ID: 1092758690

View in Genome Browser
Species Human (GRCh38)
Location 12:11789498-11789520
Sequence TGTTCACTTTTTCTCTCCTT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 618
Summary {0: 1, 1: 0, 2: 5, 3: 56, 4: 556}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092758688_1092758690 -9 Left 1092758688 12:11789484-11789506 CCAGCTATGACCTTTGTTCACTT 0: 1
1: 0
2: 0
3: 16
4: 160
Right 1092758690 12:11789498-11789520 TGTTCACTTTTTCTCTCCTTCGG 0: 1
1: 0
2: 5
3: 56
4: 556
1092758685_1092758690 21 Left 1092758685 12:11789454-11789476 CCTGCTTCGGTCTGGGCTTCAGC 0: 1
1: 0
2: 1
3: 8
4: 129
Right 1092758690 12:11789498-11789520 TGTTCACTTTTTCTCTCCTTCGG 0: 1
1: 0
2: 5
3: 56
4: 556
1092758687_1092758690 -8 Left 1092758687 12:11789483-11789505 CCCAGCTATGACCTTTGTTCACT 0: 1
1: 0
2: 1
3: 32
4: 281
Right 1092758690 12:11789498-11789520 TGTTCACTTTTTCTCTCCTTCGG 0: 1
1: 0
2: 5
3: 56
4: 556

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092758690 Original CRISPR TGTTCACTTTTTCTCTCCTT CGG Intronic
900823923 1:4911302-4911324 TGTTGACTTTTTGTCTCACTGGG + Intergenic
901263717 1:7893133-7893155 TATTTACTTTTTCTCTCTTTTGG + Intergenic
903038963 1:20514094-20514116 GGTTCATTTTCTGTCTCCTTTGG + Intergenic
904072221 1:27809803-27809825 TGTTACCTTTTTTTCTCCTAAGG - Intronic
904114100 1:28149091-28149113 TGTTCATGTTTTATCTTCTTTGG + Exonic
904714348 1:32455974-32455996 TTCTCACTTTTTCTCTTCTCTGG - Intergenic
904986230 1:34550683-34550705 TCTTTACATTTTCTGTCCTTTGG - Intergenic
905562351 1:38937438-38937460 TTTTCATTGTTTCTCTTCTTTGG - Intronic
905706081 1:40059513-40059535 TTTTCTATTATTCTCTCCTTTGG + Intronic
905977646 1:42189965-42189987 TGTTAAATTTTTTTCTCCTAAGG - Intronic
906705386 1:47891010-47891032 TGTTCCCTATGTCTCTCCTTGGG - Intronic
906830089 1:49021797-49021819 TTTACACATTTTCTGTCCTTAGG + Intronic
907073901 1:51562033-51562055 TGTTCACTGGTTCTTTGCTTAGG - Intergenic
907478779 1:54728532-54728554 TGTTCATTTTCTTTCTACTTTGG + Intronic
907940256 1:59080652-59080674 TTTTCACTTTTTATCTCTTTTGG - Intergenic
907990830 1:59580905-59580927 TGGTCAGTTTTTCTGTCCCTTGG + Intronic
908134278 1:61114263-61114285 TGTTCATTTTTTTTCTACATAGG - Intronic
908465858 1:64394274-64394296 TTTTTACTTTTTCTCTTGTTGGG - Intergenic
909546464 1:76853845-76853867 TGTTTACTCTTTCTCTTCTAGGG - Intergenic
910154404 1:84197441-84197463 TTTTCACTTTTTTATTCCTTGGG + Intronic
910440390 1:87245869-87245891 TCTACACTCTTTCTCTCCTCTGG - Intergenic
910613315 1:89168228-89168250 TTTTCCTTTTTTTTCTCCTTAGG - Intronic
911975059 1:104481886-104481908 TGATTATATTTTCTCTCCTTTGG + Intergenic
912193554 1:107370354-107370376 TTTTCAATTTTTGTCTCCATAGG + Intronic
912546658 1:110456210-110456232 TGTTGATTTCTTCTCTCCTTAGG + Exonic
913217776 1:116634915-116634937 TCTTCACCTTGTCTCTCCTGTGG - Intronic
913225940 1:116698210-116698232 TCTTTACTTTTTCTCTCTATTGG + Intronic
914265055 1:146031466-146031488 AGTTCACTGATTCTTTCCTTAGG + Intergenic
914321926 1:146572746-146572768 TGCTTACTTTTTCTTTCTTTGGG + Intergenic
914838032 1:151224349-151224371 TTTTTATTTTTTCTCTACTTAGG + Exonic
915075975 1:153308318-153308340 TCTCTTCTTTTTCTCTCCTTAGG + Intronic
915193464 1:154171507-154171529 TTTTCCCTTTTCCTCTCCTGTGG - Intronic
915272925 1:154767852-154767874 TGATCCCACTTTCTCTCCTTGGG + Intronic
916029557 1:160863957-160863979 TATTCTCTTTTTCCATCCTTTGG + Intergenic
916309979 1:163387246-163387268 TATTCACTTTTTCTCTTGTTTGG + Intergenic
916325553 1:163555587-163555609 TTTTGTCTTTTTCTCCCCTTTGG + Intergenic
916385100 1:164258162-164258184 TTTCCACTTTTTTTTTCCTTAGG - Intergenic
918191554 1:182180231-182180253 TGCTCCTTTTTTCTTTCCTTAGG + Intergenic
918532073 1:185534315-185534337 TGTGGACTTTGTCTTTCCTTGGG + Intergenic
918640027 1:186828615-186828637 TTTTCAATTTTGTTCTCCTTTGG + Intergenic
918743235 1:188163915-188163937 TTTTTACTTTTTCTCTCATTTGG + Intergenic
919239525 1:194894357-194894379 TGTTATCTTTTTATCTTCTTTGG - Intergenic
919282158 1:195504485-195504507 TGTTTACCTTTTCTATCATTTGG + Intergenic
919344686 1:196360631-196360653 TGTTCAAATTTCCTCTTCTTCGG - Intronic
919482279 1:198105302-198105324 TTTTGACTTTGTCTCTCCTTGGG + Intergenic
919538746 1:198822278-198822300 TGTTCTCTTTTCCTATCATTAGG + Intergenic
920762356 1:208797526-208797548 TGTATACTTTTTCTCTTCTAGGG + Intergenic
921074527 1:211689029-211689051 TTTTCCCTTTTTTTTTCCTTAGG - Intergenic
921164671 1:212498187-212498209 TGCTCAATTGTTCTCTCCTTGGG - Intergenic
921176167 1:212596538-212596560 TTTTCACTTTGTGTTTCCTTTGG + Intronic
922636372 1:227176854-227176876 TGTTCACATTTTCTTTTCTAGGG + Intronic
923189168 1:231603799-231603821 TGTTCACTTTTCTCCTTCTTGGG + Intronic
924694777 1:246387815-246387837 TTTTCATTTGTTCTCTGCTTTGG - Intronic
924892813 1:248302755-248302777 AGTTAATTTTGTCTCTCCTTTGG - Intergenic
1062895199 10:1097788-1097810 TGTTGCCTCTTTCTCTCTTTTGG + Intronic
1063325231 10:5093505-5093527 TTTTCACTTGTTCCTTCCTTTGG - Intronic
1063872678 10:10435601-10435623 TTCACACTTTTTCCCTCCTTGGG + Intergenic
1063901710 10:10739871-10739893 TGGTCATTTTTACTCTTCTTTGG + Intergenic
1065419633 10:25528903-25528925 TGATCTATTTCTCTCTCCTTAGG - Intronic
1066314419 10:34229813-34229835 ACTTCACTCATTCTCTCCTTTGG - Intronic
1066585306 10:36927233-36927255 GATTCAATTTTTCTTTCCTTAGG + Intergenic
1067136519 10:43612842-43612864 TTTTCCCTTTTGCTTTCCTTGGG + Intronic
1067164522 10:43854797-43854819 AATTCTCTCTTTCTCTCCTTGGG + Intergenic
1067246937 10:44555233-44555255 TGTTCTCAGTTTCTCTCCCTGGG - Intergenic
1067261424 10:44696361-44696383 TGTTCCCTTTCTTTCTCATTGGG + Intergenic
