ID: 1092758685

View in Genome Browser
Species Human (GRCh38)
Location 12:11789454-11789476
Sequence GCTGAAGCCCAGACCGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 129}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092758685_1092758690 21 Left 1092758685 12:11789454-11789476 CCTGCTTCGGTCTGGGCTTCAGC 0: 1
1: 0
2: 1
3: 8
4: 129
Right 1092758690 12:11789498-11789520 TGTTCACTTTTTCTCTCCTTCGG 0: 1
1: 0
2: 5
3: 56
4: 556
1092758685_1092758691 22 Left 1092758685 12:11789454-11789476 CCTGCTTCGGTCTGGGCTTCAGC 0: 1
1: 0
2: 1
3: 8
4: 129
Right 1092758691 12:11789499-11789521 GTTCACTTTTTCTCTCCTTCGGG 0: 1
1: 1
2: 6
3: 52
4: 389

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092758685 Original CRISPR GCTGAAGCCCAGACCGAAGC AGG (reversed) Intronic
900288890 1:1915499-1915521 GGGGAAGCCCAGGCCAAAGCGGG + Intronic
901863406 1:12088897-12088919 GCTGAAGCCCAGGATGAAGAGGG - Intronic
902992251 1:20196455-20196477 GCTGAGGCCCAGGCCTCAGCTGG - Intergenic
903221602 1:21872656-21872678 GGTGATGCCCATACAGAAGCAGG + Exonic
904561755 1:31402918-31402940 ACTGAGGCCAAGACCGAAGAAGG - Intergenic
904851541 1:33463245-33463267 ACTGAGGCCCAGACAGAAGAAGG - Intergenic
907944084 1:59117082-59117104 GCTGCAGCCAAGAGCGAAGGGGG + Intergenic
908035257 1:60044627-60044649 TCTGAAGCCCAGCCTGCAGCTGG - Intronic
910095751 1:83519805-83519827 TCTGAAGACCAGACTGAAGGAGG + Intergenic
914904167 1:151730240-151730262 ACAGAAGCCCAGACCAAAGCAGG + Intergenic
919989658 1:202700383-202700405 GGTGAAGCCCAGCCCAGAGCCGG - Intronic
920504746 1:206507845-206507867 GCTGCAGACCAGGCCGGAGCGGG - Exonic
922074750 1:222232487-222232509 GCTGCAGCCCTCACCTAAGCTGG - Intergenic
1063397669 10:5706448-5706470 GCACAAGCCCAGATTGAAGCTGG + Intronic
1067139896 10:43648438-43648460 GCTGAAGCCCGCACGGAGGCCGG + Intronic
1069650374 10:70042814-70042836 GCTGAGGCCCAGACCCCAGATGG + Intergenic
1070549497 10:77480060-77480082 CCTGCAGCCAAGACAGAAGCTGG + Intronic
1074599455 10:114899073-114899095 AGTGAAGCCCAGCCCTAAGCTGG + Intronic
1074882058 10:117667222-117667244 GCTGAAGCCCAGAGAGAGGTTGG + Intergenic
1077457567 11:2690058-2690080 CCTTCAGCCCAGACAGAAGCAGG - Intronic
1077474227 11:2778845-2778867 GCTGCAGCCGAGATGGAAGCAGG - Intronic
1077474379 11:2779453-2779475 GCTGCAGCCGAGATGGAAGCAGG - Intronic
1083745601 11:64735046-64735068 ACTGAAGCCCAGGCAGAAGTGGG + Intronic
1083988569 11:66232831-66232853 TCTGCAGTTCAGACCGAAGCTGG - Intronic
1085402941 11:76245455-76245477 GCTGAAGCCCAGAGGGTAGGAGG + Intergenic
1085609359 11:77933261-77933283 TCTGATGCCGAGCCCGAAGCTGG + Intronic
