAGCAAGG + Intronic
1080783381 11:35451827-35451849 CTCATGTGGCAGAAGGAGGGTGG - Intronic
1081317933 11:41653344-41653366 ATCTAGATGAAGAAGAAGGAGGG - Intergenic
1082708650 11:56525752-56525774 CTGTCGTGGCAGAAGGAGAAAGG + Intergenic
1082771197 11:57208897-57208919 CTCAAGAGGCTGAGGCAGGAGGG + Intergenic
1082877301 11:58001329-58001351 GTCTAGAGGCACAGGGATGAGGG - Intergenic
1083399465 11:62413816-62413838 CTCCAGAGCCAGAAGCGGGAGGG - Intronic
1083631045 11:64095709-64095731 TTCTAGATGCAGCAGGCGGAGGG + Intronic
1084124877 11:67092807-67092829 CTCAAGAGGCTGAAGCAGGCTGG - Intergenic
1084246528 11:67861400-67861422 CTCAGGAGGCTGAAGCAGGAGGG - Intergenic
1084330824 11:68429143-68429165 CTCAAGAGGCTGAGGCAGGAGGG + Intronic
1084457473 11:69276640-69276662 CTTGAGAGGCAGAAGCTGGAGGG - Intergenic
1084826153 11:71733101-71733123 CTCAGGAGGCTGAAGCAGGAGGG + Intergenic
1084902805 11:72322242-72322264 CTTTAGCAGCAAAAGGAGGATGG - Intronic
1084921869 11:72477466-72477488 CTGAAGAGGCTGAAGGAGGGCGG + Intergenic
1085356027 11:75837906-75837928 CTTTGGAGGCTGAAGCAGGAGGG + Intronic
1085409255 11:76281803-76281825 CTCCAGAGTCACAAGGAGGCAGG - Intergenic
1085454584 11:76658545-76658567 CCCTGGAGACAGAAGGATGAAGG + Exonic
1085657730 11:78332015-78332037 TCCTAGAGGCAAAGGGAGGAGGG - Intronic
1086720567 11:90116255-90116277 CTCTAGAAGCAGAGGGAGCCAGG - Intergenic
1086920041 11:92575804-92575826 GTTAATAGGCAGAAGGAGGAAGG + Intronic
1088257748 11:107916796-107916818 ATGTGGAGCCAGAAGGAGGATGG - Intronic
1088259910 11:107934324-107934346 CTCAGGAGGCTGAAGTAGGAGGG + Intronic
1088432466 11:109773915-109773937 CCTCAGAGGGAGAAGGAGGAAGG - Intergenic
1088445057 11:109917251-109917273 CTCTAGAGGGACATGCAGGATGG + Intergenic
1088779945 11:113124206-113124228 CTCTAGACTGAGAAGGAGGAAGG + Intronic
1089177846 11:116561213-116561235 CCCTGGAGGTAGAGGGAGGATGG - Intergenic
1089281884 11:117380536-117380558 CTTGAGAGCCAGCAGGAGGATGG + Intronic
1089525370 11:119093654-119093676 CTATTGAGGCAGAAGCAGAAAGG - Intergenic
1089977293 11:122743456-122743478 CTCTGGAAGCCGAAGCAGGAGGG - Intronic
1090283381 11:125477774-125477796 CCCTGGAGGCAGAAGGAGCCAGG - Intronic
1090441539 11:126728937-126728959 CTTTCGGGGCAGAGGGAGGAGGG + Intronic
1090737754 11:129625806-129625828 CTGCTGAGGCAGAAGCAGGAGGG - Intergenic
1090974095 11:131667299-131667321 CTTTCTAGGCAGAAGGAGTAAGG - Intronic
1091095662 11:132819886-132819908 CTCTAGAGTCAGAATGCGGCAGG + Intronic
1091217052 11:133908521-133908543 CAGTGGAGGCAGGAGGAGGAGGG - Intergenic
1091446107 12:544993-545015 CTCTAGAGCAGGAAGAAGGATGG - Intronic
1092377542 12:7968307-7968329 CTCTGAAGGCAGAGGCAGGAAGG + Intergenic
1092417090 12:8298521-8298543 CTCAACAGGCTGAAGCAGGAGGG - Intergenic
1092629267 12:10361072-10361094 TTGTAGAGACAGAGGGAGGAGGG + Intergenic
1092752597 12:11732689-11732711 CTCTAGAGGCAGAAGGAGGACGG - Intronic
1092826452 12:12404417-12404439 CTCAACTGGCAGAAGGAGAATGG + Intronic
1092914120 12:13174072-13174094 CTCTAAATGGAAAAGGAGGAAGG - Intergenic
1093200237 12:16177758-16177780 CTCAGGAGGCTGAAGCAGGAGGG - Intergenic
1093480562 12:19600177-19600199 CTCAGGTGGCAGAAGGAGCAAGG - Intronic
1093757986 12:22874195-22874217 GTGTAGAGAAAGAAGGAGGAGGG - Intergenic
1094129477 12:27060113-27060135 CTCGAGAGGCTGAGGCAGGAGGG - Intronic
1094208909 12:27869846-27869868 CTCCAGTGCCAGCAGGAGGATGG + Intergenic
1095732397 12:45520369-45520391 TTCTAGAGGAAGAAGCATGATGG + Intergenic
1095828249 12:46553457-46553479 CTATAGATGCAGAAAGAAGAAGG + Intergenic
1096972210 12:55676134-55676156 CTCAAGAGGCTGAAGCAGGAAGG + Intergenic
1097055210 12:56244988-56245010 TCCTAGAGGAAGAGGGAGGAGGG + Exonic
1097160157 12:57040434-57040456 GGCTAGGGGCAGAAGTAGGAGGG + Intronic
1097178214 12:57155841-57155863 CTCAGGAGGCTGAAGCAGGAGGG + Intronic
1097384044 12:58928188-58928210 CACTAGAGTCAGAAGAAGCAAGG + Intergenic
1098329887 12:69342059-69342081 CTCTGGAGGCTGAGGCAGGAGGG + Intergenic
1098385501 12:69914648-69914670 CTCTCCTGGAAGAAGGAGGATGG - Intronic
1098593990 12:72249442-72249464 CTCTGGAGACTGAAGCAGGAGGG + Intronic
1099334990 12:81344153-81344175 GTCAGGAGGCAGAAGGAGCAGGG - Intronic
1099972280 12:89512646-89512668 CTCCAGAGGCTGAGGGAGGCGGG + Intronic
1100468138 12:94866666-94866688 CTCTAGAGTCAGAAAGACAAAGG + Intergenic
1100651122 12:96590077-96590099 CACTAGAGGCATAAGGTTGAAGG + Intronic
1101242622 12:102853309-102853331 CTCTAGAAGCAGGAGAAGTAGGG - Intronic
1101946625 12:109142139-109142161 CTTGAGAGGCTGAAGCAGGAGGG + Intronic
1102042559 12:109810011-109810033 CTACAGAGGCAGATGGCGGAAGG + Intronic
1102318645 12:111911805-111911827 CACAAGAGGCTGAAGTAGGAGGG - Intergenic
1102335995 12:112080606-112080628 CTCTGGAGGCTGAGGCAGGAGGG - Intronic
1102418640 12:112786531-112786553 CTCTTAAAGGAGAAGGAGGAGGG + Intronic
1102454658 12:113064030-113064052 CTCTCAAGGGAGAAGGGGGAAGG - Intronic
1102614869 12:114144826-114144848 TTCTAGAGACAGAAGGATAATGG - Intergenic
1102858212 12:116313291-116313313 TACTAGAGGCAGGAGGAGCAAGG - Intergenic
1103024550 12:117562996-117563018 CTCTGGAGACAGAGGGAAGAGGG + Intronic
1103199309 12:119073726-119073748 CTCTGGAGGCTGAGGTAGGAGGG - Intronic
1103721154 12:122976279-122976301 CTCCAGGGGAAGGAGGAGGAGGG - Exonic
1103988853 12:124785034-124785056 CTCCAGAAGCAGCAGGAAGAGGG - Intronic
1104195282 12:126531239-126531261 CTCAAGAGGCTGAGGCAGGAGGG - Intergenic