1067277854 10:44850663-44850685 TGTTCAGATTTTTTTTCCTTTGG - Intergenic
1068051669 10:51957728-51957750 TGTTCAATTCTCCTCTGCTTAGG + Intronic
1068196747 10:53727058-53727080 TCTTCTCTGTTTCTCTCCTGTGG + Intergenic
1068277981 10:54827590-54827612 TCATTCCTTTTTCTCTCCTTTGG + Intronic
1068299281 10:55117828-55117850 TTTTTATTTTTTCTCTCATTTGG + Intronic
1068377633 10:56204977-56204999 TGTTTTCTTTTTTTTTCCTTTGG - Intergenic
1068509787 10:57950712-57950734 TGTTCACCTTTTCTTTCCTAAGG - Intergenic
1068789922 10:61017100-61017122 TCTTCAAATTTTCTCTACTTTGG - Intergenic
1068800980 10:61139469-61139491 TTTTCCCTTTTTTTCCCCTTAGG + Intergenic
1070099275 10:73369477-73369499 TTTTCTCTTTTTCTCCCTTTGGG + Intergenic
1071190795 10:83097074-83097096 TTTTCTCTTTTTCTCTTCCTGGG - Intergenic
1071433135 10:85622223-85622245 TGTTCCCTCTTTCTCAGCTTAGG - Intronic
1072544619 10:96426865-96426887 TGTTTCCTTGTGCTCTCCTTAGG + Intronic
1074060323 10:109959594-109959616 TGTTCACTTTTCCGTTCGTTAGG + Intergenic
1074314857 10:112351961-112351983 CGTGAACTTTTTCTTTCCTTGGG + Intergenic
1075323136 10:121508414-121508436 TGTTAAATTTTTCTCTTCTGAGG - Intronic
1075984625 10:126773842-126773864 GGTTCACATTTTCTTTCCTTGGG + Intergenic
1076210465 10:128638837-128638859 TCTTTATTTTTTCTTTCCTTTGG - Intergenic
1076504007 10:130959921-130959943 TGTTCACTTTTCTAATCCTTAGG - Intergenic
1077717109 11:4592644-4592666 TGTTTAGTTACTCTCTCCTTAGG - Intergenic
1079005040 11:16785596-16785618 AGTTCCCTTTCTCTCCCCTTGGG + Intronic
1079305253 11:19316015-19316037 TGTTTACCTTCTCTGTCCTTTGG + Intergenic
1079507314 11:21167909-21167931 TGCACCCTTTTTCTCACCTTAGG + Intronic
1079540803 11:21572096-21572118 TATTGACTTTTTTTGTCCTTGGG - Intronic
1080171779 11:29312495-29312517 TGTTCCCTGTTTCTTTCTTTTGG - Intergenic
1080537390 11:33235399-33235421 TAAGCACATTTTCTCTCCTTTGG + Intergenic
1081048372 11:38305776-38305798 TGCTCACTTTCTCTCTCTTTTGG + Intergenic
1081154532 11:39673712-39673734 TGTTCCCTTCTTCTCTCTGTAGG - Intergenic
1081246184 11:40769979-40770001 TGTTCATTTTTGCTCTGGTTGGG - Intronic
1081296130 11:41391728-41391750 TGTTTACTTTTTATTTCCTGAGG - Intronic
1082603944 11:55199694-55199716 TATTTCCTTTTTTTCTCCTTAGG + Intergenic
1082759770 11:57116121-57116143 TATTCATTTTTTCTTTCCTTTGG - Intergenic
1083381884 11:62275896-62275918 TGTTCAGTTTTTCCCTACATGGG - Intergenic
1083726130 11:64629380-64629402 TGTCCACCTCTTCTCTCCCTGGG + Intronic
1083814769 11:65126444-65126466 TGTTTTGTTTTTCTTTCCTTGGG + Exonic
1084448701 11:69219392-69219414 AATTCACATTTTGTCTCCTTTGG + Intergenic
1085554849 11:77410967-77410989 TGGCCAGTTTTTCTGTCCTTAGG - Intronic
1086534110 11:87822634-87822656 TGTTCTCTCTTACTCTCTTTTGG - Intergenic
1086535947 11:87846195-87846217 TGTTTTCTGTTTCTCTTCTTTGG - Intergenic
1086918309 11:92556758-92556780 TGTGACCTTTTTCTCTCCTGTGG - Intronic
1086957222 11:92945934-92945956 TGGTCACTCTGTCCCTCCTTTGG - Intergenic
1087282555 11:96228074-96228096 TGTTCCCTTTTTCTCCCCCCAGG - Intronic
1087570533 11:99921632-99921654 TGTTCATAGTTTGTCTCCTTCGG + Intronic
1088254653 11:107891862-107891884 TGTTCATTTTTTTTTTCCCTTGG + Intronic
1089437663 11:118484161-118484183 TATTCATCTTTTGTCTCCTTAGG + Exonic
1089879154 11:121756842-121756864 TGTTCATTCTTTTTCTCCTCAGG - Intergenic
1090173333 11:124624461-124624483 TGTCCAGTTTTTCTCTATTTGGG + Intronic
1092039952 12:5375220-5375242 AATTCTCTGTTTCTCTCCTTGGG - Intergenic
1092392934 12:8097455-8097477 TCTTCACTTTTTCTGACTTTGGG + Exonic
1092758690 12:11789498-11789520 TGTTCACTTTTTCTCTCCTTCGG + Intronic
1092787552 12:12041490-12041512 TGTTCACTTTCTCTGTCTTCTGG - Intergenic
1092796296 12:12113308-12113330 TATTCATATTTTCTCTTCTTAGG - Intronic
1092897727 12:13029342-13029364 TATTCCCTGTTTCTCTCCTTGGG - Intergenic
1093139497 12:15491566-15491588 TGATCATTTTTTCCCTCATTAGG - Intronic
1093813270 12:23512720-23512742 TGTTCACTTTGTTTCCACTTAGG + Intergenic
1093915019 12:24792017-24792039 TGCACACTTTTTTCCTCCTTTGG - Intergenic
1094503509 12:31040894-31040916 AGTTCACTGATTCTTTCCTTTGG + Intergenic
1094647518 12:32340299-32340321 TTTTTACTTTTTTTCTTCTTAGG - Intronic
1095224130 12:39658838-39658860 TTTTTATTTCTTCTCTCCTTTGG + Intronic
1095224208 12:39660110-39660132 TGTTCTATTTTTCTTACCTTGGG + Intronic
1095480779 12:42633355-42633377 TGTTCCATTTTTCTTTCTTTGGG - Intergenic
1095861058 12:46918451-46918473 TGTTAAGTTCTTCCCTCCTTGGG - Intergenic
1096346965 12:50857292-50857314 TGTTCATCTTTTATTTCCTTGGG + Intronic
1096620375 12:52860928-52860950 TTTTCATTACTTCTCTCCTTTGG - Intergenic
1096806476 12:54144101-54144123 TGCTCCCGTCTTCTCTCCTTAGG + Intergenic
1097289677 12:57904238-57904260 TGTGCACTTTTTTTCTTCTGGGG + Intergenic
1098280700 12:68860194-68860216 TCTTCATTTTTTGTCTCCTGAGG + Intronic
1098949538 12:76625335-76625357 TTTTCATTATTTCTATCCTTGGG - Intergenic
1098984951 12:77001996-77002018 TGTTCACATTTTCTATCTCTCGG - Intergenic
1099110452 12:78553585-78553607 TGTTTTCTTTTCGTCTCCTTGGG - Intergenic
1099175844 12:79420880-79420902 TGAACACTTTTTTTTTCCTTAGG - Intronic
1099321192 12:81151822-81151844 ATTTCACTTTTTCTCTCCTTAGG + Exonic
1100220809 12:92502925-92502947 CGTTCACTTTATCTCTGTTTGGG - Intergenic
1100580773 12:95938377-95938399 TTGTCACATTTTCACTCCTTTGG + Intronic
1100868503 12:98885192-98885214 TTTACTCTTTTTTTCTCCTTTGG - Intronic
1100951513 12:99855221-99855243 TGTTCACTTTTGGTGTCCATTGG - Intronic
1101092279 12:101299946-101299968 TTTTCCCTTTTTCTCCCCCTTGG + Intronic
1101569342 12:105938589-105938611 TGCTCATATTTTCTCTACTTGGG + Intergenic