1089597825 11:119592940-119592962 GCTGAAGCCCAAACTGAAAGAGG + Intergenic
1092758685 12:11789454-11789476 GCTGAAGCCCAGACCGAAGCAGG - Intronic
1093007173 12:14063342-14063364 GCTGAAACCCAACCAGAAGCTGG - Intergenic
1097287556 12:57889496-57889518 CCTGAGGCCCAGAGGGAAGCAGG + Intergenic
1101640050 12:106581320-106581342 GCTGAGGCCCAGAACGATGAAGG + Intronic
1103521082 12:121537406-121537428 GCCGAGGCCCAGGCGGAAGCCGG - Intronic
1103739038 12:123078839-123078861 GCTGAAGCCAGTATCGAAGCTGG - Intronic
1104004129 12:124880257-124880279 GCTGGAGCCCACAGAGAAGCTGG + Intronic
1104929163 12:132329251-132329273 GCTGAAGCCCAGGCCCGGGCGGG - Intronic
1112569549 13:100581286-100581308 GCTGAACCTAAGACTGAAGCAGG + Intronic
1114892493 14:26942851-26942873 GCTGAAGCCATGACAGAAGAAGG - Intergenic
1123042974 14:105497985-105498007 GCTGGTGCCCAGAGCGAGGCTGG - Intronic
1123786874 15:23683412-23683434 GCTGAAGCCCAGACTGCTGTGGG - Intergenic
1124372068 15:29109684-29109706 GCTGGTGCCCAGAACGAAGAGGG + Intronic
1126802648 15:52313708-52313730 AATGAAGCCCAGGCCGAGGCTGG + Exonic
1126849638 15:52789315-52789337 GATGCTGCCCAGACCGGAGCTGG + Exonic
1127871633 15:63079028-63079050 GCTGGAGTCCAGGCCGGAGCAGG - Intergenic
1128454493 15:67825021-67825043 GCTGTATTCCAGACCAAAGCTGG - Exonic
1132894779 16:2223656-2223678 GCAGAAGCCCAGGCCGAAGCCGG + Exonic
1134746610 16:16593664-16593686 GCGCAAGCCCAGACTGGAGCTGG + Intergenic
1134998864 16:18760016-18760038 GCGCAAGCCCAGACTGGAGCTGG - Intergenic
1139435150 16:66932617-66932639 GTTATAGCCTAGACCGAAGCTGG - Intronic
1143171486 17:4933081-4933103 CCTGACGCCCACACCCAAGCTGG + Exonic
1144040458 17:11405864-11405886 GCTGAATCACAGACCGACTCTGG - Intronic
1152201175 17:78947299-78947321 GCTGGAGCCGAGTCCAAAGCCGG - Intergenic
1152258984 17:79256391-79256413 GCTGAAGCCCAGAGTGAGGATGG + Intronic
1152552150 17:81035218-81035240 GCTGCACCACAGACCGGAGCGGG - Exonic
1152735674 17:81995801-81995823 GCTGCAGACCAGACTCAAGCTGG + Intronic
1157585480 18:48798370-48798392 GATGAACCCCAAACCGAAGAGGG - Intronic
1157662836 18:49460555-49460577 GCTGCAGGCCGGACCGGAGCCGG - Exonic
1160510677 18:79451836-79451858 GCCGAAGCCCAGGCCGCAGATGG - Intronic
1160660520 19:296150-296172 CCTGCAGCCCAGACCCAGGCAGG - Intergenic
1162156090 19:8678937-8678959 ACTGAAGACCAGACTGAAGGAGG + Intergenic
1163344594 19:16732426-16732448 CCTGAAGCCCAGTACGAAGAGGG - Intronic
1165149348 19:33751806-33751828 GCTGAAGCCCCCACGGGAGCGGG + Intronic
1167749945 19:51373357-51373379 GCTGGAGCCCCCACCCAAGCAGG - Intergenic
926075498 2:9939673-9939695 TCTGAAGCCCAAACCGAGGAGGG + Intergenic
926075509 2:9939710-9939732 TCTGAAGCCCAAACCGAGGAGGG + Intergenic