1104373521 12:128244542-128244564 CTCTGGAGGCTGAAGGAAGATGG + Intergenic
1104732657 12:131116570-131116592 CTCCAGAGGAAGGAGGAGGAGGG - Intronic
1106657993 13:31767916-31767938 CACTAGAGGCTCAAGCAGGAGGG + Intronic
1106684568 13:32044559-32044581 CTCTAGAGACAGAAGCAGATTGG - Intronic
1106690950 13:32115781-32115803 CACTAGAGGGAGAAGGAGGCTGG - Intronic
1107423369 13:40270243-40270265 CTCTAGAGGCTAAGGTAGGAGGG - Intergenic
1107757597 13:43641638-43641660 CTCGGGAGGCTGAAGGAGAATGG - Intronic
1108021894 13:46136170-46136192 AGCAGGAGGCAGAAGGAGGATGG - Intronic
1108176593 13:47798740-47798762 CTGGAGAGGCAAAAGGAGGCAGG + Intergenic
1108729038 13:53213823-53213845 CGTCATAGGCAGAAGGAGGAAGG - Intergenic
1109119289 13:58433742-58433764 CTCACATGGCAGAAGGAGGAAGG + Intergenic
1109443150 13:62400449-62400471 GACTAGAGGGATAAGGAGGAGGG - Intergenic
1110406915 13:75160910-75160932 CTCCAGATCCAGAAGGAGGGTGG - Intergenic
1110439967 13:75516880-75516902 CCATAGTGGCAGAAGGTGGAAGG - Intergenic
1110700387 13:78540626-78540648 CTCTGCAAGAAGAAGGAGGATGG - Intergenic
1111922968 13:94431726-94431748 CTCTGGAGGCAGACAGAGAACGG - Intergenic
1112255716 13:97829078-97829100 CTCTGGAGGCTGAAGTTGGAAGG - Intergenic
1113000147 13:105625761-105625783 GTCTAAAGGCAGAAAAAGGATGG + Intergenic
1113098738 13:106694566-106694588 CTGCACAGGCAGAAGAAGGAAGG - Intergenic
1113475332 13:110576475-110576497 CTCCAGAGGCTGAGGCAGGAGGG + Intergenic
1113618507 13:111697411-111697433 CTCTGGAGGCAGGGAGAGGAAGG - Intergenic
1113624036 13:111782672-111782694 CTCTGGAGGCAGGGAGAGGAAGG - Intergenic
1113803274 13:113097138-113097160 GTCCAGAGGCAGAAGCAGCACGG - Intronic
1115618534 14:35119443-35119465 CTCGAGAGGCTGAAGCAGGGAGG - Intronic
1117701646 14:58419806-58419828 CTCAAGAGGCTGAGGTAGGAAGG + Intronic
1117717488 14:58595952-58595974 CTCCAGAGGTTGAAGCAGGAGGG - Intergenic
1118203624 14:63701086-63701108 CTCTGGAGGCTGAGGTAGGAGGG - Intronic
1118214772 14:63798499-63798521 CTCGAGAGGCTGAGGCAGGAGGG - Intergenic
1118381226 14:65219196-65219218 AAATAGAGCCAGAAGGAGGAAGG - Intergenic
1119235746 14:73017787-73017809 CTGTAGAGGGACAAGAAGGAAGG - Intronic
1119523018 14:75300136-75300158 CTCAGGAGGCTGAAGTAGGAGGG - Intergenic
1120414817 14:84206184-84206206 TTCTAGAGGGAGTAGGATGAAGG + Intergenic
1121234653 14:92383443-92383465 ATCTTGAGGCAGAGAGAGGAAGG - Intronic
1121842682 14:97147591-97147613 CTCTAGAAGCTGAAAAAGGAAGG - Intergenic
1122292411 14:100686868-100686890 CTGGAGAGGCAGGAGGGGGAGGG + Intergenic
1122969536 14:105146920-105146942 CTGCAGAAGCAGACGGAGGAGGG - Intronic
1123478626 15:20611416-20611438 CTCTGGAGACTGATGGAGGATGG - Intergenic
1123639387 15:22388969-22388991 CTCTGGAGACTGATGGAGGATGG + Intergenic
1123703735 15:22935617-22935639 TACTGGAGGCAGGAGGAGGAAGG + Intronic
1124142046 15:27086224-27086246 CCCTAGGAGCAGGAGGAGGAAGG + Intronic
1124423477 15:29542118-29542140 CTCTGGAGGCTGAATGAGGCAGG - Intronic
1125200072 15:37095431-37095453 CTCTAGGGAGAGAGGGAGGAAGG - Intronic
1125277265 15:38006173-38006195 ATCAGGAGGCAGAAGCAGGAAGG + Intergenic
1125609525 15:40961071-40961093 CTCCACAGGCAGCAAGAGGAAGG - Intergenic
1125819916 15:42620371-42620393 CTCCAGAGGCTGAGGCAGGAGGG + Intronic
1125824171 15:42661550-42661572 CTCCAGAGGCTGAGGCAGGAGGG - Intronic
1125994131 15:44140773-44140795 CTCAAGAGGCTGAGGTAGGAGGG + Intronic
1127846331 15:62874809-62874831 CTCTGGAGGCAGAGAGAGCAGGG - Intergenic
1128256187 15:66198778-66198800 CTCTAGAAACAAAAGGAGGCTGG - Intronic
1128455803 15:67830698-67830720 CTCTAAAGGCAGAAGGTCTAGGG + Intronic
1128732318 15:70029582-70029604 CTCTAGAGGCAGCACAAAGAAGG + Intergenic
1128790491 15:70429958-70429980 CCCTGGAGGAAGAAAGAGGAGGG + Intergenic
1129425643 15:75460577-75460599 CTCAAGAGGCTGAGGCAGGAAGG + Intergenic
1129968447 15:79757181-79757203 CCCAGGAGGCAGAAGGAGCAGGG + Intergenic
1130287829 15:82570542-82570564 CTCTTGTGGTACAAGGAGGAGGG - Intronic
1133012385 16:2921367-2921389 TTCTAAAGCCAGAGGGAGGATGG + Intronic
1133131220 16:3677098-3677120 CTATAGAGGCAGAAGTGGGCTGG + Intronic
1133356180 16:5138701-5138723 CTCAGGAGGCTGAAGCAGGAGGG - Intergenic
1133463538 16:6008095-6008117 CTCAGGAGGCTGAAGCAGGAGGG + Intergenic
1133824288 16:9263156-9263178 CTTTGGAGGCAGACGCAGGAGGG - Intergenic
1134511362 16:14850338-14850360 TTCTAGAGAAAGAGGGAGGAGGG + Intronic
1134638648 16:15811601-15811623 CAGTAGAGGCAGAGAGAGGAAGG - Intronic
1134699006 16:16248835-16248857 TTCTAGAGAAAGAGGGAGGAGGG + Intronic
1134776610 16:16859006-16859028 CTCGGGAGGCTGAAGCAGGAGGG - Intergenic
1134972831 16:18545838-18545860 TTCTAGAGAAAGAGGGAGGAGGG - Intronic
1135075234 16:19387473-19387495 CTCAAGAGAGAGAAAGAGGAAGG + Intergenic
1135117493 16:19735956-19735978 CTCAAGAGGCTGAGGCAGGAAGG + Intronic
1135255244 16:20936555-20936577 GACTAGAGGCAGGGGGAGGAGGG - Intronic
1135407759 16:22210223-22210245 CTCCAGAGTCAGAAGGTGGATGG + Intronic
1135782947 16:25322225-25322247 ATCCAGATGAAGAAGGAGGAGGG - Intergenic
1136073460 16:27802760-27802782 CTCTGGAGGCTGAAGTGGGAGGG - Intronic
1136118152 16:28108806-28108828 CTCAGGAGGCAGATGGAGGCAGG + Intronic
1137361298 16:47818178-47818200 CTCTGGAGGCTGAAGTGGGAGGG + Intergenic
1137376836 16:47958990-47959012 CTTGAGAGGCTGAAGTAGGAGGG - Intergenic
1137400975 16:48154224-48154246 CTGGACAGGCAGAAGCAGGAAGG + Intronic
1137532445 16:49287949-49287971 CTGAAGATGGAGAAGGAGGAAGG - Intergenic
