ID: 1092755992

View in Genome Browser
Species Human (GRCh38)
Location 12:11763908-11763930
Sequence GCTTATAGTTGACTGTGAAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 81}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092755984_1092755992 20 Left 1092755984 12:11763865-11763887 CCTTTATTGTTCAGATAGCATTA 0: 1
1: 0
2: 1
3: 17
4: 175
Right 1092755992 12:11763908-11763930 GCTTATAGTTGACTGTGAACGGG 0: 1
1: 0
2: 1
3: 3
4: 81
1092755983_1092755992 29 Left 1092755983 12:11763856-11763878 CCTTCTAAACCTTTATTGTTCAG 0: 1
1: 0
2: 0
3: 33
4: 237
Right 1092755992 12:11763908-11763930 GCTTATAGTTGACTGTGAACGGG 0: 1
1: 0
2: 1
3: 3
4: 81
1092755989_1092755992 -10 Left 1092755989 12:11763895-11763917 CCCAGGACAGAGGGCTTATAGTT 0: 1
1: 0
2: 0
3: 11
4: 137
Right 1092755992 12:11763908-11763930 GCTTATAGTTGACTGTGAACGGG 0: 1
1: 0
2: 1
3: 3
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092755992 Original CRISPR GCTTATAGTTGACTGTGAAC GGG Intronic
900132768 1:1095363-1095385 GTTTATAGTTTTCAGTGAACAGG + Intronic
904203218 1:28835327-28835349 GCTTCTTGTTGAGTGTGACCTGG + Intronic
912280941 1:108312681-108312703 CCTTATATTTGACAGTGAAATGG + Intergenic
915871520 1:159564795-159564817 CCTTCTATTTGAGTGTGAACTGG - Intergenic
918202555 1:182280695-182280717 GCTTCTGGTTGTCTGTGACCTGG - Intergenic
920252105 1:204628691-204628713 GCTTATAGTTGACATCGGACAGG - Intronic
1066196326 10:33103974-33103996 CCTTGTAGTCAACTGTGAACGGG - Intergenic
1071581910 10:86779660-86779682 GCTTAGAGTGGACAGTGATCAGG - Intronic
1091354592 11:134926557-134926579 GGTCATAGTTGATTGTTAACCGG + Intergenic
1092755992 12:11763908-11763930 GCTTATAGTTGACTGTGAACGGG + Intronic
1094166800 12:27451527-27451549 CCTTGTTGTTGGCTGTGAACTGG - Intergenic
1097632006 12:62075535-62075557 CCTTATAGTTGTCTAGGAACAGG - Intronic
1098506122 12:71252749-71252771 GCTTTTGGTTGTCTGGGAACGGG - Intronic
1102131380 12:110531813-110531835 GGTTATAATTGACTGTAAACAGG - Exonic
1102722616 12:115030694-115030716 GCATATAGGTGCCTGTGAAAGGG - Intergenic
1104606057 12:130188631-130188653 GCATATAGTTGTCTGTTAATTGG - Intergenic
1111381968 13:87467626-87467648 GCTGAAAGATGATTGTGAACTGG + Intergenic
1120137920 14:80891869-80891891 TCTTATAGTTTTCTGTGTACAGG - Intronic
1120538001 14:85721150-85721172 TCTTATAGGTAACTCTGAACAGG - Intergenic
1121082495 14:91119640-91119662 GCTTAATGTTGAGTGTCAACTGG + Intronic
1122537191 14:102473902-102473924 GCTTACAGTGGACTCTGAAATGG + Intronic
1131555649 15:93396276-93396298 GGTTATAGTGCACTGTGATCAGG - Intergenic
1132002263 15:98192274-98192296 CCTTGTAGCTGACTGTGCACTGG - Intergenic
1139440023 16:66961957-66961979 GCTCGTAGTTCCCTGTGAACAGG + Intronic
1141402390 16:83761672-83761694 GATTATAGTTCACTATGTACAGG + Intronic
1151837487 17:76592646-76592668 GCTTAAATTTGAATATGAACCGG + Intergenic
1155242083 18:23873165-23873187 GCTTGCAGTTGACTTTGACCGGG - Intronic
1157324725 18:46660449-46660471 GCACATAGCTGGCTGTGAACGGG + Intergenic
1157356544 18:46940534-46940556 GCTTGTAGTTGACTGTCACAAGG + Intronic
1158226836 18:55210139-55210161 GCTGATAGTGGACAGTGAAGTGG - Intergenic
1159417960 18:68178158-68178180 GTTTAAAGTTGACTGTGTATTGG + Intergenic
1163982367 19:20913095-20913117 GTTAGTAGGTGACTGTGAACTGG - Intergenic
1168495871 19:56849943-56849965 TCTTATAGTTTTCAGTGAACAGG + Intergenic
930455362 2:51601672-51601694 GTTTATAGTTCTCTGTGAAGAGG + Intergenic
931360231 2:61571735-61571757 GATTATAGTTGACTGTAGCCTGG - Intergenic
936773879 2:115948833-115948855 GTTTATAGTTGTCTTTGAAGAGG + Intergenic