926479688 2:13377155-13377177 GCCGAAGCCAAGACTGAAGAGGG + Intergenic
928155850 2:28875760-28875782 TCTGAAGCCCAGACAGGAGCAGG - Intergenic
930321821 2:49864612-49864634 GCTGATGCCCAGGCAGAAGTGGG + Intergenic
932618275 2:73249948-73249970 GCAGAAGACCAGACCCAGGCAGG - Intronic
932837322 2:75049705-75049727 CTTGAAGCCCAGACGGAACCTGG + Exonic
937589966 2:123601014-123601036 GCTGAAAGCCAGACGGAAACTGG - Intergenic
938540001 2:132278087-132278109 TCTGACGCCCAGGCTGAAGCTGG - Intergenic
943393957 2:187308696-187308718 TCTGTAGCCCAGACCTCAGCAGG + Intergenic
948867330 2:240782632-240782654 GCTGAGGCCCGGAGCGAAGCTGG + Intronic
948871077 2:240798508-240798530 GGTAAAGGCCAGGCCGAAGCTGG - Intronic
1169342808 20:4809455-4809477 GCTGAAGGGCAGGCCGAAGTGGG - Intronic
1171009120 20:21498357-21498379 GCTGAAACAATGACCGAAGCTGG - Intergenic
1172766264 20:37352687-37352709 GCTGAAGCTCAGAGAGAGGCGGG + Intronic
1173268646 20:41511037-41511059 ACTGAAGCCCAGAACGATCCAGG - Intronic
1176667120 21:9697967-9697989 GCTGAACCCCAGGCAGAAGCCGG - Intergenic
1178175273 21:30089893-30089915 GCTGTAGCCAAGCCGGAAGCTGG - Intergenic
1178383869 21:32133991-32134013 GCTGAGGCCCAGTCTGAAGGTGG - Intergenic
1180143489 21:45907041-45907063 GCTGAAGGCCAGGCGGAGGCCGG + Intronic
1182646617 22:31815221-31815243 GCTGAAGCACAGACAGAGCCAGG + Intronic
1185270098 22:49925803-49925825 TCTGAAGCTCAGACCTCAGCGGG + Intronic
950119937 3:10475036-10475058 GCAGAAGCCCAGGCTGAAACTGG - Intronic
950577223 3:13839381-13839403 CCTGAAGCCCAGCCCGTAACAGG + Intronic
950738929 3:15034193-15034215 GCTGGATCCGAGACTGAAGCAGG - Intronic
951520071 3:23603142-23603164 GCTGAAGGCCAGACAGCACCAGG - Intergenic
952730239 3:36630900-36630922 GCTGAAGTCCAGAGAGAAGATGG - Intergenic
953346148 3:42177689-42177711 GTTGAAGCTCAGACAGAAACTGG + Intronic
954457533 3:50607955-50607977 GTTGGAGTCCAGACGGAAGCTGG + Exonic
958856318 3:99390509-99390531 TCTGAAGACCAGAAGGAAGCAGG - Intergenic
960077960 3:113509929-113509951 GCAGAAGGCCAAACAGAAGCAGG - Intronic
965352657 3:167633472-167633494 GCTAAAGACAAGACAGAAGCTGG - Intronic
967054980 3:185823887-185823909 GCTGGAGCCCAGACAGGAGACGG - Intronic
967135522 3:186509711-186509733 GCTGAATCACAGACAGAGGCTGG - Intergenic
967316373 3:188154638-188154660 GCTGAGGCCCAGAGAGAAGGAGG + Intronic
969484149 4:7462472-7462494 GCAGAAGCCCAGATAAAAGCAGG + Intronic
971424451 4:26502401-26502423 ACTGAAGACCAGACCGGAGTGGG - Intergenic
972814405 4:42628399-42628421 GCTGGAGCACAGACAGAAGGCGG + Intronic
979824339 4:125215018-125215040 GGTGAAGCACAGACAGCAGCTGG + Intergenic
982361502 4:154524020-154524042 GCTGGAGCCCAGATGGAGGCTGG + Intergenic