1101748428 12:107562212-107562234 TGTTCCTTTTTTGTCTCCTTTGG - Intronic
1101929939 12:109005747-109005769 TGTCCCCTTGATCTCTCCTTGGG - Intronic
1102069890 12:110009764-110009786 TGTTAACTTTTTTTCTACTTCGG - Intronic
1102304128 12:111791899-111791921 CGTTCACTTTTTTTTTCTTTTGG - Intronic
1102486022 12:113257669-113257691 TGTACACTTTTTGTTTCTTTTGG - Intronic
1102772636 12:115491899-115491921 TGCTCACTTCTTCTCTCCAGTGG - Intergenic
1103900684 12:124302351-124302373 TGTTCACCGTTTCTCTGCCTTGG + Intronic
1104231287 12:126886942-126886964 TGTTTTTTTTTTCTCTCCTTTGG + Intergenic
1105435888 13:20378126-20378148 TGTGCAATTTGTCTCCCCTTAGG + Intergenic
1105521198 13:21132230-21132252 TGTACATTTCTTCTCTCTTTCGG - Intergenic
1107346422 13:39466265-39466287 TGTTCCATTTTTCTCTACCTGGG - Intronic
1107620559 13:42224735-42224757 TCTATACTTTTTCTCACCTTGGG + Intronic
1108074887 13:46669631-46669653 TGTTCTCCTTTTCTATCCCTAGG - Intronic
1108451252 13:50566798-50566820 TCTGCACATTTTCTGTCCTTTGG + Intronic
1108965994 13:56302544-56302566 TGTTCACTGTTTCTTTTATTGGG + Intergenic
1109278803 13:60331742-60331764 TGTTCTCTTGTTTTCTCTTTTGG - Intergenic
1109738524 13:66519632-66519654 TGTTGTCTGTTTCTCTCCTAGGG - Intronic
1110096625 13:71532031-71532053 TGTTCACTCTCTCTTTCATTTGG + Intronic
1110100424 13:71594670-71594692 TGAGGACTTTTTTTCTCCTTAGG + Intronic
1110861129 13:80345565-80345587 TTTTCAATTTATCTATCCTTTGG + Intergenic
1110946247 13:81422613-81422635 TTTTCTCTTTTTTTCTCCTGAGG + Intergenic
1111220159 13:85194446-85194468 TCATCACTCTTTCCCTCCTTGGG + Intergenic
1111471884 13:88694680-88694702 TGTACTGATTTTCTCTCCTTAGG + Intergenic
1111576354 13:90158824-90158846 TGTTAACTTTCTCTCTTCTAAGG - Intergenic
1112124442 13:96448924-96448946 TTTTCATTTTGTCTCACCTTTGG + Intronic
1113001890 13:105648696-105648718 TGTAAACTTATTCTCTCCTCAGG - Intergenic
1113408616 13:110064301-110064323 GGTTTTGTTTTTCTCTCCTTGGG + Intergenic
1113567534 13:111327701-111327723 TCTTCCCTTTTTCTCCCTTTGGG + Intronic
1114014216 14:18411393-18411415 TTTTCACTTGTTCTCACATTGGG - Intergenic
1114300277 14:21370207-21370229 TGTTTACATTTTATCCCCTTTGG - Intronic
1114748855 14:25181336-25181358 TCCTCACTTTTCCTATCCTTTGG + Intergenic
1114845462 14:26315248-26315270 TGTTCAAGTTATCTCTTCTTGGG - Intergenic
1114848819 14:26357957-26357979 TGTTCATTTTGTATCTTCTTTGG + Intergenic
1116663224 14:47739153-47739175 TATTCACCTTTACTCTCCTAAGG + Intergenic
1116982238 14:51183935-51183957 TCTTCACTATTTCTGTCCTTGGG - Intergenic
1117004389 14:51403922-51403944 AGTTCACATCTTCTCTCCTATGG - Intergenic
1117952925 14:61100809-61100831 AGTTCCCTTTCTCTTTCCTTGGG + Intergenic
1118141023 14:63082813-63082835 TATTGACTTTTTTTTTCCTTTGG - Intronic
1118451165 14:65903775-65903797 TGTTCTCTTTTGCCCTCTTTAGG - Intergenic
1118524528 14:66624001-66624023 TGTAGACTTTTTCTCTCCTTTGG - Intronic
1118634858 14:67738949-67738971 TATTCAATTGTTCTCGCCTTGGG + Intronic
1119244008 14:73087799-73087821 TTTTCCCTTTTTTTCCCCTTTGG + Intronic
1119799994 14:77435492-77435514 TGTTCTTTGTTTCTCTCCTAGGG - Intronic
1122396774 14:101438947-101438969 TCTTTTGTTTTTCTCTCCTTAGG + Intergenic
1124408942 15:29419522-29419544 TGTTCTCTTTTTCTCTGAATGGG - Intronic
1125246010 15:37641047-37641069 TTTTCTCCTTTTCCCTCCTTTGG + Intergenic
1125400452 15:39296733-39296755 TTTTCACTTGCTCTTTCCTTGGG - Intergenic
1127011614 15:54636666-54636688 TGATCTCTTTTTCTCTCTCTGGG - Intergenic
1129232917 15:74206588-74206610 TGAGCACTTTTGCTCTCCTGAGG - Intronic
1131087840 15:89591925-89591947 TGTGCACTTTGTATGTCCTTTGG + Intronic
1131747568 15:95465673-95465695 TTTTTACTTTTTCTATCCTTTGG + Intergenic
1132008581 15:98253924-98253946 TGTTTCCTTTTTCTCTCTTTTGG - Intergenic
1132762241 16:1515043-1515065 TTTTCTTTTTTTCTGTCCTTTGG - Intronic
1133849834 16:9492379-9492401 TGATCAATTTTTCTAACCTTTGG - Intergenic
1134149170 16:11792203-11792225 TGTTCAAAGTATCTCTCCTTGGG - Intronic
1137483759 16:48874682-48874704 TTTTCTCTTTTTCTGTCCATTGG + Intergenic
1137597638 16:49735407-49735429 TGTCTACTTTCTCTCTCCCTTGG + Intronic
1137604978 16:49781215-49781237 TGGTCTTTTTTTTTCTCCTTTGG - Intronic
1137942170 16:52699034-52699056 TAGTCATTGTTTCTCTCCTTTGG - Intergenic
1137948070 16:52753696-52753718 TGTGCATTTGTTCTCTGCTTTGG - Intergenic
1138737509 16:59267621-59267643 TGCTCACTGTTTCCCTCATTTGG - Intergenic
1138769344 16:59645202-59645224 TAGCCACTTTTTCTTTCCTTTGG + Intergenic
1138987141 16:62343414-62343436 AGATCATTTTTTTTCTCCTTGGG + Intergenic
1139342180 16:66274798-66274820 TGTTGACTTTTGCTTTCCCTTGG - Intergenic
1139740221 16:69029055-69029077 TGTTCTTTTTCTCTCTCCTAAGG + Intronic
1140011698 16:71138402-71138424 TGCTTACTTTTTCTTTCTTTGGG - Intronic
1143179105 17:4973283-4973305 TGCCCACTTTTTCCCTCATTGGG - Intronic
1143271506 17:5678846-5678868 TCTTCACTATTTCTCCCTTTTGG + Intergenic
1143685416 17:8510730-8510752 TGTTCTCTTTCTCTCTTCTTTGG - Intronic
1144170265 17:12653135-12653157 TGTCCTCTTTTTTTTTCCTTTGG - Intergenic
1145728247 17:27153631-27153653 TGTACCATTTTTCTCTGCTTAGG - Intergenic
1146547506 17:33751670-33751692 GGTTTACTTTTTCTTTCCTTTGG + Intronic
1146648499 17:34591474-34591496 TTTTAAGTTTTTCTCTCCCTGGG + Intronic
1147008826 17:37427139-37427161 TCTTTACCTTTTCTCCCCTTCGG + Intronic
1147265626 17:39232595-39232617 TGTTCACTTTTTCCTGCCTTTGG - Intergenic
1149099973 17:52893946-52893968 TCGTCACTTTTACTTTCCTTTGG + Intronic
1149507840 17:57210832-57210854 TATTCAGTGTTTCTCTCATTAGG - Intergenic
1150576051 17:66431985-66432007 CGTTCCCTTTTTTTATCCTTAGG + Intronic
1150869396 17:68888944-68888966 TGTCCATTGTTTGTCTCCTTTGG - Intronic