1137569112 16:49553126-49553148 CTCTGAAGGCAGAAGGAGCTGGG + Intronic
1137884396 16:52086926-52086948 CACTAGAAGCAGAAGGAGGAGGG + Intergenic
1138183606 16:54959913-54959935 CTCTGGAGACAGAAAGGGGAAGG - Intergenic
1138229007 16:55324297-55324319 GGCAAGAGGGAGAAGGAGGAGGG - Exonic
1138231523 16:55340516-55340538 CACATGAGGCAGAAGGAGTAGGG + Intergenic
1138426684 16:56938787-56938809 CTATAGATTCAGATGGAGGATGG + Intronic
1138436208 16:57001411-57001433 CTCAAGAGGCAGAAACAGGATGG + Intronic
1138520268 16:57567154-57567176 CGCTATAGGCAGAAGGAGGGAGG + Intronic
1139484926 16:67249996-67250018 CACAACAGGGAGAAGGAGGAGGG - Intronic
1139848829 16:69938749-69938771 CTCTAAAAGCAGAACGTGGATGG + Intronic
1140070945 16:71649152-71649174 CCATAGAGGCAGGAGGTGGAGGG + Exonic
1140117124 16:72051644-72051666 CTCAAGAGGAGGTAGGAGGAAGG - Intronic
1140175790 16:72658414-72658436 CTCTGGAGGCTGAAGTGGGAGGG - Intergenic
1140711482 16:77682258-77682280 CTCAAAAGGCCGAAGCAGGAGGG + Intergenic
1140760876 16:78107725-78107747 CTCAAGAGGCTGAAATAGGAGGG + Intronic
1140977911 16:80078267-80078289 CTCTATAGGAAGAAAGTGGAGGG - Intergenic
1141089456 16:81120289-81120311 CTGTGGAGGCAGTTGGAGGAGGG + Intergenic
1141198381 16:81878586-81878608 CTCAAGAGACAGTAGGAAGAAGG - Intronic
1141985632 16:87577864-87577886 CTCAAGAGGCTGAGGCAGGATGG + Intergenic
1142189547 16:88711614-88711636 CCCTAGAGGGAGAAGCAGCAGGG - Exonic
1142519584 17:495468-495490 CTCAGGAGGCAGAAGTGGGAGGG - Intergenic
1143065720 17:4245585-4245607 CTCTGGAGGCAGAGGCAGGTGGG - Intronic
1143365165 17:6403274-6403296 CTCAAGAGGCTGAAGCTGGAGGG - Intronic
1143863587 17:9908383-9908405 CTCTCCAGGCACAAGGAGGAAGG + Intergenic
1143964664 17:10748623-10748645 CTATACAGGCAGAGGCAGGAAGG - Intergenic
1144462103 17:15466669-15466691 CTCTGGAGGCTGAGGCAGGAGGG - Intronic
1144787211 17:17838492-17838514 CTCTAGAGGCTGCAGGAAGCTGG + Intergenic
1145206857 17:20989097-20989119 CTCTACATACAGAAGCAGGAGGG + Intergenic
1146438054 17:32869823-32869845 CTCAGGAGGCTGAAGTAGGAGGG + Intronic
1146490342 17:33276942-33276964 GTCTGGAGGCAAAAGCAGGATGG - Intronic
1146665428 17:34699500-34699522 CTGGAGAGGCAGAGGGAGAAAGG - Intergenic
1146894291 17:36530202-36530224 TTCTAGAGGCTGAGGCAGGAGGG + Intronic
1147717542 17:42518580-42518602 CTCGAGTGGGTGAAGGAGGAAGG - Intronic
1147944575 17:44073567-44073589 CTCCAGAGGCTGAAGTGGGAAGG - Intronic
1148925764 17:51083661-51083683 CTCTGGAGGCTGAGGCAGGAGGG - Intronic
1149013545 17:51882789-51882811 CCCTAGAGAGGGAAGGAGGATGG - Intronic
1149464988 17:56871036-56871058 CTCGGGAGGCTGATGGAGGAGGG + Intergenic
1150118050 17:62572254-62572276 CAGTAGAGGAAGAAGGAGAAGGG + Intronic
1150619045 17:66795205-66795227 CTCTGCAGGTAAAAGGAGGAGGG + Intronic
1151052601 17:70995603-70995625 GTCAGGAGGCAGAAGGAGTAGGG - Intergenic
1151218171 17:72591954-72591976 CGCTAGAGGCTGAAGGACAACGG + Intergenic
1151484338 17:74389181-74389203 CTCATGAGCCAGAAGGAGAAGGG + Intergenic
1151490266 17:74428707-74428729 CTCGAGAGGCTGAGGCAGGAGGG + Intronic
1151492244 17:74439724-74439746 CCCTAGAGACAGAAGGAAAAGGG - Exonic
1152956079 18:43427-43449 CTCTGGAATCAGATGGAGGAAGG + Intergenic
1153460564 18:5328276-5328298 CTCGGGAGGCTGAAGCAGGAGGG + Intergenic
1153469754 18:5430669-5430691 CTCAGGAGGCTGAGGGAGGAGGG - Intronic
1153595902 18:6725064-6725086 ATCTAGAGGGAGAGGGAGTAAGG - Intergenic
1153711052 18:7799212-7799234 CTCACATGGCAGAAGGAGGAAGG + Intronic
1153967643 18:10196191-10196213 CTCACGTGGCAGAAGGAGCAAGG + Intergenic
1154274994 18:12950927-12950949 CTCAAGAGGCTGAGGCAGGAGGG - Intronic
1155355110 18:24944271-24944293 GGCTTTAGGCAGAAGGAGGAGGG + Intergenic
1155517384 18:26637214-26637236 CGATAGAGTCAGGAGGAGGAAGG - Intronic
1155739668 18:29272527-29272549 CTATAGAGGAAGAAGAGGGAAGG - Intergenic
1156247952 18:35321016-35321038 CTCAAGAGGCTAAAGTAGGAGGG + Intergenic
1157131539 18:45012249-45012271 ATCAAGAGGCAAAAGGATGAAGG + Intronic
1157358372 18:46955657-46955679 CTCCAGAGGCTGAAGCAGGAGGG - Intronic
1157511174 18:48275987-48276009 CTCAAGATACAGAGGGAGGAGGG + Intronic
1157514270 18:48299696-48299718 ATGAAGAGGCTGAAGGAGGATGG + Intronic
1157619469 18:49007970-49007992 CTTTGGAGGCAGTAGGAGAATGG + Intergenic
1158462886 18:57662139-57662161 CTCTGGAGGTTGAAGCAGGAGGG - Intronic
1160013438 18:75123818-75123840 CTCCAGAGGGCAAAGGAGGAGGG - Intergenic
1161319291 19:3633576-3633598 CAAGAGAGGCAGAGGGAGGAAGG + Intronic
1161819689 19:6522266-6522288 CCTCAGAGGCAGAAGAAGGAGGG + Intergenic
1162367167 19:10256687-10256709 CTCTGGAGGCACAAAGAGGAGGG - Exonic
1162811844 19:13168867-13168889 CTCTAGAGGCTGAGGCGGGAGGG + Intergenic
1163181972 19:15610512-15610534 CTCGAGAGGCTGAGGCAGGAAGG + Intergenic
1163212201 19:15849413-15849435 CTCAGGAGGCAGAGGCAGGAGGG - Intergenic
1163283938 19:16334455-16334477 TTGTAGAGACAGAAGGAAGAAGG - Intergenic
1163625288 19:18386068-18386090 CTCTGCAGGCAGGGGGAGGAGGG + Intronic
1164629924 19:29755249-29755271 CTCCACAGGCAGAGGCAGGAGGG + Intergenic
1164632705 19:29772104-29772126 CTCCAGAGGAAAAAGGAGAAAGG - Intergenic
1164834641 19:31349560-31349582 CTCCAGAGGCCAGAGGAGGAGGG + Intergenic
1164886357 19:31782038-31782060 CTCTGGAGGCTGATGGAGGAGGG - Intergenic
1165103326 19:33453204-33453226 CTCCAGAGGCTGAGGGGGGAAGG + Intronic
1165571239 19:36776495-36776517 CTCGGGAGGCTGAAGCAGGAGGG - Exonic
1165600083 19:37047342-37047364 CTCACATGGCAGAAGGAGGAAGG - Intronic
