ID: 1092758691

View in Genome Browser
Species Human (GRCh38)
Location 12:11789499-11789521
Sequence GTTCACTTTTTCTCTCCTTC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 449
Summary {0: 1, 1: 1, 2: 6, 3: 52, 4: 389}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092758688_1092758691 -8 Left 1092758688 12:11789484-11789506 CCAGCTATGACCTTTGTTCACTT 0: 1
1: 0
2: 0
3: 16
4: 160
Right 1092758691 12:11789499-11789521 GTTCACTTTTTCTCTCCTTCGGG 0: 1
1: 1
2: 6
3: 52
4: 389
1092758687_1092758691 -7 Left 1092758687 12:11789483-11789505 CCCAGCTATGACCTTTGTTCACT 0: 1
1: 0
2: 1
3: 32
4: 281
Right 1092758691 12:11789499-11789521 GTTCACTTTTTCTCTCCTTCGGG 0: 1
1: 1
2: 6
3: 52
4: 389
1092758685_1092758691 22 Left 1092758685 12:11789454-11789476 CCTGCTTCGGTCTGGGCTTCAGC 0: 1
1: 0
2: 1
3: 8
4: 129
Right 1092758691 12:11789499-11789521 GTTCACTTTTTCTCTCCTTCGGG 0: 1
1: 1
2: 6
3: 52
4: 389

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092758691 Original CRISPR GTTCACTTTTTCTCTCCTTC GGG Intronic
901315810 1:8307425-8307447 TTTCACTTTTTCTTTTCTTTTGG + Intergenic
905836592 1:41128748-41128770 GTGCTCCTTATCTCTCCTTCAGG + Intronic
905984621 1:42268009-42268031 ATTCCTTTTTTTTCTCCTTCTGG - Intronic
906987893 1:50706560-50706582 GTTCTATTTTTATCTCCTCCTGG + Intronic
907558475 1:55366588-55366610 GGTCACTTGTACTCTCCTTCAGG + Intergenic
907838566 1:58134642-58134664 CTTCACTGTCTCTCTCCTGCTGG - Intronic
910495622 1:87824278-87824300 GTTCACATTCTCTCTTCCTCAGG - Intergenic
910864196 1:91772961-91772983 ATTAACTTTTTTTCTCCTTGAGG - Intronic
911907027 1:103582741-103582763 GTTTATCTTTTCTCTCCTGCTGG - Intergenic
912019270 1:105085622-105085644 GTTCACTTTTATGCTCTTTCAGG - Intergenic
912309026 1:108600544-108600566 GCTCTTTTTTTCTTTCCTTCAGG + Exonic
914265056 1:146031467-146031489 GTTCACTGATTCTTTCCTTAGGG + Intergenic
916020601 1:160789059-160789081 TTTCACTTTTATTCTCCATCAGG - Intergenic
916357802 1:163932910-163932932 TTTCTCTTTTTTTCCCCTTCAGG + Intergenic
917812474 1:178672427-178672449 TTTCTCTTTTTCTCTTCTTCTGG - Intergenic
920108747 1:203572550-203572572 TTTCCATTTTTCTCTCCTCCCGG - Intergenic
920535494 1:206734097-206734119 CTTCACCTTTCCTCTCCCTCAGG + Exonic
921164670 1:212498186-212498208 GCTCAATTGTTCTCTCCTTGGGG - Intergenic
921308742 1:213822173-213822195 CTACACTTTGTCTGTCCTTCTGG + Intergenic
921468753 1:215523063-215523085 GTTCAAGTTTTCTTTCTTTCTGG - Intergenic
921578843 1:216872477-216872499 GTTTATTTTTTCTCTCAGTCTGG + Intronic
923069262 1:230547885-230547907 GTCCCCTTTTTCTGTCCTGCAGG + Intergenic