1153235086 18:2978472-2978494 TGTTGAATTTGTCTCTACTTCGG - Intronic
1153443594 18:5148381-5148403 TTTTCTCTTTTGCTCTCTTTTGG - Intronic
1155094823 18:22545468-22545490 TCTTCACTTCTTCTGTCTTTAGG - Intergenic
1155738049 18:29249068-29249090 TGTTCAGTTATTCTCTCTTTTGG + Intergenic
1155923335 18:31627924-31627946 TGGTCACGTTTTCTCTGCTCTGG - Intronic
1157139521 18:45091761-45091783 TTTTCACTTTTTTCCTCTTTAGG - Intergenic
1157177241 18:45462977-45462999 TGTTAACTTTTTGTTTCCCTCGG + Intronic
1157735644 18:50046363-50046385 GGTTCAGTTTTTCTCAACTTTGG - Intronic
1158129354 18:54135607-54135629 GCTTCACTTTTTCTAGCCTTTGG - Intergenic
1158743122 18:60166056-60166078 TGATCACTGTTTCTTTCCTTAGG - Intergenic
1158794620 18:60829379-60829401 TATTCACTTTTATTCTTCTTTGG - Intergenic
1158902515 18:61979073-61979095 ATTTCACTTTTTTTCTACTTTGG + Intergenic
1159858947 18:73623678-73623700 TTTTGACTTTTTCTCTCTATTGG - Intergenic
1160210327 18:76873180-76873202 TTTTTACTTTATCTCTACTTTGG - Intronic
1161527311 19:4764508-4764530 TGTTCAGTTTTTCTCCTCTCTGG - Intergenic
1161669409 19:5596877-5596899 TGCTCGCTCTTTCTCTCCTATGG - Intronic
1161729086 19:5947913-5947935 TTTTCACTGTTTCATTCCTTAGG - Intronic
1162218090 19:9153103-9153125 TCTTCACTTTTGCTTTCCCTAGG + Intronic
1162839828 19:13348285-13348307 TCTTCTCTATTTCTCTCCTTTGG - Intronic
1163076067 19:14892821-14892843 TGTTCTCTTTCTCTCTCTTTTGG - Intergenic
1163821099 19:19497026-19497048 TGTTGACTTTTTTTCTTTTTTGG + Intronic
1164184699 19:22854306-22854328 TGATCTCTTCTTCTCTCATTTGG + Intergenic
1164518275 19:28955246-28955268 TGTTCATCTTCTCTCTCTTTGGG + Intergenic
1164761525 19:30731851-30731873 AGTTCACATTTTACCTCCTTTGG + Intergenic
1164871025 19:31643048-31643070 TGTTCCCTTTCTCTGTCCTTTGG + Intergenic
1165268854 19:34687353-34687375 TGGTCTCTTTGTTTCTCCTTAGG - Intergenic
1165987931 19:39786942-39786964 GGTTCACTGCTTCTCTCCTGGGG - Intergenic
1167500192 19:49841977-49841999 TTTTCACTATTTCTTGCCTTAGG - Intergenic
925835650 2:7943803-7943825 TGGGCACTTGTTCACTCCTTGGG + Intergenic
926544527 2:14223183-14223205 TGTGCACTTCTTATGTCCTTTGG + Intergenic
926680525 2:15660164-15660186 TGTTCACTTTTTCATTGCTTTGG - Intergenic
928268641 2:29834284-29834306 TTTTCACTTTTTTTCTAATTGGG - Intronic
928455691 2:31419475-31419497 TTATCATTTTTTTTCTCCTTTGG + Intergenic
928464395 2:31508377-31508399 TGTTTTCTTTTTTTCTCCCTTGG - Intergenic
928829186 2:35458457-35458479 TGTTCATTTTGTGTCTTCTTTGG - Intergenic
929702505 2:44176105-44176127 GGATCTCTTTTTCTCTCTTTGGG - Intronic
932005114 2:67919770-67919792 TGTTCACTTTTTCTAGCATGTGG + Intergenic
933306780 2:80610277-80610299 TATTCATTTTTTTTCTCCATTGG - Intronic
933540323 2:83632591-83632613 TGTTCTTTTTCTATCTCCTTGGG + Intergenic
935036675 2:99383371-99383393 TTGTCTCTTTCTCTCTCCTTGGG + Intronic
935352764 2:102167984-102168006 TGTTCACTTTTTTTTTGATTGGG + Intronic
935360275 2:102240808-102240830 TGTTCACTTCTACTATCCTGTGG - Intergenic
935511399 2:103980263-103980285 TGTTGACTTTTTTTCTTCTTTGG + Intergenic
935553813 2:104485340-104485362 TGTTTGTTTTTTGTCTCCTTAGG + Intergenic
935954722 2:108364318-108364340 TGCTTACTTTTTCTCTCTATAGG - Intergenic
936654857 2:114473092-114473114 TTATCATTTTTTTTCTCCTTTGG + Intronic
939034453 2:137113829-137113851 TTTTCACTTTTTTTTTCCCTAGG - Intronic
939088853 2:137754891-137754913 TTTTCTCTTTTACTATCCTTAGG + Intergenic
940396261 2:153196050-153196072 TGTGCACTTTCTCCCTTCTTAGG - Intergenic
940927091 2:159376394-159376416 TTTTCACTTTTTTTTTCATTGGG - Intronic
941034297 2:160550876-160550898 TGTTCTCTTGTACCCTCCTTGGG + Intergenic
941044060 2:160652798-160652820 TTCTCACCTTTTCTCTCCTTTGG + Intergenic
941091952 2:161187078-161187100 TATTCACTCTTGCTCTCTTTTGG - Intronic
941799131 2:169635606-169635628 TGTTCACTTATTCAACCCTTAGG - Intronic
942142950 2:172996142-172996164 TGTTCCTTTTTATTCTCCTTTGG + Intronic
942146947 2:173036103-173036125 TCATCTCTTTTTCTCTCCTAAGG + Exonic
942517619 2:176770147-176770169 TCTTCCCTTTTTTTCTCCCTGGG - Intergenic
943035070 2:182733628-182733650 TTATCTCTTTTTCTCTTCTTTGG + Intronic
943212424 2:184985005-184985027 AGTTCACTTGTATTCTCCTTTGG + Intergenic
943345228 2:186731062-186731084 TGTTCAGTTTGTCTCTCATGCGG + Intronic
943770806 2:191714250-191714272 TATTGACTTTTTCTTCCCTTAGG + Intergenic
943930546 2:193845843-193845865 TGGTGACTTTTTCTCTTCTCAGG + Intergenic
943986732 2:194631507-194631529 AGATCATTTTCTCTCTCCTTAGG + Intergenic
944349493 2:198710033-198710055 TGCTCAATTTGTCTCACCTTAGG + Intergenic
944568931 2:201022946-201022968 TGTTCACTTTTGTTTTCCTTTGG - Intronic
944607452 2:201364858-201364880 TGTTCACTTTTTTCCTTCTCAGG - Intergenic
945470510 2:210223742-210223764 TTTTCACTTTTTTTCTGTTTAGG + Intronic
945666504 2:212750486-212750508 TTTTCTCTCTCTCTCTCCTTAGG + Intergenic
945698758 2:213143473-213143495 TTTTCCCTTTTTTTCTCTTTTGG + Intronic
946093937 2:217255847-217255869 TGTTCATGTTTTCTCTTCATAGG + Intergenic
946120401 2:217507761-217507783 TCTTCACTTTTTTTCTACTCTGG + Intronic
946598785 2:221336426-221336448 TTTTTTCTTTTTCTCTCCGTGGG - Intergenic
946717323 2:222566320-222566342 TGTTCAGGTATTCTCTGCTTTGG - Intergenic
948502280 2:238404510-238404532 TGATCGCATTTTGTCTCCTTTGG + Intergenic
948973145 2:241444887-241444909 TGTGCCTTTTTTCTTTCCTTGGG + Intronic
1170086522 20:12538844-12538866 TTTTCTCTTTTTCTATCCTGTGG - Intergenic
1171073476 20:22098771-22098793 CTTTCTCATTTTCTCTCCTTTGG - Intergenic
1171859983 20:30390300-30390322 TGTTCACAATTTCTCTACTGGGG - Intronic
1171934565 20:31261631-31261653 TCATCTCTTTTTCTCTCATTAGG + Intergenic