1165922039 19:39305311-39305333 ATCTTGGGGAAGAAGGAGGAAGG - Intergenic
1165928812 19:39343031-39343053 TTCTGGAGACAGGAGGAGGACGG - Intronic
1166351657 19:42201708-42201730 CCCTAGAGCCAGAAAGAGGAAGG - Intronic
1166864970 19:45830310-45830332 CTGGAGAGGCAGCAGGGGGATGG - Intronic
1166877497 19:45906431-45906453 CTCTAGAGGCTGAGGTGGGAGGG - Intergenic
1167109591 19:47451414-47451436 CTCGAGAGGCTGAGGCAGGAGGG - Intronic
1167140129 19:47644606-47644628 CTCTGGAGGCTGAGGCAGGAGGG - Intronic
1167145072 19:47676498-47676520 CAGAAGAGGGAGAAGGAGGAAGG - Intronic
1167343996 19:48933859-48933881 CTCCAGAGTCTAAAGGAGGAGGG + Intronic
1167560790 19:50225799-50225821 CTCTTGAGTCTGAGGGAGGAGGG + Intronic
1167560819 19:50225873-50225895 CTCTTGAGTCTGAGGGAGGAGGG + Intronic
1167645485 19:50703123-50703145 CTCTGGAGGGAGGATGAGGAAGG - Intronic
1167693493 19:51001288-51001310 CTCTGGAGGAAGGAGGAGGCTGG + Intronic
1167695917 19:51015648-51015670 TTCTTGAGTCTGAAGGAGGAGGG - Intronic
1167798592 19:51726537-51726559 CTCTCGGGTCTGAAGGAGGAGGG - Intergenic
1168153607 19:54461589-54461611 CACTGGGGGCAGAGGGAGGAGGG - Exonic
1168266084 19:55224806-55224828 CTCTTGAGTCTGAGGGAGGAGGG - Intergenic
1168337345 19:55604104-55604126 CTCCGGAGGCTGAAGCAGGAGGG - Intergenic
1168503343 19:56912199-56912221 CTCTAGAAGCAGAAAGAAGGAGG - Intergenic
925644709 2:6023940-6023962 CACCAGAGGGAGAAGGTGGAAGG + Intergenic
926647989 2:15310738-15310760 GTTTAGAGGCAGAAGGAGCCAGG - Intronic
926838682 2:17053403-17053425 CTCAAGAGGCTGAGGCAGGAGGG - Intergenic
927556381 2:24036397-24036419 CTCAGGAGGCTGAAGCAGGAGGG + Intronic
927960528 2:27238283-27238305 GTCTGGAGACAGCAGGAGGAGGG + Intronic
927991130 2:27447921-27447943 TTCTAGAGGTAGAGGGAAGAAGG + Exonic
928284248 2:29975181-29975203 CTCCAGAGGCAGAAGGATGATGG + Intergenic
928929260 2:36607146-36607168 ATCTCAAGGCAGAAGGTGGAAGG + Intronic
929722004 2:44379068-44379090 GACTAGAGGAAGAAGGAGAATGG - Intronic
929764223 2:44830961-44830983 CTCTAGAGGAAAGGGGAGGATGG - Intergenic
930321008 2:49854456-49854478 CTCGAGAGGCTGAAGCAGAACGG + Intergenic
930381595 2:50636639-50636661 CTCTAGAAGCACAAAGAGGTAGG - Intronic
932301088 2:70667385-70667407 TGCTAGAGGCTGGAGGAGGAGGG + Intronic
933688615 2:85162125-85162147 CTCTGGAGGCTGAGGCAGGAGGG + Intronic
933820608 2:86108016-86108038 CTCAGGAGGCTGAAGCAGGAGGG + Intronic
934565668 2:95339227-95339249 CCCTTGTGGCTGAAGGAGGAGGG - Intronic
934876232 2:97923512-97923534 CTTGAGAGGCTGAGGGAGGAGGG + Intronic
934976350 2:98805555-98805577 CTCTGGAGGGTGGAGGAGGAGGG - Intronic
935186451 2:100738219-100738241 CTCTGGAGGCTGAGGCAGGAGGG + Intergenic
935444921 2:103146185-103146207 CTCAGGAGGCTGAAGTAGGAGGG - Intergenic
935469646 2:103442965-103442987 CACTAAAGGCTGGAGGAGGAAGG + Intergenic
935891149 2:107679862-107679884 CTTTATAGGCAGAATGAGTAGGG + Intergenic
936398168 2:112145377-112145399 CTCCAGAGGCTGAGGCAGGAGGG - Intronic
936480367 2:112879914-112879936 TGCTAGAGGCAGACAGAGGATGG - Intergenic
937072666 2:119076055-119076077 CTATTGAGGCAGCAGGAGCAGGG - Intergenic
937273684 2:120671023-120671045 CTCTGGGGGCAGGGGGAGGAGGG + Intergenic
938012227 2:127838063-127838085 CTCGAGAGGCTGAGGCAGGAAGG - Intergenic
938736570 2:134191569-134191591 CACTTGCGCCAGAAGGAGGAGGG - Intronic
938982830 2:136542787-136542809 CTCAAGAGGAAGAATGAGAATGG - Intergenic
939217641 2:139260187-139260209 CCCTAGAGGCAGAGAGAGCAGGG + Intergenic
940640465 2:156340955-156340977 CTCCAGAGGTAGGAGGGGGAAGG + Intronic
940670157 2:156657699-156657721 CTGTACAGGGAGAAGGAGAAGGG + Intergenic
941562441 2:167064665-167064687 GTCAAGAGGCACAAGGAGAATGG - Intronic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
942133141 2:172900094-172900116 CTCGAGAGGCAGAGGCAGAATGG + Intronic
942856611 2:180556167-180556189 CTCTAGATGCAGAAGGGATAGGG + Intergenic
943836319 2:192518132-192518154 CTCTGGTGGCAGAAGAAGGGGGG - Intergenic
944550673 2:200841828-200841850 CTCCAGAGGCTGAGGCAGGAAGG + Intergenic
945586051 2:211664430-211664452 CTTTATGGGCAGTAGGAGGATGG + Intronic
945972341 2:216243103-216243125 CTCTGGAGGCATGTGGAGGAGGG - Intergenic
946071744 2:217040002-217040024 CTCTAAAGGGACAGGGAGGAGGG - Intergenic
946551282 2:220804365-220804387 TCCTAAAGGCTGAAGGAGGATGG - Intergenic
946655411 2:221940504-221940526 CTCAAGAGCCAAAATGAGGAGGG - Intergenic
947507193 2:230716892-230716914 CTCAAGAGGCTGAGGCAGGAGGG + Intronic
947542808 2:230990444-230990466 CTCTGGAAGCAGGATGAGGACGG + Intergenic
947812214 2:233011693-233011715 CTCAGGAGGCAGAGGCAGGAGGG - Intronic
948021516 2:234737447-234737469 CTCTGGAGCCAAAAGGAGGGTGG + Intergenic
948363951 2:237442591-237442613 CTCTGTAGGGAGAGGGAGGAAGG + Intergenic
948446814 2:238039628-238039650 CTCTGGAGCCAGAAGGAGGTGGG - Intronic
948732569 2:239976402-239976424 CAGTTGAGGGAGAAGGAGGATGG - Intronic
948833529 2:240612772-240612794 CTCCAGAGGAAGAAGGGGAAGGG + Intronic
1168796782 20:615481-615503 CTCTGGAGGCTGAGGCAGGAGGG + Intergenic
1169190910 20:3658803-3658825 CTTTGGAGGAAGAAGGAGGCAGG + Intergenic
1169902475 20:10567403-10567425 CTCACACGGCAGAAGGAGGAAGG - Intronic
1171079071 20:22159656-22159678 CACTAGAGAGAGAGGGAGGAGGG - Intergenic
1172053964 20:32141286-32141308 CACTAGAGCCCAAAGGAGGAGGG + Intronic
1172084605 20:32371027-32371049 CTCAGGAGGCTGAAGCAGGAGGG + Intronic
1172145383 20:32754120-32754142 CTCCTGAGGCACAAGGAGCACGG - Intergenic