923896802 1:238279041-238279063 ATTCTCTTTTTATTTCCTTCTGG + Intergenic
924892812 1:248302754-248302776 GTTAATTTTGTCTCTCCTTTGGG - Intergenic
1064012371 10:11744746-11744768 AATGACTTTTTCTCTCATTCAGG + Intronic
1064287417 10:14003965-14003987 GTTCATTTTTACTTTACTTCTGG + Intronic
1064434081 10:15295619-15295641 TTTCATTTTTTCTTTCCTTTTGG + Intronic
1064469063 10:15616820-15616842 CATCACTTTTCCTATCCTTCAGG + Intronic
1064842688 10:19612740-19612762 GTTCTCTCTCTCTCTCCTGCCGG - Intronic
1066024530 10:31341362-31341384 GTCCATTTTTTCTCTCCCACTGG - Intronic
1066126841 10:32349920-32349942 GTTCACTTTTCTTCACCTTAAGG + Intronic
1066614830 10:37283820-37283842 TTTCACTTTTCCTTTACTTCTGG - Intronic
1066641196 10:37555954-37555976 GGTCACTTCTTCACTCCTCCAGG + Intergenic
1069434159 10:68365920-68365942 ATTCACTTTTTTTCTGATTCTGG - Intronic
1070783330 10:79149755-79149777 GTTCACTCTTCCTCTCATCCTGG + Intronic
1070872069 10:79764724-79764746 GTTCATTTTTTCTCCCATTATGG - Intergenic
1071275075 10:84046419-84046441 GCTGACTTTCTGTCTCCTTCAGG + Intergenic
1071638987 10:87286892-87286914 GTTCATTTTTTCTCTCATTATGG - Intergenic
1071656251 10:87451058-87451080 GTTCATTTTTTCTCTCATTATGG + Intergenic
1073589340 10:104741528-104741550 ACTTTCTTTTTCTCTCCTTCTGG + Intronic
1074349082 10:112717296-112717318 GTTCTCTTTTTCTCTTCTCCTGG + Intronic
1074541732 10:114370845-114370867 TTCCACTATTTCTCTCCATCTGG + Intronic
1075917863 10:126185049-126185071 TTTCATCTTTTCTCTCTTTCGGG + Intronic
1077846328 11:6028732-6028754 GTTCTATTTTTATCTCTTTCAGG - Intergenic
1078296789 11:10079042-10079064 GGTAACTTTTTTTCTTCTTCAGG - Intronic
1079375921 11:19891930-19891952 GTTCATTTTTTTTTTCCCTCTGG - Intronic
1079651751 11:22938424-22938446 AAACACATTTTCTCTCCTTCTGG - Intergenic
1079747276 11:24149423-24149445 GCTCTCTTTCTCTCTCTTTCTGG + Intergenic
1079828739 11:25234127-25234149 CTTCAATTTTGTTCTCCTTCTGG + Intergenic
1080516635 11:33028481-33028503 GTTGACTTTTTCTTTCTTTTTGG + Intronic
1083723395 11:64614949-64614971 TTTCACTCTTTCTCACCTCCAGG - Intronic
1085103848 11:73824880-73824902 GTCCCCTTATTCTCTCCTTTTGG - Intronic
1085146638 11:74205471-74205493 GCTCTCATTTTCTGTCCTTCAGG - Intronic
1085276933 11:75306501-75306523 GTTTGCTTTTCCTCTCTTTCTGG - Intronic
1085344085 11:75755547-75755569 TTTCACTTTTTCTTTCAGTCTGG - Intergenic
1087973542 11:104515688-104515710 GTTCAGATTTCATCTCCTTCAGG + Intergenic
1092563092 12:9637119-9637141 GTTTGTTTCTTCTCTCCTTCAGG - Intergenic
1092669114 12:10842405-10842427 GCCCATTTCTTCTCTCCTTCTGG + Intronic
1092758691 12:11789499-11789521 GTTCACTTTTTCTCTCCTTCGGG + Intronic