943422723 2:187688278-187688300 GCATATAGTTGGCTTTCAACAGG - Intergenic
944056948 2:195532208-195532230 GCTAATAGTGTCCTGTGAACTGG - Intergenic
947503821 2:230691661-230691683 GCTTGGAGATGACTTTGAACAGG - Intergenic
1172808556 20:37630962-37630984 GCTTCTAATGGACTGTAAACAGG + Intergenic
1174528921 20:51195599-51195621 AATTATAGTGGACGGTGAACGGG + Intergenic
1174971885 20:55285486-55285508 GCTTCTAGTAGAATGTGAAAGGG + Intergenic
952328665 3:32343612-32343634 GCTTATAATTAAATGTCAACTGG + Intronic
954119510 3:48488531-48488553 GCTTATAGTAAAATGTGAAAAGG + Intronic
959235412 3:103715605-103715627 GCTTTTTGTTGACTGTGCAGGGG - Intergenic
964774483 3:160260783-160260805 GCTTATAGGTGACTAAGAATTGG - Intronic
972052514 4:34756465-34756487 GCTTATGATTGAGTGAGAACTGG - Intergenic
974734671 4:65913759-65913781 GATTTTAGTAGACTGTCAACTGG - Intergenic
976752516 4:88464414-88464436 TCTTATACTTTACTGTGATCAGG - Intronic
977261304 4:94800294-94800316 GTTTATAGTTGAATGTGTAGGGG + Intronic
978980337 4:114937421-114937443 GCATACAGCTGAATGTGAACCGG + Exonic
979748180 4:124243330-124243352 GCTTATAGTAGAATGTGAGAAGG + Intergenic
982048124 4:151469755-151469777 GGTTTTATTTGACTGTGAAATGG - Intronic
982386192 4:154805416-154805438 TCTTATATTTGACTTTGAAATGG + Intronic
991098097 5:62760873-62760895 GCTTATAGCCCAATGTGAACAGG + Intergenic
997437123 5:133883692-133883714 ACTGATAGTTGACTGTGACACGG - Intergenic
1004010703 6:11684132-11684154 CCTTATATTTGCCTGTTAACAGG - Intergenic
1004636733 6:17475997-17476019 TCCTATAGTTGAATGTGTACAGG + Intronic
1013879221 6:114874659-114874681 GATTATAGTTGACTGTGGGGTGG - Intergenic
1013979964 6:116118827-116118849 ACTCATTGTTGACTGTGAAGAGG - Intronic
1014317890 6:119890307-119890329 GCTTATAGTAGACTGTGAAAAGG + Intergenic
1015019954 6:128460981-128461003 CCTTAAAGATGACTGTAAACTGG - Intronic
1015144934 6:129975321-129975343 GCTCATAGATGACTTTGAAGGGG + Intergenic
1016067901 6:139702856-139702878 GCTTATGCTTGACTTTCAACTGG + Intergenic
1018489979 6:164282418-164282440 GATGAGAGTTGAATGTGAACTGG - Intergenic
1019426213 7:978121-978143 GCTTTTAATTGACTGTCACCTGG + Intergenic
1019731069 7:2630000-2630022 GCTGATTGCTCACTGTGAACAGG - Intergenic
1020523604 7:9227976-9227998 GCTCATAGTTGACAGAGCACTGG + Intergenic
1020725368 7:11806781-11806803 GCTTATTCTTAACTGTGTACTGG - Intronic
1022556606 7:31304466-31304488 GATTATAGTTTACTGTAACCTGG + Intergenic
1028028013 7:85870895-85870917 GTTTATAGTTCTCTGTGAAGAGG - Intergenic
1031202181 7:118702316-118702338 GCTTTTAGTTTACTGTGCAGAGG - Intergenic
1033223923 7:139546014-139546036 GCTTATATGTAACTGAGAACAGG - Intergenic
1035413234 7:158662991-158663013 GTTTGTAGTTTACAGTGAACAGG - Intronic
1037710256 8:21349634-21349656 GCTTAGAATTCACTGTGAGCTGG - Intergenic
1042187555 8:66152195-66152217 GCTTCTAGTGGAATGTGGACTGG - Intronic
1047553754 8:125906672-125906694 GCCTATAGTTAACTATGATCAGG + Intergenic
1047902161 8:129435033-129435055 GCTTATAGTAGAATGTGAGTGGG + Intergenic
1050155262 9:2660369-2660391 TCTTGTAGGTGACTGAGAACAGG + Intergenic
1051411223 9:16791619-16791641 TGTTATAGTTGACTGTGAATGGG - Intronic
1185596296 X:1308876-1308898 CCTCATAGTTGACGATGAACAGG - Intronic
1185997484 X:4968017-4968039 GCTTCTAGCTGGCTGTGAGCTGG - Intergenic
1186751747 X:12628683-12628705 ACTTGTAGTTGCCTGTGAAAGGG - Intronic
1197163643 X:123351715-123351737 GCTTTTAATTTACTGTGAACTGG + Intronic
1198092492 X:133345501-133345523 GGTTACAGTTCACTGTGTACGGG - Intronic
1201987587 Y:19986496-19986518 GCTTACTGTTGACTGTGATATGG + Intergenic