1172234740 20:33363788-33363810 CTCCGGAGGCTGAAGCAGGAGGG + Intronic
1172511118 20:35501757-35501779 ATATAGAGGCAGATGGAGGATGG - Intronic
1172642375 20:36448240-36448262 CTCAGGAGGCTGAAGCAGGAGGG + Intronic
1172733566 20:37109074-37109096 CTCAAGAGGCTGAGGGAGGTAGG + Intronic
1173018200 20:39245722-39245744 TCCCAGAGGCAGAAGGAGTAGGG + Intergenic
1173495718 20:43515754-43515776 CTCTAGCTGCAGAAGCTGGAAGG + Intronic
1173817477 20:45998987-45999009 GTCAGGAGGCAGAAGGAGGAAGG + Intergenic
1174000020 20:47367760-47367782 CTCTAGAGGCTGAGGCAGGAAGG + Intergenic
1174012178 20:47458787-47458809 CTCAGGAGGCTGAAGCAGGATGG + Intergenic
1174244240 20:49164406-49164428 CTCCAGAGGCTGAGGCAGGAGGG - Intronic
1174710299 20:52697437-52697459 CTCAAGAGGCTGAGGCAGGAGGG - Intergenic
1176273616 20:64249773-64249795 CTCTGGAGGCTGAGGTAGGAAGG - Intergenic
1177332720 21:19683136-19683158 CTACAGAGACCGAAGGAGGAGGG - Intergenic
1177916781 21:27098858-27098880 GTCTGGAGGCAGAAGGAGCAAGG + Intergenic
1178350784 21:31872287-31872309 CTTGTGAGGGAGAAGGAGGAGGG - Intergenic
1178981312 21:37267469-37267491 CTCTTGTGCCGGAAGGAGGAAGG - Exonic
1179826524 21:43969097-43969119 CTCTGGAGGGAGGAGAAGGAGGG - Exonic
1180202167 21:46230491-46230513 CTCTGGAAGCAGAAAGAGGCTGG + Intergenic
1180581565 22:16844179-16844201 CTCTGTAGGCAGAGGGAGGAGGG + Intergenic
1180691261 22:17717977-17717999 CTCTGAAGGCTGAAGTAGGAGGG + Intronic
1182681793 22:32085227-32085249 CTCAGGAGGCTGAAGCAGGAAGG - Intronic
1182734288 22:32520243-32520265 CTCTAGAGACTGAGGCAGGAGGG - Intronic
1183973333 22:41495132-41495154 CTCAAGAGGCTGAGGCAGGAGGG - Intronic
1184041713 22:41947875-41947897 CTCAGGAGGCTGAAGCAGGAGGG - Intergenic
1184117194 22:42429050-42429072 CTCAAGTGGGAGGAGGAGGATGG + Intronic
1184376584 22:44117328-44117350 CTGTAGAGGGTGAAGGAGGAGGG + Intronic
1184515199 22:44957457-44957479 CTCTGGAGGCAGCATGAGGACGG - Intronic
1184696510 22:46142372-46142394 CTCAGGAGGCAGAGGCAGGAGGG + Intergenic
1184734987 22:46392799-46392821 CTCTGGAGGCCGAGGCAGGAGGG - Intronic
1185096733 22:48811017-48811039 CTCTAGAGGCTGAGGCAGGAGGG + Intronic
1185157564 22:49203356-49203378 CTCAAGATGCAGAGGAAGGAAGG + Intergenic
949459542 3:4275431-4275453 GTCAAGAGGCAGAAGAGGGATGG + Intronic
949573155 3:5312598-5312620 CTTTCCATGCAGAAGGAGGAAGG - Intergenic
949817598 3:8076340-8076362 ATCAAGAGCCAAAAGGAGGAAGG - Intergenic
949965677 3:9354108-9354130 CTATAATGGCAGAAGAAGGAAGG + Intronic
950139258 3:10604040-10604062 GTATGGAGGCAGAGGGAGGAGGG - Intronic
950199589 3:11033817-11033839 TTCTAGAGGCAGAGGCAGGTGGG + Intronic
950358200 3:12429419-12429441 CTCAAGAGGAAGGAGGAGGCTGG + Intronic
950455026 3:13087817-13087839 CTCCCGTGGCAGAAGGTGGAAGG + Intergenic
950851851 3:16069747-16069769 CTCTAGGGGCAGTGGGAGGGTGG + Intergenic
951081116 3:18451035-18451057 TTCTCCAGGCAGAAAGAGGAGGG + Intergenic
951514196 3:23540169-23540191 CTCGGGAGGCTGAAGCAGGAGGG - Intronic
951802822 3:26615380-26615402 AGTTAGAGGGAGAAGGAGGAGGG + Intergenic
952311356 3:32193315-32193337 CTCAGGAGGCTGAAGTAGGAGGG - Intergenic
952582893 3:34855425-34855447 GTCAAGAGGCAGAGGGAGAAAGG + Intergenic
952832484 3:37576709-37576731 CTCGGGAGGCTGAGGGAGGATGG - Intronic
952951836 3:38532052-38532074 CTTTAGAGGCAGGAGGATAATGG + Intronic
953666061 3:44927497-44927519 CACCAGAGGAGGAAGGAGGAGGG + Intronic
954485269 3:50844321-50844343 CTCAGGAGGCTGAGGGAGGACGG - Intronic
954534681 3:51350686-51350708 CACTGGAGGCAGAAGTTGGAAGG - Intronic
955315429 3:57934897-57934919 CTCTGGAGGCCGAAGCAGGAGGG + Intergenic
955819557 3:62881715-62881737 CAGCAGAGGCAGAAGCAGGAAGG - Intergenic
955867657 3:63402107-63402129 CCCTGCAGCCAGAAGGAGGAAGG + Intronic
956119759 3:65954584-65954606 ATCTACAGAGAGAAGGAGGAGGG + Intronic
956585010 3:70854909-70854931 ATCTTGAGGCAGAAGGAGCAAGG + Intergenic
956600902 3:71021228-71021250 CTCTAGAGACAGAAAGATTAGGG - Intronic
956617783 3:71190175-71190197 CTATGGAGGCAGTAGGAAGATGG - Intronic
956963402 3:74430498-74430520 CTCCAGAGGCTGAGGTAGGAGGG + Intronic
957060839 3:75480148-75480170 CTCAGGAGGCTGAAGCAGGAGGG - Intergenic
958921507 3:100111195-100111217 CAATGGAGGCAGAAAGAGGATGG + Intronic
958980414 3:100712492-100712514 TTCTTGGGGCAGGAGGAGGAAGG + Intronic
959391891 3:105785593-105785615 TTCCAGAGCCAGAAGAAGGAAGG - Intronic
960573415 3:119206797-119206819 CCCTGGAGCCAGAAGGAAGAGGG - Intergenic
960659657 3:120043850-120043872 GTTTAGATGGAGAAGGAGGAGGG - Intronic
961292544 3:125859257-125859279 CTCAGGAGGCTGAAGCAGGAGGG + Intergenic
961484387 3:127206971-127206993 CCCAAGAGGCAGAGAGAGGAGGG - Intergenic
961553873 3:127684577-127684599 CTCTAGAGGCTGAGGTGGGAAGG + Intergenic
961894639 3:130157120-130157142 CTCAGGAGGCTGAAGCAGGAGGG - Intergenic
962434820 3:135356790-135356812 CTCCTTGGGCAGAAGGAGGAAGG - Intergenic
963156886 3:142108838-142108860 CCCTTGAGGCAGGAGGAGCACGG - Intronic
963327355 3:143877153-143877175 CTCAAGATGGAGGAGGAGGAGGG - Intergenic
965099398 3:164277427-164277449 ATACAGAGACAGAAGGAGGAGGG + Intergenic
966002003 3:174960927-174960949 CTTAAGAGGCTGAAGCAGGAGGG + Intronic
966721965 3:183072382-183072404 CTCTAATTGCAGATGGAGGAGGG + Exonic
966953661 3:184849713-184849735 ATCTAAAGGGAGAAGTAGGATGG + Intronic
967321129 3:188196481-188196503 CTCCAAAGGTAGAGGGAGGAGGG - Intronic
967326079 3:188241162-188241184 CTCTAGGAGCAGAAGGTGGTGGG + Intronic