1092897726 12:13029341-13029363 ATTCCCTGTTTCTCTCCTTGGGG - Intergenic
1092918909 12:13213450-13213472 ATTAACATTTTCTTTCCTTCTGG + Intronic
1093145150 12:15556486-15556508 GTTTACTTTTTCTCTACTTCTGG + Intronic
1093196863 12:16139984-16140006 GTTCAGTTTTTCTGTGCTTAAGG + Intergenic
1097303354 12:58042183-58042205 GTTCTCTCTTTCTCTCTTTTTGG + Intergenic
1097632807 12:62084547-62084569 ATTCTCTTTTTCTCTCCTTTTGG - Intronic
1097757539 12:63423621-63423643 GTTTACTTTTTCTTTTCTACAGG - Intergenic
1097810806 12:64016684-64016706 GCTTACTTTTTCTCTCTTTTTGG + Intronic
1098927543 12:76367946-76367968 GTCCACTTTTTATTTCCTGCAGG - Intronic
1099293172 12:80797726-80797748 CTTCACTCTTTTTCTCTTTCAGG - Exonic
1099321193 12:81151823-81151845 TTTCACTTTTTCTCTCCTTAGGG + Exonic
1099333951 12:81329726-81329748 GGTCCCTGTTTCTCCCCTTCAGG - Intronic
1099536144 12:83847213-83847235 ATTCTCTTTCTCTCACCTTCTGG + Intergenic
1099721190 12:86363753-86363775 GTTCACTATTTCTCTCTTTCTGG - Intronic
1100053599 12:90482003-90482025 GTTTACTTTTAATTTCCTTCTGG - Intergenic
1101500037 12:105295154-105295176 TTACACTGTTGCTCTCCTTCAGG - Intronic
1102672303 12:114630494-114630516 GTTCACTTTTTCTCTATCCCTGG - Intergenic
1102678695 12:114675524-114675546 GATCCCTTTTTCTTTTCTTCTGG - Intronic
1103542585 12:121676484-121676506 TTTCCCTCTTTCTCTGCTTCAGG + Intergenic
1104213994 12:126717920-126717942 GCTCTCTTTCTCTCTCCTGCTGG - Intergenic
1104231288 12:126886943-126886965 GTTTTTTTTTTCTCTCCTTTGGG + Intergenic
1105613286 13:21988108-21988130 GTTCTCTCTTGCTCTCCTTCTGG - Intergenic
1105768861 13:23588371-23588393 GTTCTATTTTTGTCTCCTTATGG + Intronic
1105831950 13:24170442-24170464 CTTCAGTTTCTCTCTCATTCTGG + Intronic
1105955325 13:25276643-25276665 GTTCACTATTACTCTTCCTCAGG + Intronic
1106001864 13:25731188-25731210 TCTCTCTTTCTCTCTCCTTCCGG - Intronic
1106001876 13:25731311-25731333 TCTCTCTTTCTCTCTCCTTCCGG - Intronic
1107631132 13:42343815-42343837 TTTCCTTTTCTCTCTCCTTCAGG + Intergenic
1108767553 13:53651126-53651148 TTTCCCCTTTTCTCTCCATCAGG + Intergenic
1109332598 13:60948357-60948379 TTTCACTTTCTCTTGCCTTCAGG + Intergenic
1109492676 13:63123400-63123422 GTTTAATTTTTTTCTCCCTCCGG + Intergenic
1109608558 13:64732538-64732560 ATTCACTTTCTCTCTTCTTGAGG + Intergenic
1109864431 13:68244566-68244588 AATCCCTTTGTCTCTCCTTCAGG + Intergenic
1110067415 13:71126179-71126201 TTTCTTTTCTTCTCTCCTTCTGG - Intergenic
1110095984 13:71521511-71521533 GTTCCTTTTTTCTTTCCTCCAGG - Intronic
1110638455 13:77792765-77792787 TTTCTCTTTTTTTCTCTTTCAGG - Intergenic