1172677861 20:36687338-36687360 TCCTCATATTTTCTCTCCTTGGG - Intronic
1172917033 20:38450858-38450880 TGTTGACTTTTTCTGTGCTATGG + Intergenic
1172988078 20:39009159-39009181 TGTTAACTTTGTTTCTCCTTTGG + Intronic
1173355770 20:42288453-42288475 TGTTCATTTGTTCACTCTTTGGG - Intronic
1173373984 20:42466484-42466506 ATTTCAGTTTTTATCTCCTTAGG - Intronic
1173483102 20:43418836-43418858 TTTTCTCTTTTTCTTTCTTTTGG - Intergenic
1175302557 20:57953121-57953143 TCTTCTCTTTGTCTCTACTTCGG - Intergenic
1175332647 20:58175896-58175918 TGGTCACTTGTTCTGTCCCTGGG + Intergenic
1175509334 20:59512275-59512297 TTTTCACTTCTTTTCTCTTTAGG + Intergenic
1175641793 20:60636269-60636291 TGTTCATTTTTTTTCTGCCTGGG - Intergenic
1175736162 20:61388964-61388986 ATTTGAATTTTTCTCTCCTTAGG + Intronic
1175929598 20:62487476-62487498 TGTTCACACTTTCTTTACTTGGG + Intergenic
1177259668 21:18713170-18713192 TGGCCAATTTGTCTCTCCTTTGG + Intergenic
1177333166 21:19687403-19687425 TGTTTAATATTTCTCTCTTTGGG + Intergenic
1177806526 21:25880287-25880309 TTTTCCCTTTGTCTCTCATTTGG + Intergenic
1178420718 21:32441212-32441234 TGTTGCCTGTTTCTCCCCTTTGG - Intronic
1178670342 21:34584689-34584711 TTTTCAGTTTTTACCTCCTTTGG - Intronic
1179134970 21:38671473-38671495 AGTTCACATTTTCTTTTCTTTGG - Intergenic
1179570844 21:42278146-42278168 TTTCCACATTTTCTCTCTTTTGG - Intronic
1179669328 21:42934902-42934924 TGTTCTCTTTTTTTCTACCTTGG - Intergenic
1180438713 22:15342199-15342221 TTTTCACTTGTTCTCACATTGGG - Intergenic
1181294384 22:21823781-21823803 AGTTCAGTTTTTCTCTTATTTGG - Intronic
1182524036 22:30904643-30904665 TGTTCATACTTTCTCTACTTGGG - Intronic
1182884165 22:33759098-33759120 TGTTCTATTTTTCTCTGCCTTGG - Intronic
1183042712 22:35194324-35194346 TGTGCAGATTTTCTTTCCTTAGG + Intergenic
1183761093 22:39818809-39818831 TTTTTACTTTTTTCCTCCTTAGG + Intronic
1183776127 22:39967222-39967244 TGGTAACTTCTTTTCTCCTTTGG - Intronic
1183989540 22:41588976-41588998 TGCTCAGTTTTTCTCCCATTGGG - Intronic
1184194489 22:42917626-42917648 TGTTCACTTTTTTTTTTGTTTGG - Intronic
1184619482 22:45664617-45664639 AGTTCATTTATTCTCTCTTTAGG + Intergenic
949093566 3:59159-59181 TGTACACTTTTCTTCTACTTTGG - Intergenic
949166974 3:954497-954519 GGTTCCCTTTTTATCTGCTTAGG + Intergenic
950453352 3:13078186-13078208 TGTTCACTGGTTCTCTCCCCAGG - Intergenic
950913993 3:16624885-16624907 TGTTCATTTTTGCTTTGCTTTGG - Intronic
950943507 3:16919563-16919585 TCTTTACTTTTTCTTTCTTTGGG + Intronic
950986332 3:17372247-17372269 TGTTCAATTTTTCTGTTTTTAGG - Exonic
951796031 3:26539346-26539368 TGTTCCTTTTTTCCTTCCTTAGG - Intergenic
952624394 3:35386711-35386733 TGTTAATTTTTTATCTCATTAGG + Intergenic
952808584 3:37381003-37381025 AGTTCACTGATTCTTTCCTTTGG + Intergenic
953355115 3:42249361-42249383 AGTTCCCCTTTTCACTCCTTGGG - Intergenic
953485334 3:43289251-43289273 TTTTCCCTTTTTCTCTGCCTGGG - Intronic
954193029 3:48977836-48977858 TGTTCAATTTTTCTCCTCCTGGG - Intronic
954890076 3:53919228-53919250 TTTTCTTTTTTTCACTCCTTAGG + Intergenic
954980521 3:54741260-54741282 TGTTCTATTTTTCTCTCTTTAGG + Intronic
955342830 3:58138615-58138637 TCTTCACCTTTTTTTTCCTTTGG + Intronic
956792295 3:72689491-72689513 TGTTCAGTGTTGGTCTCCTTTGG + Intergenic
956873755 3:73442385-73442407 TGTTCTCCTTTTCTCTCCTTAGG - Intronic
956929875 3:74030893-74030915 TATTCACTTTGTTTCTCTTTTGG + Intergenic
957578649 3:82041995-82042017 TGTTCACTTTTGTTCTCTTTTGG - Intergenic
957616516 3:82534980-82535002 TTTTCACTTTTTCACTCCGTTGG + Intergenic
957827857 3:85472608-85472630 TGTTAACTATTATTCTCCTTTGG + Intronic
959480179 3:106862946-106862968 TGTTCACTGCTTTTCTTCTTGGG - Intergenic
959738984 3:109694298-109694320 TGTTGACTTTTTCTCCTCTTAGG + Intergenic
959767952 3:110055770-110055792 TGTTCATTTTTTGTCTTCTTTGG - Intergenic
960239148 3:115319844-115319866 AGATCACTTTCTGTCTCCTTTGG - Intergenic
960571383 3:119188294-119188316 TTCTCACTGTGTCTCTCCTTTGG - Intronic
960617489 3:119609291-119609313 TAATCACTTTTTCTCTTCCTGGG - Intronic
960647615 3:119905975-119905997 TGATGACTTTTTCTCTGTTTTGG - Intronic
960808834 3:121609607-121609629 TCTTCCTTTTTTCTCTCCTCAGG + Intronic
960830018 3:121835801-121835823 TCATCACTTTTTCTCACCTCTGG + Intronic
962363050 3:134757584-134757606 TGTACATTTTTTCTGTCTTTAGG - Intronic
962819563 3:139035175-139035197 TGTTCACTTTTGATTTCCTTAGG + Intronic
963293860 3:143523067-143523089 TTTTCTCTTTTTCTCCCCATGGG - Intronic
963636463 3:147803498-147803520 TGCTCACTTTATCTTACCTTGGG - Intergenic
963926438 3:150956497-150956519 TTTTCGCTTTCTCTCTCCTGTGG - Intronic
964473502 3:157078036-157078058 TTTGCCCTTTTTCTCCCCTTAGG - Intergenic
965474191 3:169133710-169133732 TGTTCACATTTTCTTTTCCTTGG + Intronic
965876925 3:173335414-173335436 TTTTCACTTATTCTCTCTTTTGG - Intergenic
965877776 3:173348694-173348716 TGGTTACTCTTTCTCTCTTTTGG + Intergenic
966023494 3:175245454-175245476 TTTTAACTTTTTTTGTCCTTTGG + Intronic
966122507 3:176537602-176537624 TTTTCTGTTTTTCTCTCATTTGG - Intergenic
966130537 3:176633371-176633393 TGTTTACTTCTTTTCTACTTGGG - Intergenic
966363278 3:179152637-179152659 TGTTCATTTCCTTTCTCCTTAGG + Intronic
966475595 3:180341566-180341588 TGTGTCCTTTTTTTCTCCTTTGG - Intergenic
966529233 3:180956076-180956098 AGTTCTCTTTTTCTTTCATTTGG - Intronic
966661178 3:182416689-182416711 TGTTCAATATTTCTATTCTTTGG + Intergenic
966675322 3:182579962-182579984 TCTTCACTTTTTAGCTGCTTTGG + Intergenic
967015799 3:185480560-185480582 TGTTCCCTTTTTTGCTCTTTGGG + Intronic
967386946 3:188921145-188921167 TGTACTCTTTTTCTCTCTCTGGG + Intergenic