969244674 4:5924665-5924687 CTCTCGGGGAGGAAGGAGGAGGG + Intronic
969748134 4:9089944-9089966 CTCAAGAGGCTGAAGCAGGAGGG + Intergenic
969809156 4:9634487-9634509 CTCAGGAGGCTGAAGCAGGAGGG + Intergenic
969922911 4:10557527-10557549 CCCTAGATGCAGAGGGATGAGGG - Intronic
970158310 4:13163799-13163821 CTGTAGTGGCAGAAGGGAGAAGG - Intergenic
970176078 4:13340768-13340790 CTCTAAAGGCACCAGGAGAAGGG - Intergenic
970320183 4:14867800-14867822 TACTAGAGGGAGAAGGTGGAAGG + Intergenic
970991297 4:22216248-22216270 CTCTAGATTCTGAAGGAGGTGGG + Intergenic
971141764 4:23932327-23932349 CCCTGGAGGCAGGAGGAGGATGG - Intergenic
971260705 4:25054342-25054364 CTCAGGAGGCTGAAGCAGGAGGG - Intergenic
971501805 4:27326294-27326316 CTCAAGAGGGGGAAGGAGGGAGG + Intergenic
971537892 4:27777401-27777423 CTCTGAAGGCTGAGGGAGGAGGG + Intergenic
971968425 4:33592416-33592438 CTCTAGGGGCACAAAAAGGAGGG - Intergenic
972238180 4:37158364-37158386 GTCATGAGGCAGAAGGAGCAAGG + Intergenic
972506598 4:39725748-39725770 CTCAGGAGGCTGAAGCAGGAGGG - Intronic
972551334 4:40137717-40137739 GTCAGGAGGCAGAAGGAGTAGGG + Intronic
972639391 4:40911886-40911908 GTGTAGGGGCAGAGGGAGGAGGG - Intronic
972804054 4:42509362-42509384 CTGTTGAGGAAGAAGGGGGATGG + Intronic
975395683 4:73870430-73870452 CTCTAGAGGCTGGAGGAGCAGGG + Intronic
975460767 4:74650976-74650998 CTCAGGAGGCTGAGGGAGGATGG + Intergenic
976172776 4:82321444-82321466 CTCAAGAGGCTGAGGCAGGAGGG + Intergenic
976230938 4:82842257-82842279 CTCCAGAGGAAGGGGGAGGAGGG + Exonic
976383012 4:84421644-84421666 CTCTTCAGACAGAAGGAGGGAGG - Intergenic
976639591 4:87323949-87323971 CTCAAGTGGCAGAAGGAGGAAGG + Intergenic
977289536 4:95149112-95149134 GTCTAGTGGCAGCTGGAGGAAGG - Intronic
977753277 4:100634840-100634862 CTCTAGATGCTGGAGGAGGGAGG + Intronic
978401587 4:108336546-108336568 ATCTTGGGGCAGAAGGGGGAAGG - Intergenic
978558473 4:110006235-110006257 CTCAAGAGACTGAAGCAGGAGGG + Intronic
979112027 4:116770831-116770853 CTCTATTAGCAGAACGAGGAGGG - Intergenic
979212346 4:118120318-118120340 CTCAGGAGGCAGAGGGAGCAGGG + Intronic
979676935 4:123419784-123419806 CACTAGAGGTGGAAGGATGATGG + Intergenic
980262615 4:130471815-130471837 CTCTAGTAGCAGAAGGTGGTCGG - Intergenic
980308334 4:131094493-131094515 CTCTACAGGTTGAGGGAGGATGG + Intergenic
981251844 4:142612212-142612234 CTTCAGAGGCAGAAGCAGCAGGG - Intronic
981356238 4:143792530-143792552 CTCACATGGCAGAAGGAGGAAGG - Intergenic
981377556 4:144033412-144033434 CTCACATGGCAGAAGGAGGAAGG - Intergenic
981971999 4:150674765-150674787 CTTGGGAGGCTGAAGGAGGAGGG + Intronic
982065295 4:151649647-151649669 CTCCAGAGTCTGACGGAGGAGGG + Exonic
983698319 4:170560030-170560052 CTCTTGAGGAAAAAGGAGGCTGG + Intergenic
983763229 4:171440437-171440459 GTGTAGGGGCAGAAGGGGGATGG - Intergenic
983833752 4:172364311-172364333 CTCTGGAGGCTGTGGGAGGATGG + Intronic
984792469 4:183627274-183627296 CTCAGGAGGCTGAAGCAGGAGGG - Intergenic
985440186 4:189978252-189978274 CTCTGGAATCAGATGGAGGAAGG + Intergenic
985494714 5:198018-198040 CACCAGGGGCAGAAGGAGAAAGG - Exonic
985832035 5:2240884-2240906 CTCTCCCGGCAGAAGCAGGAGGG - Intergenic
985891523 5:2719385-2719407 CTCTAGAGCCAGAAGCTGGAGGG - Intergenic
985985596 5:3513461-3513483 CGGGAGAGGCAGAAGGAGAAGGG + Intergenic
986253214 5:6080147-6080169 CACTCCAGGCAGAAGGAGGTGGG + Intergenic
986266633 5:6196703-6196725 ATGTAGAGGCAGCAAGAGGATGG + Intergenic
986691399 5:10316625-10316647 GTCAAGAAGCAGAAGGAGCAGGG - Intergenic
987246496 5:16054356-16054378 CTCTGAAGGCAGAAGGAAAAAGG - Intergenic
987341387 5:16942560-16942582 CTTTGGAGGGAGAAGGAGAAGGG - Intergenic
987372614 5:17207262-17207284 CTCCAGAGGCTGAGGCAGGAGGG + Intronic
987466834 5:18282061-18282083 CTCTCCAGACAGAAGGAGGAGGG - Intergenic
988692900 5:33590527-33590549 CTCATAAGGCTGAAGGAGGAAGG - Intronic
988861223 5:35281992-35282014 CTGGAGAGTCAGCAGGAGGAGGG + Intergenic
989074952 5:37554812-37554834 CTCGAGAGGCTGAGGCAGGAGGG - Intronic
989138834 5:38182141-38182163 CCCAAGAGAAAGAAGGAGGATGG - Intergenic
990327719 5:54694609-54694631 CATTCCAGGCAGAAGGAGGAGGG + Intergenic
990378717 5:55200161-55200183 CTCCAGAGGCAAAGGCAGGAGGG + Intergenic
991441842 5:66658912-66658934 CTTGAGAGGCAGAGGCAGGAGGG + Intronic
991611944 5:68458546-68458568 CTAAAGAGGCAGCAGGAAGAAGG + Intergenic
992544409 5:77797429-77797451 CTCTAGAAGAAGAAGGTGAAAGG + Intronic
993691578 5:91007436-91007458 CACAAGAGGCAGTAGCAGGATGG - Intronic
994362464 5:98868217-98868239 CTCGAGAGGCTGAGGCAGGAGGG + Intronic
994595050 5:101821531-101821553 CTCAAGAGGCTGAGGCAGGAGGG - Intergenic
994665930 5:102705237-102705259 CTCATATGGCAGAAGGAGGAAGG - Intergenic
995496397 5:112748887-112748909 CTCTAGAGGCTGAAGCAGGAGGG + Intronic
995671276 5:114606084-114606106 CTCTAAGGCCAGAAGGAGCATGG + Intergenic
996483654 5:124004290-124004312 CTCTAGAGGCAGAAAGAGCTTGG - Intergenic
997540549 5:134658157-134658179 CTCGAGAGGCTGAATGAGGCAGG + Intronic
998038582 5:138936731-138936753 CACCAGGGGCAGATGGAGGATGG - Intergenic
998241042 5:140444960-140444982 CTCTAGAGGCAAGAGGTGGGAGG - Intronic
999189405 5:149735376-149735398 TTCCAGAGGAAGAAGGAAGAGGG - Intronic
999266372 5:150269457-150269479 CTCAAGAGGGAGACTGAGGAGGG - Intronic
999353209 5:150897610-150897632 CTGATGAGGCTGAAGGAGGAGGG - Intronic
999737120 5:154521230-154521252 CTCTGGAGGGAGCAGGGGGATGG - Intergenic