985628416 5:1002182-1002204 GCTGCAGCTCAGGCAGAAGCAGG + Intergenic
986169827 5:5306611-5306633 GCCGAAGCCCAGCCTGGAGCTGG + Exonic
991461434 5:66863451-66863473 TCTGGAGGTCAGACCGAAGCCGG - Intronic
994047850 5:95329485-95329507 GCAGAAGCTCAGACAGCAGCAGG - Intergenic
997819673 5:137053618-137053640 GCCGAAGCCCAGAAAGAACCTGG - Intronic
997846296 5:137289032-137289054 GTTGAAGCCAAGACTCAAGCTGG - Intronic
1000098923 5:157995557-157995579 GTCTAAGCCCAAACCGAAGCAGG - Intergenic
1001012462 5:168110696-168110718 GCTCAAGTCCAGACTGAAGGAGG - Intronic
1007850630 6:44799350-44799372 GCTGAAACCCAGTCTGAAACAGG - Intergenic
1007989959 6:46244722-46244744 ACTAAGGCCCAGAGCGAAGCAGG - Intronic
1014892360 6:126858221-126858243 GCTCAAGCCCAGGCTGAAGAAGG + Intergenic
1017134884 6:151139644-151139666 GCTGAGGCCCTGTGCGAAGCTGG + Intergenic
1018787300 6:167118027-167118049 GCAGAAGGACAGACTGAAGCTGG - Intergenic
1019164605 6:170089738-170089760 GCTCAGGCCCAGACCGCAGAAGG - Intergenic
1021838862 7:24706304-24706326 GCTGAAGCCCCGGCAGCAGCAGG - Exonic
1023594014 7:41810048-41810070 GTTAGAGCCCAGACTGAAGCCGG + Intergenic
1025254514 7:57374545-57374567 GTTGATGCCCAGACAGCAGCAGG + Intergenic
1026977117 7:74505633-74505655 GCTGAGGCCCAAATCGAATCAGG - Intronic
1038426655 8:27468324-27468346 GCTGAGGGCCAGAGGGAAGCAGG - Intronic
1038747954 8:30270445-30270467 GATGAAGGCGAGACCGAAGAAGG - Intergenic
1039454388 8:37697645-37697667 GCCCAAGCCCAGCCCGGAGCCGG + Exonic
1049269057 8:141684496-141684518 GCTGAATCCCTGTCCGAAGCAGG + Intergenic
1049599747 8:143501917-143501939 GCTGAAGCCCTGACCCCAGCGGG + Intronic
1052192668 9:25677667-25677689 GCTGTAGCCGAGGCCGCAGCCGG - Exonic
1056777595 9:89525092-89525114 GCTGCAGCCGAGACTGAGGCCGG - Intergenic
1059335959 9:113568638-113568660 GCTGCAGCCCAAGCCGAAGCTGG + Intronic
1060720313 9:125972198-125972220 GGTGGCGCCCAGACGGAAGCAGG - Intergenic
1061919941 9:133777226-133777248 GCTGGAGCCCAGAGAGAAGATGG - Intronic
1062107311 9:134762776-134762798 GCTGAGGCCCACACAGGAGCAGG - Intronic
1203658976 Un_KI270753v1:23795-23817 GCTGAACCCCAGGCAGAAGCCGG + Intergenic
1189293146 X:39900124-39900146 GCAGAAGCCCAGACATAAGTGGG - Intergenic
1189295128 X:39912451-39912473 GCTGAAGCCCAAAAGGGAGCTGG - Intergenic
1192362863 X:70450160-70450182 GCTGAAACCCAGGCCTGAGCGGG - Exonic
1196764975 X:119235390-119235412 GCTGGAGCCCAGACAAAGGCGGG - Intergenic
1198424154 X:136497766-136497788 GGTGACACCCAGACCGATGCCGG + Exonic
1199772901 X:150985118-150985140 GCTGAACACAAGACCAAAGCAGG - Intronic
1200087017 X:153611919-153611941 ACAGAAGCCCGGACGGAAGCAGG - Intergenic