967394201 3:188988809-188988831 TTTTCAATTTTGCTCTCTTTTGG + Intronic
967882730 3:194313458-194313480 TGTTCTCTTTTCCTCTCTTTGGG - Intergenic
968130589 3:196190653-196190675 TGTCTCCATTTTCTCTCCTTGGG - Intergenic
969207555 4:5658282-5658304 TGTTCACTTGTTCTTTGATTGGG - Intronic
970180327 4:13384752-13384774 TGTTCATTCTTTCTCATCTTTGG - Intronic
970232942 4:13929394-13929416 TGTTCTCTGTTTCTCTGCTTCGG - Intergenic
970561569 4:17286794-17286816 TGTTCACAGCTTATCTCCTTGGG - Intergenic
971551452 4:27962778-27962800 TGTTTATTTTTTCTTTCCATGGG + Intergenic
972152939 4:36117798-36117820 TCTTCACTTTGTCTGTCTTTTGG - Intronic
972162122 4:36239865-36239887 TGGACTTTTTTTCTCTCCTTTGG + Intronic
973228590 4:47815871-47815893 TGTTAACTGTTTGACTCCTTTGG - Intronic
974156470 4:58079720-58079742 TTTTTTTTTTTTCTCTCCTTTGG - Intergenic
974235218 4:59172258-59172280 TGTTAGCTTTTTCTCTCAGTAGG - Intergenic
974854071 4:67438549-67438571 TGTTCAGTTTTTTACTTCTTAGG - Intergenic
975046505 4:69810867-69810889 TGTTAATATTTTCTTTCCTTAGG - Intronic
975499931 4:75073442-75073464 GTTTCCCTTTGTCTCTCCTTTGG - Intergenic
976275515 4:83273294-83273316 TGTTCATTTCTTAACTCCTTTGG + Intronic
976898255 4:90138812-90138834 TGTTCACTTTTTAAGACCTTTGG + Intronic
977048447 4:92095717-92095739 TGCTTGCTTTTTCTCACCTTAGG - Intergenic
977406277 4:96603330-96603352 TGTTTATTTTTTCTTTCCCTGGG + Intergenic
977854991 4:101878472-101878494 TGAGGACTATTTCTCTCCTTAGG - Intronic
978113113 4:104986414-104986436 TGTTCACTATTTCTCAACCTTGG + Intergenic
979036040 4:115719646-115719668 TTTTTTCTTTTTTTCTCCTTTGG + Intergenic
979097046 4:116563711-116563733 TGTTTATTTTTTCTCATCTTTGG - Intergenic
979402786 4:120270548-120270570 TTTTCACTTCTTCTATTCTTTGG + Intergenic
980395191 4:132203999-132204021 TGTTAACATTTTCTCACTTTAGG + Intergenic
980577761 4:134707601-134707623 TGTGCACTTTTTATCTCCTTTGG + Intergenic
981195728 4:141918313-141918335 TGTTGACTTTTAATTTCCTTTGG - Intergenic
981792557 4:148555234-148555256 TCTTCACTTTTTCTATGATTGGG + Intergenic
981844176 4:149147766-149147788 TTTTGACTTTTTATTTCCTTAGG - Intergenic
983014135 4:162588971-162588993 TGGTCATTTATTCTATCCTTTGG - Intergenic
983451372 4:167915336-167915358 TGTTCTCTTTTTATGTACTTTGG - Intergenic
983597848 4:169490765-169490787 TCTTCACTTTTTCTCTATCTGGG - Intronic
983729967 4:170980345-170980367 AGTTCATTTTTTTTCTCATTTGG + Intergenic
984923694 4:184787862-184787884 TGTGCACTTTTTTTTTTCTTTGG - Intronic
985011160 4:185583508-185583530 TGTTCGCTATTTCTTTCCCTCGG + Intergenic
985604701 5:852459-852481 TGCTCACATTTTCTCTAATTTGG - Intronic
986997591 5:13625010-13625032 TTTTCACTTTTTCTTTGGTTAGG - Intergenic
987610950 5:20201799-20201821 TCTGCACTTTTTCTCTTCTATGG - Intronic
987626956 5:20414509-20414531 TGTTCACTCTCTCACTCTTTGGG + Intronic
987670924 5:21007287-21007309 TGTTAACTTCTTCTTTCCTCTGG + Intergenic
987799313 5:22673018-22673040 TTTTCATTTTTTTTCTCTTTTGG + Intronic
987849637 5:23333791-23333813 TCATCACTTTTTTTTTCCTTTGG + Intergenic
987897351 5:23964697-23964719 TATTCACTTTTTCTCTATTAAGG - Intronic
987982398 5:25103121-25103143 TCATCTCTTTTCCTCTCCTTAGG - Intergenic
988774300 5:34463473-34463495 TGGTCACTCTGTCCCTCCTTTGG - Intergenic
988799912 5:34686850-34686872 TGTCCTTTTTTTCTCTGCTTAGG + Exonic
989218517 5:38929319-38929341 TGTTAACTTTTTCTCGGATTAGG + Intronic
989263647 5:39447538-39447560 TTTTTTTTTTTTCTCTCCTTTGG - Intronic
989470468 5:41811536-41811558 TATTCACTTTCTTGCTCCTTTGG - Intronic
990019604 5:51108751-51108773 TGTGCAATTTTTTTCTCCTTAGG + Intergenic
991579724 5:68141952-68141974 TTTTCACTTAGTCTTTCCTTGGG - Intergenic
993012584 5:82500131-82500153 TGTTTCCTTTTTCTTTCCTATGG + Intergenic
993054414 5:82965609-82965631 TGTTCACTTTTTTGGTCCTCAGG - Intergenic
993323852 5:86509838-86509860 AGGTCAATTTTTCTCTACTTAGG - Intergenic
994638910 5:102380483-102380505 TGTTCAATTTTTTCCTCCTGGGG - Intronic
994810697 5:104515347-104515369 TGGTCACTCTGTCTCTCTTTGGG + Intergenic
995090201 5:108165880-108165902 TGTTCCCATTTTCTGTGCTTTGG - Intronic
996199791 5:120657738-120657760 TCCTCACTTCTTCTGTCCTTGGG - Intronic
996248720 5:121299877-121299899 TCTTTATGTTTTCTCTCCTTTGG - Intergenic
996617748 5:125461468-125461490 TGTTCTACTTTTCTCTCATTAGG - Intergenic
997417609 5:133741040-133741062 TGCTCTCTTTTCCTCTCCTTTGG - Intergenic
997705479 5:135947884-135947906 TGTACTCTATTTCTCTACTTGGG - Intronic
997785194 5:136704282-136704304 TGTTGCCTTTTTCTCACGTTAGG - Intergenic
998425503 5:142024869-142024891 AGTTCACTTTTTTTTTCTTTTGG - Intergenic
998722302 5:144966789-144966811 GATTCAATTTTTCTCTCTTTAGG - Intergenic
999484106 5:151976785-151976807 TTTGCACTTTTTTTTTCCTTTGG + Intergenic
999624330 5:153504520-153504542 TGTTGACTTTTTGTCTGCATTGG - Intronic
999976988 5:156921729-156921751 TGTTCACTTTCTCTGTTCTTTGG - Intronic
1001110514 5:168892434-168892456 TGAAGACTTTTTCCCTCCTTTGG - Intronic
1001341484 5:170850447-170850469 TCATCTCTTATTCTCTCCTTAGG - Intergenic
1001657271 5:173361356-173361378 TGTTCTGTTTTTCTCTCCAGTGG - Intergenic
1002278220 5:178116430-178116452 CCTTCCCTTTGTCTCTCCTTAGG - Intronic
1002306015 5:178283664-178283686 TGTTTGCTTTTCCTCTTCTTTGG - Intronic
1003103941 6:3199447-3199469 TGTTGATTTTATCTCACCTTGGG + Intergenic
1003250019 6:4419200-4419222 TGTTCCCTTTTTCTATCCCTGGG - Intergenic
1003309908 6:4961594-4961616 TGTTCTCTTTTTGCCTCCTCTGG + Intergenic
1003983261 6:11409760-11409782 TGTTTACTTTTTTTTTCTTTTGG + Intergenic
1004269338 6:14179915-14179937 TTTTCACTTTTTGTCTCCATGGG + Intergenic
1004973017 6:20933067-20933089 ATTCCATTTTTTCTCTCCTTGGG - Intronic