999970934 5:156861985-156862007 CACTAGAGTCAAAAGAAGGAAGG + Intergenic
1000263745 5:159615314-159615336 CTCTAGAGGCGGGAGGGGGAGGG - Intergenic
1000614888 5:163415769-163415791 CTGCAGAGGCAGGAGGTGGAGGG + Intergenic
1001487088 5:172127545-172127567 CTCCCAAGGCAGGAGGAGGAAGG - Intronic
1001519983 5:172384542-172384564 CCCTAGAGACAGAAGTAGAATGG - Intronic
1002329116 5:178429327-178429349 CTCTAGAGGAAGGCAGAGGAGGG - Intronic
1002335283 5:178473400-178473422 CTCTGGAGGCTGAGGTAGGAGGG - Intronic
1002473237 5:179450080-179450102 GTCCCGAGGCAGAAGGAGCAAGG + Intergenic
1002480984 5:179500573-179500595 GTCCCGAGGCAGAAGGAGCAAGG - Intergenic
1002622751 5:180500540-180500562 CTCAGGAGGCTGAAGGAGAATGG - Intronic
1003170547 6:3718683-3718705 GTCAGGAGGCAGAAGGAGCAGGG - Intergenic
1003553616 6:7120929-7120951 CTCGAGAGGCTGAGGCAGGAGGG - Intronic
1003754544 6:9102030-9102052 CACTCGAGGCAGAAGGGGAAGGG + Intergenic
1004366361 6:15016438-15016460 CTCTGGAGGCTGAGGCAGGAGGG + Intergenic
1004989325 6:21119143-21119165 CTCAACAGGAAGAAAGAGGAAGG - Intronic
1006517494 6:34553042-34553064 AGCTAGAGGGAGAAGGAGGGGGG + Intronic
1006635128 6:35456460-35456482 TCCTGGAGGAAGAAGGAGGAAGG + Intronic
1006725245 6:36195528-36195550 TTCTAGAGTCAGAAGGATGAAGG - Intergenic
1007239784 6:40416725-40416747 CCCTAGCAGGAGAAGGAGGAAGG - Intronic
1007275391 6:40669565-40669587 CTCACGTGGCAGAAGGTGGAAGG - Intergenic
1007727739 6:43926869-43926891 CTCAGGCGGCAGAGGGAGGAGGG - Intergenic
1007820350 6:44556165-44556187 TCCTAGAGGCAGAAGGTGCAAGG + Intergenic
1008243388 6:49141448-49141470 CTCGTGAGGCTGAAGCAGGAGGG - Intergenic
1010991208 6:82482316-82482338 CTCTCAAGAGAGAAGGAGGAAGG - Intergenic
1011753543 6:90476680-90476702 CCCTAGAGGCAGGAGGGGGGTGG - Intergenic
1012896311 6:104953657-104953679 CTGCAGAGGCAGGAGGTGGAGGG + Intergenic
1013832588 6:114292320-114292342 CTCACGTGGCAGAAGGTGGAAGG + Intronic
1015338848 6:132074534-132074556 CTCTGGAGGCTGAAGTGGGAGGG - Intergenic
1015450968 6:133365584-133365606 GTCAGGATGCAGAAGGAGGAAGG + Intronic
1015494794 6:133869233-133869255 CTCATGAGGCAGAAGGGGCAAGG - Intergenic
1015765284 6:136709822-136709844 CTCAAGAGGCAGAGGCAGGAGGG + Intronic
1016740588 6:147524634-147524656 CTCCACAGGGAGAAGGAGGTAGG - Intronic
1016815872 6:148302205-148302227 CTCGGGAGGCAGCAGGAGAATGG + Intronic
1017147364 6:151246867-151246889 CTCAGGAGGCTGAAGTAGGAGGG - Intronic
1017395123 6:153990006-153990028 CTATATAGGCAGAAGGTTGAAGG - Intergenic
1018221589 6:161586121-161586143 CTCTGGAGGCTGAAGCTGGAGGG - Intronic
1018454735 6:163941642-163941664 TCCTGGAGACAGAAGGAGGAGGG + Intergenic
1018922353 6:168184116-168184138 CTCTGGGACCAGAAGGAGGAAGG + Intergenic
1019464175 7:1177506-1177528 CTCAGGAAGCAGAAGCAGGAGGG - Intergenic
1019507585 7:1400351-1400373 CCATAGAGACAGAAGTAGGAAGG - Intergenic
1019773714 7:2899621-2899643 CTCTGGCTGCAGGAGGAGGAAGG - Intergenic
1020240614 7:6391774-6391796 CCCTGCAGGCACAAGGAGGAAGG - Intronic
1020324871 7:6966698-6966720 CTCAGGAGGCTGAAGCAGGAGGG - Intergenic
1020537504 7:9419520-9419542 CTCAAGAGGCTGAGGCAGGAGGG + Intergenic
1020831123 7:13096738-13096760 CTTGAGAGGCAGAAGAAGAAAGG + Intergenic
1021990103 7:26132848-26132870 CTCTAGAGGCATAATCAGGTGGG - Intergenic
1022080146 7:27012385-27012407 CTCAAGCGGGAGAAAGAGGAGGG - Intergenic
1022478470 7:30727432-30727454 CTCTGGAGGCAGGAGGAGGGAGG + Intronic
1022902516 7:34825029-34825051 CTCAGGAGGCAGGAGGTGGAGGG - Intronic
1023250375 7:38253888-38253910 CTCGAGAGGCTGAGGCAGGAGGG + Intergenic
1023254719 7:38301735-38301757 CTCAAGAGGCTGAGGCAGGAGGG - Intergenic
1023570816 7:41569617-41569639 CTCTAGAAGCAGAAGCAAGAAGG + Intergenic
1023849592 7:44142798-44142820 CTCCAGAGGCTGAGGCAGGAAGG - Intergenic
1024053134 7:45642157-45642179 ATCAGCAGGCAGAAGGAGGAAGG + Intronic
1024118322 7:46213353-46213375 CTCAGGAAGCAGAAGGAGCAGGG + Intergenic
1026589794 7:71684768-71684790 CTCTGGAAGCTGAAGCAGGAGGG - Intronic
1026890584 7:73979429-73979451 GTCAAGAGGCAGAAGCAGGCAGG + Intergenic
1027358597 7:77384836-77384858 CTCTAGAGGCAGGAGGGAGAAGG + Intronic
1027970825 7:85078846-85078868 CTAGAGAGGAAGAAGGAGAAAGG + Intronic
1029860326 7:103564541-103564563 CACTTGAGGCAGAAAGAGGGGGG + Intronic
1030715846 7:112805949-112805971 CTAAAGAGGCAGAAGGTGGAGGG - Intergenic
1031035223 7:116781239-116781261 CTCTAGAGGCAGAGAGAGAGAGG - Intronic
1031102918 7:117504644-117504666 CTCAGGAGGCTGAAGCAGGAGGG + Intronic
1031714870 7:125096541-125096563 CTGGAGATTCAGAAGGAGGAGGG - Intergenic
1032104054 7:129010273-129010295 CTCAAGAGGCTGAGGCAGGAAGG - Intronic
1032172954 7:129600942-129600964 TTCAAGAGGCAGCAGGATGAAGG - Intergenic
1032177193 7:129640408-129640430 CTCTGGAGGCTGAGGCAGGAGGG + Intronic
1032191608 7:129769135-129769157 CTCTTGAGACAGAAAGAGAAGGG - Intergenic
1033595744 7:142856598-142856620 CACTCTAGGTAGAAGGAGGATGG + Intronic
1033801715 7:144909406-144909428 CTCTGGAGCCTGAAGGAGAAAGG - Intergenic
1036371194 8:8164247-8164269 CTCAGGAGGCTGAAGCAGGAGGG + Intergenic
1036463963 8:8979029-8979051 CGCTGGAGCCAGAAGTAGGATGG - Intergenic
1036879708 8:12501401-12501423 CTCAGGAGGCTGAAGCAGGAGGG - Intergenic
1036909468 8:12742831-12742853 CTCGAGAGGCTGAAGTGGGAAGG - Intronic
1037797934 8:22011706-22011728 CTCTGGAGGCTGAGGGGGGAGGG + Intergenic
1037903300 8:22700876-22700898 GTCTTCAGGGAGAAGGAGGAGGG + Intergenic