1110748738 13:79087734-79087756 GTTCAATATTTATCTGCTTCAGG + Intergenic
1110779281 13:79446051-79446073 GCCCACTCCTTCTCTCCTTCTGG + Intergenic
1111064013 13:83066281-83066303 GGTCACTTTTTCACTCCTGGAGG + Intergenic
1111089305 13:83421981-83422003 GTACATATTTTCTCTCCTTATGG - Intergenic
1111349955 13:87014813-87014835 GTGCATTTTTTGTCTCATTCTGG + Intergenic
1111868618 13:93801642-93801664 TTTCAATTTTTCTCTCTTTTTGG - Intronic
1112449036 13:99492816-99492838 GTTCCCTTTTTCCTTCCTTCAGG + Intergenic
1112952253 13:105014196-105014218 GTTTATTTATTCTCCCCTTCAGG + Intergenic
1113256116 13:108507713-108507735 TTTCTCTTTTTCTTTTCTTCTGG + Intergenic
1114210779 14:20612604-20612626 TTTCGCATTTCCTCTCCTTCGGG - Intergenic
1114310408 14:21461570-21461592 GTGCACTTTTTTTTTCCTTGAGG + Intronic
1115732612 14:36287651-36287673 TTTGACTTTTTTTCTCCATCTGG - Intergenic
1116093040 14:40333201-40333223 ATATACTTTTTCTCTGCTTCAGG + Intergenic
1116379519 14:44247923-44247945 GTTCACTTTAGCTCTTCTTAAGG - Intergenic
1116647938 14:47553254-47553276 GTGTACTTTTTCACTGCTTCTGG + Intronic
1116827053 14:49682943-49682965 GGTCACTTTGTCTCTCCTAGTGG - Intronic
1116967365 14:51028851-51028873 GTTCTTTGTTTCTCTCCTTCAGG - Intronic
1117650247 14:57897162-57897184 GTACACTTTTACTCTCTTTCTGG + Intronic
1117952926 14:61100810-61100832 GTTCCCTTTCTCTTTCCTTGGGG + Intergenic
1118101461 14:62609406-62609428 TTCCACTTTATCTCTCCTTTTGG - Intergenic
1118666289 14:68074133-68074155 GCTCTCTCTTTCTCTCTTTCAGG + Intronic
1119304874 14:73599519-73599541 GTTCTCAATTTCTCTCCATCTGG - Intergenic
1119684191 14:76617705-76617727 CTTGACTTTTTCTCTCCTTCCGG - Intergenic
1120340821 14:83218897-83218919 TTTCTCTTTTTCTTTTCTTCTGG + Intergenic
1120374918 14:83691994-83692016 TTTCACTTCTTTTTTCCTTCTGG + Intergenic
1120631818 14:86900914-86900936 GTCAACATTTACTCTCCTTCAGG - Intergenic
1120892351 14:89502290-89502312 CTGCACCTTGTCTCTCCTTCAGG - Intronic
1121339906 14:93099088-93099110 GTTCATTTCCTCTCCCCTTCCGG + Intronic
1121378471 14:93436854-93436876 GTCTTGTTTTTCTCTCCTTCTGG + Intronic
1124073047 15:26413529-26413551 GCTTGCTTTTTCTCTCCTTTTGG - Intergenic
1124504212 15:30259187-30259209 GTTCATTTTTTAGCTCCTTGAGG + Intergenic
1124739342 15:32279456-32279478 GTTCATTTTTTAGCTCCTTGAGG - Intergenic
1125858811 15:42978093-42978115 GTTCAGTTTGTCTCTCATTATGG - Intronic
1126606453 15:50481994-50482016 GTTGACTTTTTCTGTATTTCTGG - Exonic
1127439261 15:58989949-58989971 TTTGACTTTTTCTCCCCTTTTGG + Intronic
1127834542 15:62780197-62780219 GTTCACTTTGTCTCTTCGCCTGG + Intronic
1129919241 15:79305671-79305693 ATTCAGTTTTCCTCTCCTTCTGG + Intergenic