1005025189 6:21455927-21455949 TGTTCTCTTTTTTCCCCCTTGGG + Intergenic
1006013971 6:31066035-31066057 TACTCACTTTTTATCTCATTTGG + Intergenic
1007434179 6:41796732-41796754 TTTTCTCTCTTTTTCTCCTTTGG - Intronic
1007689857 6:43693586-43693608 TGGTCTCTTTTTCTGTCATTCGG + Intergenic
1007747527 6:44052042-44052064 TGTTCACCTTTTCGCACCCTTGG + Intergenic
1007825294 6:44595447-44595469 TGTCTAATTTTTCTCTCCTGAGG - Intergenic
1007929454 6:45677309-45677331 TGCTGAATTTTTCTCTCCTCAGG + Intergenic
1008180906 6:48327605-48327627 TGTTCATTTGTTATCACCTTTGG + Intergenic
1008664759 6:53705346-53705368 TGGTCTCTGTTTCTCTTCTTTGG + Intergenic
1008871757 6:56280468-56280490 TGTTCACTTTTCATCTCCAGCGG - Intronic
1008921348 6:56846624-56846646 TGTTTACTTCTTATCTCCTAGGG - Intronic
1010066072 6:71684118-71684140 TTTTCACATTTTCTCCCCTGGGG + Intergenic
1010165509 6:72910749-72910771 TGTTCACTTTTATCCTCTTTCGG - Intronic
1010232545 6:73547768-73547790 TGATAACTTTTTTTCTCCCTGGG + Intergenic
1012168677 6:95991028-95991050 TGTTCAATTTTTTTTTCCTAAGG - Intergenic
1012405553 6:98893103-98893125 TGTTTACCTTTTCTCTGTTTGGG - Intronic
1012904011 6:105043063-105043085 TTTTCACTTTTTTGTTCCTTTGG - Intronic
1013093808 6:106925642-106925664 AGTTCATTTTTTTTCTCCTAAGG - Intergenic
1013902387 6:115173128-115173150 TGTTCACATTCTCTCTTCATAGG - Intergenic
1014405602 6:121046790-121046812 TGGTCACTCTGTCCCTCCTTTGG + Intergenic
1017112902 6:150949398-150949420 TCTTCTGTTTCTCTCTCCTTTGG + Intronic
1017686521 6:156918881-156918903 TGTTCCCTTTTTCTCCCTTGGGG + Intronic
1017756356 6:157532476-157532498 GATTCCCTTTTTCTTTCCTTGGG - Intronic
1017804768 6:157934963-157934985 TGCTCACATTTTCTTTTCTTTGG - Intronic
1018001361 6:159581332-159581354 TGTTCACATTCTCTCTCTTGGGG - Intergenic
1018460455 6:163993917-163993939 TTTTCATTTTGTCTTTCCTTGGG - Intergenic
1018524990 6:164700049-164700071 TGTTCATATTTACTCTGCTTGGG + Intergenic
1018780058 6:167055084-167055106 TGTTCGCTTTCTTTCCCCTTGGG - Intergenic
1020419035 7:7979305-7979327 TGCTCACTTTTTATCTTTTTAGG + Intronic
1020438179 7:8188743-8188765 GGTTCTCTCTTGCTCTCCTTGGG - Intronic
1020692828 7:11378993-11379015 TGCTCACTTTTTTAATCCTTTGG + Intronic
1021020535 7:15592820-15592842 TTTTCACTTTTCTTCTCCTGAGG - Intergenic
1021409045 7:20307314-20307336 TGTTCACTTTGTTTCTCCATGGG - Intergenic
1021531791 7:21654810-21654832 TGTTCTCTTTTTGTCTCCTTGGG + Intronic
1021823390 7:24520072-24520094 TGCTCACGTTTTCCCTCTTTTGG - Intergenic
1021940954 7:25678622-25678644 TCTTCCCCTTTTCTCTCCATGGG - Intergenic
1022308910 7:29176532-29176554 TCTTTACTTTGTCTTTCCTTTGG - Intronic
1023009075 7:35909118-35909140 TGTCCAATTTTTTTTTCCTTAGG + Intergenic
1023212019 7:37816240-37816262 TTTTATTTTTTTCTCTCCTTTGG + Intronic
1023641660 7:42265067-42265089 TGTTCTCTTATTCTCTTTTTGGG + Intergenic
1024026892 7:45418153-45418175 TATACATTTTTTCTGTCCTTAGG + Intergenic
1024223619 7:47306960-47306982 AGTTCACTTTTTCTCTACCAAGG - Intronic
1024331005 7:48155411-48155433 TTTTTATTTTTTCTCTCCCTTGG + Intergenic
1024562707 7:50657962-50657984 TTTTCTGTTTTTCTTTCCTTAGG - Intronic
1026243465 7:68597467-68597489 TGCTTACTTTTTCTCTTCCTGGG + Intergenic
1026647346 7:72183340-72183362 TTTTGACTTTTTCTCTCTTTTGG - Intronic
1027467782 7:78536553-78536575 TGTTTTCTGTTTTTCTCCTTTGG - Intronic
1027600548 7:80234727-80234749 TGTTTACTATTTCTCCCTTTGGG + Intergenic
1028313706 7:89372535-89372557 TGTTCAATTTTTGTCTCTTTTGG + Intergenic
1028610711 7:92708071-92708093 TTTTCGATTTTTCTCTCCTTGGG - Intronic
1029008438 7:97233508-97233530 TGGTCACTTTTTGGCCCCTTAGG + Intergenic
1030351044 7:108487953-108487975 TGTTCACTTTTTCATTCACTAGG - Exonic
1031133395 7:117859587-117859609 TGTGCCCTTGTTCTGTCCTTGGG + Intronic
1031290034 7:119922725-119922747 TGTGCTCTGTTTATCTCCTTAGG - Intergenic
1031960607 7:127986060-127986082 TGTTCACTTTTTCCTTTATTGGG - Intronic
1032399138 7:131611470-131611492 AGTTCTTTTTTTCTTTCCTTTGG + Intergenic
1032753663 7:134867334-134867356 TGTTCACTTTTTCATAACTTTGG + Intronic
1032875989 7:136038705-136038727 AGATCAGTTTTTTTCTCCTTAGG + Intergenic
1033620073 7:143053948-143053970 TTATCACTTTTTCCTTCCTTAGG - Intergenic
1035296418 7:157869353-157869375 TGTAAACTTTTTCTTTACTTTGG - Intronic
1035310847 7:157967711-157967733 TGTTGAGTTTTTCTCTTTTTAGG - Intronic
1035893058 8:3366997-3367019 TGTTTGCTGTTTCTCTCCTCTGG - Intronic
1036496592 8:9275784-9275806 TGGACACTTTTTTTCTCATTAGG + Intergenic
1036764997 8:11543832-11543854 ATTTCACTTTTTTTTTCCTTTGG - Intronic
1036970916 8:13353995-13354017 TCTTCACATTTCCACTCCTTTGG + Intronic
1036973885 8:13387129-13387151 TGTTGACTGTTTCTTTCCTCAGG + Intronic
1037700676 8:21271549-21271571 GGTTTCATTTTTCTCTCCTTAGG + Intergenic
1038037752 8:23700982-23701004 TTCTTACATTTTCTCTCCTTTGG - Intergenic
1038081285 8:24139652-24139674 TTTTCACTTTATCTCTCTTTTGG + Intergenic
1038119185 8:24592667-24592689 TGTGACATTTTTCTCTCCTTGGG - Intergenic
1038274134 8:26105784-26105806 TGTTCTCTTATTCTGTCCATTGG + Intergenic
1038386272 8:27149777-27149799 TCTTCTCTTTGTCTCTCTTTTGG - Intergenic
1038878203 8:31575944-31575966 TTGTAAGTTTTTCTCTCCTTGGG + Intergenic
1039074553 8:33678021-33678043 GGGTGACATTTTCTCTCCTTGGG + Intergenic
1039250153 8:35654730-35654752 TGTTAGCTTTTTCTTTCTTTTGG + Intronic
1041448684 8:57983752-57983774 TTTTCACTTTTTTTTTTCTTTGG - Intergenic
1041576449 8:59401475-59401497 TGGCCATTATTTCTCTCCTTTGG - Intergenic
1041766090 8:61419716-61419738 TATTCTCTTTTTCTTTCTTTAGG + Intronic
1042124862 8:65528088-65528110 TGATCATTTTTTTTCCCCTTTGG - Intergenic