1040751863 8:50719345-50719367 CTCCCGTGGCAGAAGGAGGAAGG - Intronic
1041151953 8:54944242-54944264 CTCCAGTGGCAGAAGGTGGAGGG + Intergenic
1041225429 8:55692726-55692748 ATCAGGAGGCAGAGGGAGGATGG - Intergenic
1041746916 8:61217356-61217378 CTTTAAGGGGAGAAGGAGGAGGG + Intronic
1042212425 8:66393775-66393797 TTTTAGAGTCAGGAGGAGGAAGG - Intergenic
1042400379 8:68338464-68338486 CTGAAGATGCAGAAGGAGTAAGG - Intronic
1043810816 8:84737795-84737817 CTCATTTGGCAGAAGGAGGAAGG - Intronic
1043932692 8:86108674-86108696 CTCTGGAGGCCGAGGCAGGAGGG - Intronic
1044611275 8:94094699-94094721 GTCTTGAGGCAGCAGGAGGCAGG + Intergenic
1044668606 8:94655947-94655969 CTCCAGAGGCTGAAGCTGGAGGG + Intronic
1044939095 8:97322214-97322236 CTCCAGAGGCAGACAGAGGTAGG + Intergenic
1045051926 8:98335257-98335279 CTTTAGAGGCAGAATGAGGTTGG - Intergenic
1045964419 8:108007830-108007852 CTCCAGAGGCTGAGGCAGGAGGG + Intronic
1046131671 8:109974551-109974573 CCCTAGCGGCAGGAGGAGGAAGG - Exonic
1046645094 8:116777200-116777222 CTCTAGAGGCAGGATCTGGAAGG + Intronic
1047085020 8:121506530-121506552 GTCAAGAGGCAGAAAGAGAAAGG - Intergenic
1048058851 8:130896482-130896504 CTTTAGGGGCAGAAAGAAGAAGG + Intronic
1048167619 8:132077338-132077360 GTCTAGAGGAGGAAGGTGGAGGG + Intronic
1048284448 8:133130913-133130935 CACTGGAGGAAGAAAGAGGAGGG + Intronic
1048557466 8:135494576-135494598 CTCAAGAAACAAAAGGAGGAGGG - Intronic
1049047477 8:140164444-140164466 CTGAAGAGGAAGAAGGAAGAAGG - Intronic
1049324234 8:142013722-142013744 CTCTGGAGGCAGAAGAGGGAAGG - Intergenic
1049913863 9:297317-297339 CTCTAGAGTCAGAAGGAACTGGG - Intronic
1050313632 9:4378703-4378725 ATCCAGAGGCAGAATGAGAAAGG + Intergenic
1050624202 9:7486404-7486426 CTCTAGAGGCTGAGGTGGGAGGG - Intergenic
1053292354 9:36889629-36889651 GTCTAGAAGCAGGAGAAGGATGG - Intronic
1053336750 9:37281121-37281143 CTCAGGAGGCTGAAGCAGGAGGG - Intronic
1055533622 9:77213606-77213628 CTCAAGAGGCTGAGGCAGGAAGG - Intronic
1056396870 9:86189204-86189226 CTCGGGAGGCTGAAGCAGGAGGG + Intergenic
1056455994 9:86760713-86760735 CTCTGGAGGCAGAAGTGGAAGGG + Intergenic
1056958507 9:91101601-91101623 CCCTACAGGCAGGAGGGGGACGG - Intergenic
1057747434 9:97763183-97763205 CCTTAGAGGCAGAATGTGGAGGG + Intergenic
1057761265 9:97876497-97876519 CTTAAGAGGGAGATGGAGGAAGG + Intergenic
1058060225 9:100487462-100487484 CTTTAGAGAGAGAAGGAGGCTGG - Intronic
1058810369 9:108633270-108633292 CTTGAGAGGCTGAAGCAGGAAGG + Intergenic
1058815979 9:108683374-108683396 CGCTAGAGGCAGAATGGGGGTGG - Intergenic
1058973347 9:110102887-110102909 CTGCAGAGGCAGAAAGAGGCTGG - Intronic
1059207371 9:112479487-112479509 CTCCAGTGGCAGAAAGAGCAAGG - Intronic
1059246061 9:112850682-112850704 CTCTGGAGGAAGCAGGAGAAAGG - Intronic
1060173015 9:121476990-121477012 TTCTTGAGGCCAAAGGAGGAGGG - Intergenic
1060504384 9:124187315-124187337 CTCTGGAGGCAAGAGGAGGCAGG - Intergenic
1061995807 9:134182204-134182226 CTCTGGAGGCTGAGGCAGGAGGG + Intergenic
1062038969 9:134395558-134395580 CTCTGGAGGAGAAAGGAGGATGG - Intronic
1062141182 9:134959956-134959978 CCCTGCAGGCAGGAGGAGGACGG + Intergenic
1062679090 9:137767225-137767247 CTCAAGAGGCTGAGGCAGGAGGG - Intronic
1185562881 X:1073156-1073178 CTCTAGAGGCTGAGGTGGGAGGG - Intergenic
1185623496 X:1467272-1467294 CTCTGGAGGAAGAAAGAGCAGGG - Intronic
1185673640 X:1831190-1831212 CCCTGGAGGCAGGAGGAGGCAGG + Intergenic
1186068232 X:5789516-5789538 GTCTAGAGGGAGAAGGAAAAAGG + Intergenic
1186096600 X:6109156-6109178 CTCCAGAGGCTGAGGGTGGAGGG + Intronic
1186343502 X:8667401-8667423 CTCTGGAGGCTGAAGCAGGAGGG - Intronic
1186492868 X:9988185-9988207 CTCAAGAAGCTGAGGGAGGAGGG + Intergenic
1186660816 X:11665742-11665764 CTCTAGAGGCAGCGGGAAGGGGG + Intergenic
1186726477 X:12364312-12364334 GTCAAGAGGCGGAAGGAGAAGGG + Intronic
1187364564 X:18655900-18655922 CTCTAGAGCCAGGAAGATGAGGG - Intronic
1187552406 X:20319091-20319113 GTCTAGAAGCAGAAGAAAGAGGG + Intergenic
1188994927 X:36872472-36872494 CTTAAGAGGCTGAAGCAGGAGGG + Intergenic
1189332602 X:40152867-40152889 CTCCCGAGACAGAATGAGGAAGG + Intronic
1189703635 X:43737533-43737555 CAGAAAAGGCAGAAGGAGGAAGG + Intronic
1190074876 X:47309657-47309679 CTCAAGAGGCTGAAGAAGGAGGG - Intergenic
1190927158 X:54920770-54920792 CTCTGGAGGCGGAAAGAGGCAGG + Intronic
1192432246 X:71120237-71120259 ATCTAGATTAAGAAGGAGGATGG - Intronic
1192612742 X:72584251-72584273 CTCTAGTGGTAGAGGAAGGAAGG + Exonic
1194839007 X:98715493-98715515 CTGTAGTGGCAGAAGGTAGAGGG + Intergenic
1195613494 X:106894821-106894843 CTCTGGGGGAATAAGGAGGAGGG + Intronic
1195901190 X:109799115-109799137 CTCTAGAAGGGGAAGGAGTAGGG - Intergenic
1197112109 X:122788809-122788831 CTCGGGAGGCAGAGGCAGGAGGG - Intergenic
1197448946 X:126587395-126587417 CTCAGGAGGCTGAAGTAGGAGGG - Intergenic
1197730259 X:129803797-129803819 AGCTTGAGGAAGAAGGAGGAAGG + Exonic
1198803597 X:140472104-140472126 CTTGAGAGGCTGAAGCAGGAGGG - Intergenic
1199045569 X:143167319-143167341 CTGAAGAAGCAGAAGGAGGGTGG + Intergenic
1199193840 X:145003745-145003767 CTGAAGATGGAGAAGGAGGAGGG + Intergenic
1199369746 X:147033647-147033669 CTCAAGAGGCTGAAGGGGGGAGG + Intergenic
1200559074 Y:4677376-4677398 ATATAGAGACAGAAGAAGGAGGG + Intergenic
1201144684 Y:11057758-11057780 CAATAGAGGCAGAAGGCTGAGGG + Intergenic
1201553236 Y:15240559-15240581 CTCCAGAGGCTGAGGGGGGAGGG + Intergenic
1201567748 Y:15384456-15384478 CTCAGGAGGAGGAAGGAGGATGG - Intergenic