1130816165 15:87435785-87435807 GTTCACTAATTTTTTCCTTCTGG - Intergenic
1131428575 15:92367904-92367926 TTTCAATTCTTCTCTCCCTCTGG + Intergenic
1131747569 15:95465674-95465696 TTTTACTTTTTCTATCCTTTGGG + Intergenic
1131864875 15:96697284-96697306 GCTTTCTGTTTCTCTCCTTCAGG + Intergenic
1132382405 15:101375494-101375516 TTTCTCTTTTACTCCCCTTCAGG - Intronic
1133558686 16:6929621-6929643 ATTCAATTTTTCTCACCTTTAGG + Intronic
1134352248 16:13448498-13448520 GTTCACCTCTTATCTCATTCTGG - Intergenic
1135125625 16:19807073-19807095 GCTCACTTGTTCTCTCCCTCTGG + Intronic
1137029567 16:35508945-35508967 GTTCACATCTTCTGTCATTCAGG + Intergenic
1137533775 16:49301541-49301563 GTTCACTTTGTATCTCACTCTGG + Intergenic
1138168715 16:54828962-54828984 TTTCATTTTATCTCTCCTACTGG + Intergenic
1138310751 16:56021630-56021652 ATTCTCTCTTTCTCTCCTTTTGG - Intergenic
1138782396 16:59805083-59805105 TTGCACGTTTTCTCTCCTGCTGG - Intergenic
1139495245 16:67312138-67312160 GTTTCCTTTTTCACACCTTCTGG - Intronic
1139759606 16:69174013-69174035 GTTGTCTTTTTCTTTCTTTCTGG + Intronic
1140491417 16:75339375-75339397 ATTCTCTTTTTATCTCTTTCAGG + Intronic
1140738137 16:77917246-77917268 TTCCAATTTTTCTCCCCTTCTGG - Intronic
1140817456 16:78634346-78634368 TTTCACTTATTCCCTCATTCAGG + Intronic
1141314498 16:82948881-82948903 GTAAACTTTGTCTTTCCTTCTGG - Intronic
1141844787 16:86600594-86600616 GTTCTCTTGTTCTGTCTTTCTGG + Intergenic
1142011523 16:87717540-87717562 GGTCTCTTTTGTTCTCCTTCTGG + Intronic
1142438061 16:90075858-90075880 GTTCTCTCTGTGTCTCCTTCTGG + Exonic
1142727072 17:1823580-1823602 GTACCCTTTCTCTCTACTTCCGG + Intronic
1143402612 17:6656199-6656221 GTGCGCATTTTCTCTCTTTCTGG - Intergenic
1144147508 17:12412717-12412739 GTCAACTTTTTCTTTCTTTCTGG + Intergenic
1144434602 17:15229270-15229292 GGTGGCCTTTTCTCTCCTTCAGG + Intergenic
1146800568 17:35816691-35816713 GTTCTATTTATCTATCCTTCAGG - Intronic
1147878427 17:43638211-43638233 GTTCCATGTTTTTCTCCTTCTGG + Intergenic
1151019205 17:70594305-70594327 GTTTATTTTTTCTTTCCTTCTGG + Intergenic
1151072213 17:71227837-71227859 GTTTTGTTTTTCTCTCCTTCAGG + Intergenic
1151516982 17:74602888-74602910 GTTCTGTTTTTCCCTCTTTCAGG - Intergenic
1152151985 17:78607395-78607417 GTCCTCTTGTTCTCTCCTCCCGG + Intergenic
1152244201 17:79176736-79176758 TTTCTCTGCTTCTCTCCTTCAGG - Intronic
1152292935 17:79450865-79450887 TTTTACTTTTTCTCTCCTCTTGG - Intronic
1152857428 17:82673830-82673852 GATAATTTGTTCTCTCCTTCTGG + Intronic
1153110150 18:1577022-1577044 GTTCATTTTTCCTCTGCTTATGG + Intergenic