1042998607 8:74729986-74730008 TATTCACATTTTCTATCTTTTGG - Intronic
1043268000 8:78290773-78290795 TGTTTGCTATCTCTCTCCTTTGG - Intergenic
1043538130 8:81228527-81228549 TCTCCACTTTTGCTCTCCTTTGG - Intergenic
1043603433 8:81969887-81969909 TTTTCTCATTTTGTCTCCTTTGG - Intergenic
1043604219 8:81980319-81980341 TGTACACTCTATCTCACCTTTGG + Intergenic
1043659231 8:82714781-82714803 TGTTAACTTTTTTTCTCTCTTGG + Intergenic
1043802473 8:84627486-84627508 TTTTCAGTTTTTATCTCCTAGGG + Intronic
1045258443 8:100550150-100550172 TGGACAGTTTTTCACTCCTTTGG + Intronic
1046141214 8:110095320-110095342 TTTTTACATTCTCTCTCCTTTGG - Intergenic
1047047169 8:121066999-121067021 TATTCACTGTTTTTCCCCTTAGG - Intergenic
1047793449 8:128229890-128229912 TGTTCACTTTTAATATTCTTGGG + Intergenic
1047924206 8:129666715-129666737 AGTTGACTTTTTTTCTCATTAGG + Intergenic
1048152372 8:131906147-131906169 TATTTGCCTTTTCTCTCCTTTGG + Intronic
1048373285 8:133799202-133799224 TGTCCAATTTTTGTCTTCTTTGG + Intergenic
1049499940 8:142956677-142956699 TGTTCCTTTTTTATTTCCTTTGG - Intergenic
1049648874 8:143754101-143754123 TTTTCTCTTTTTCTCTTCTTAGG - Intergenic
1050119659 9:2295458-2295480 TGTTCACAGTTTCGCTTCTTGGG + Intergenic
1050778268 9:9296250-9296272 TTTTGACTTTATATCTCCTTGGG + Intronic
1051575347 9:18609037-18609059 TTTTCTCCTTTTTTCTCCTTTGG - Intronic
1051766041 9:20524847-20524869 TTTTGACTTCTTGTCTCCTTTGG - Intronic
1052007381 9:23364563-23364585 GGTTTACTTTTTTTTTCCTTTGG - Intergenic
1052051884 9:23858540-23858562 CCTTCACTTTTCCTCTCCCTTGG + Intergenic
1053089819 9:35264860-35264882 TCTTCCCTGTTTCTCTCTTTTGG + Intronic
1053617677 9:39785172-39785194 TGTTCTCTATTTCGTTCCTTTGG + Intergenic
1053875859 9:42544539-42544561 TGTTCTCTATTTCATTCCTTTGG + Intergenic
1053896797 9:42750098-42750120 TGTTCTCTATTTCGTTCCTTTGG - Intergenic
1054235840 9:62557183-62557205 TGTTCTCTATTTCATTCCTTTGG - Intergenic
1054266484 9:62922260-62922282 TGTTCTCTATTTCGTTCCTTTGG - Intergenic
1054549980 9:66591710-66591732 TGTTCTCTATTTCATTCCTTTGG - Intergenic
1055610138 9:78014142-78014164 TTTTCTCTTTCTCACTCCTTTGG - Intronic
1055971316 9:81915545-81915567 TGTTCCCTTTGTGTCCCCTTTGG + Intergenic
1056098854 9:83281287-83281309 TTTTCACCTTTCCTCTCCTGTGG + Intronic
1057007967 9:91577273-91577295 TCTACCCTTTTTCTCGCCTTTGG - Intronic
1058709331 9:107665902-107665924 TGTCCCTGTTTTCTCTCCTTTGG + Intergenic
1058801408 9:108547781-108547803 TATTCTCATATTCTCTCCTTTGG - Intergenic
1058847189 9:108972555-108972577 TGAGCATTTTCTCTCTCCTTTGG - Intronic
1059009033 9:110436504-110436526 CTTTCTCTTTCTCTCTCCTTAGG - Exonic
1059209029 9:112494318-112494340 TGTTTTCATTTTCTCTCTTTGGG + Intronic
1059264756 9:113016703-113016725 CCATCTCTTTTTCTCTCCTTGGG + Intergenic
1059359115 9:113726011-113726033 TGTTCATTTTTAATCTACTTTGG + Intergenic
1059888301 9:118771390-118771412 TTCTCACTTTTTTTCTTCTTGGG + Intergenic
1059997038 9:119921220-119921242 TGTTGACTATATCTCTCTTTTGG + Intergenic
1185468090 X:367613-367635 TGGTCGCCTTTTCTCTCGTTTGG - Intronic
1186362249 X:8854434-8854456 TTTTCACTTGTTCTCTTCTTGGG - Intergenic
1187472264 X:19579866-19579888 TGTTCACTTTTCCACTCCCTTGG + Intronic
1188210334 X:27416341-27416363 TATTTATTTTTTTTCTCCTTTGG + Intergenic
1188278668 X:28235483-28235505 TTTTCCCTCTTTCTCTGCTTAGG - Intergenic
1188385742 X:29555438-29555460 TGTTCATTTTTTCTAACTTTGGG - Intronic
1189104871 X:38225156-38225178 TGTTCTCTTCTTCTCACCTCTGG - Intronic
1189663625 X:43329604-43329626 TATTCAGTTTTTATCTCCTATGG + Intergenic
1189920364 X:45897155-45897177 TGTTCCCTGTTTGTTTCCTTTGG - Intergenic
1191041774 X:56089309-56089331 CGCTCACTTTTTCCCTGCTTGGG - Intergenic
1191215577 X:57929413-57929435 TGTCCAATTCTTCTCTCCTTTGG + Intergenic
1191800708 X:65076035-65076057 TGTTGACTTGGTGTCTCCTTTGG + Intergenic
1192619115 X:72659213-72659235 TGTTCAAATTTTTTCTGCTTTGG + Intronic
1193679509 X:84501390-84501412 TCTTGCCTTTTTCTCTTCTTGGG - Intronic
1194031487 X:88821666-88821688 TTTTCTCTTTTTTTCTTCTTGGG + Intergenic
1194566622 X:95496350-95496372 TGTTCATTTTTTTTTTCATTTGG - Intergenic
1196183217 X:112718196-112718218 GGCTCACATTTTCTTTCCTTGGG - Intergenic
1197110326 X:122765445-122765467 TGCTCACTTTTGATTTCCTTTGG - Intergenic
1197599955 X:128517403-128517425 TCTTCACTTATCCTTTCCTTCGG - Intergenic
1197891802 X:131276594-131276616 TGTCCACTTTTTCTCTAGCTGGG - Intronic
1197950726 X:131893524-131893546 TTTTCATTTATTCTCTCCTCTGG - Intergenic
1199277280 X:145961335-145961357 TTTTCACTTTTATTCACCTTAGG - Intergenic
1199866976 X:151860691-151860713 TGTTCAATGTTTCTCTGCCTGGG + Intergenic
1199953853 X:152726690-152726712 TGCTCACTTCTGCTCACCTTGGG + Intergenic
1200700702 Y:6399998-6400020 TGTACCATTTTTCTCTGCTTAGG - Intergenic
1200706686 Y:6449046-6449068 TGTACTATTTTTCTCTGCTTAGG - Intergenic
1200910794 Y:8529713-8529735 TGTACTGTTTTTCTCTGCTTAGG + Intergenic
1200917102 Y:8580827-8580849 TGTACCATTTTTCTCTGCTTTGG + Intergenic
1200923710 Y:8635597-8635619 TGTACTCTTTTCCTCTGCTTAGG + Intergenic
1200923994 Y:8638097-8638119 TGTACCATTTTTCTCTACTTAGG + Intergenic
1200924831 Y:8645032-8645054 TGTACCATTTTTCTCTGCTTAGG + Intergenic
1200933644 Y:8719674-8719696 TGTACCATTTTTCTCTGCTTAGG - Intergenic
1201027426 Y:9715662-9715684 TGTACTATTTTTCTCTGCTTAGG + Intergenic
1201033410 Y:9764700-9764722 TGTACCATTTTTCTCTGCTTAGG + Intergenic
1202130262 Y:21602868-21602890 TGTACCATTTTTCTCTGCTTAGG - Intergenic
1202178769 Y:22121637-22121659 TGCACAATTTTTCTCTTCTTAGG - Intergenic
1202212592 Y:22464757-22464779 TGCACAATTTTTCTCTTCTTAGG + Intergenic