1153233201 18:2960618-2960640 GATGACTTTTCCTCTCCTTGAGG + Intronic
1153343181 18:3997499-3997521 TTTTACTGTTTCTATCCTTCTGG + Intronic
1153366406 18:4261862-4261884 GTTCACTTTTTCTTTCCTTCTGG - Intronic
1153461557 18:5339423-5339445 CTTCAATTTTTCTCTTTTTCTGG - Intergenic
1154533470 18:15372122-15372144 GTTAACTTTTTCTATCTGTCAGG + Intergenic
1155135520 18:22987752-22987774 CTTCACTTTCTCTCTCTTCCTGG + Intronic
1155406457 18:25493302-25493324 ATTCACTTTTAATTTCCTTCAGG - Intergenic
1155486297 18:26346399-26346421 TTTCACTTCTTTTCTCCTTCCGG - Intronic
1155846384 18:30713131-30713153 ATTCAGTTTTTCTCTGCCTCAGG - Intergenic
1156437335 18:37146626-37146648 GTTCTGTTTTTAGCTCCTTCAGG + Intronic
1156601651 18:38614485-38614507 GTTCCCTTTGTCTCTGCTTTAGG + Intergenic
1156764575 18:40636401-40636423 TTTCACCATTTCTGTCCTTCTGG + Intergenic
1157047029 18:44113739-44113761 GTCCAATATTTATCTCCTTCTGG + Intergenic
1158345207 18:56509191-56509213 GTCTAGTTTTTCTCTCCTTTAGG - Intergenic
1158384288 18:56971647-56971669 GTTCAGATATCCTCTCCTTCAGG - Intronic
1158436782 18:57439839-57439861 GTTCCCTTTCTCTCTCATTTTGG + Intronic
1160293008 18:77611114-77611136 GATAACTCTTTCTCTCATTCAGG - Intergenic
1160591333 18:79946430-79946452 GAGCACTTTTCCTCTCCTGCCGG + Intronic
1161351931 19:3798227-3798249 GCCCTCTTTGTCTCTCCTTCAGG + Intronic
1162409577 19:10497340-10497362 GATCTCTATTTCTCTCCTTCAGG - Intronic
1163385962 19:17000733-17000755 GGTCTCTTTTTCTGTCCATCTGG - Intronic
1163850808 19:19662400-19662422 GTTCCCTTTTCCTCTTCTTGAGG + Intronic
1164204689 19:23048363-23048385 GCTCATTTTTTCTTTTCTTCAGG - Intergenic
1164270964 19:23671310-23671332 GTTTCCTTTTTCCTTCCTTCAGG - Intronic
1164648953 19:29878475-29878497 CTGCACTTTCTCTCTCCTGCAGG - Intergenic
1164761526 19:30731852-30731874 GTTCACATTTTACCTCCTTTGGG + Intergenic
1165207231 19:34200321-34200343 GTTTTCTTTTTCTCCCCTGCAGG - Intronic
1165987930 19:39786941-39786963 GTTCACTGCTTCTCTCCTGGGGG - Intergenic
1166551759 19:43670152-43670174 CTGCACGTCTTCTCTCCTTCTGG + Exonic
1168065694 19:53919082-53919104 TTTTAATTTTTCTCCCCTTCTGG + Intronic
925079072 2:1046966-1046988 GTTCTCTTTTCTTCTCTTTCAGG + Intronic
925819700 2:7787897-7787919 GTTCACTTCCTCTGTCGTTCTGG + Intergenic
926680524 2:15660163-15660185 GTTCACTTTTTCATTGCTTTGGG - Intergenic
927403485 2:22741489-22741511 GTTCACTATTTCTCTTCTTTAGG - Intergenic
928663799 2:33530283-33530305 GTTCTCTTTTTCTGTCCTCCAGG - Intronic
929013012 2:37466119-37466141 GTTTACTTTTTGTCCCCTTTTGG + Intergenic
930523164 2:52493733-52493755 AATAACTTTTTCTCTCCTTTTGG - Intergenic
930571061 2:53088038-53088060 GTTTATTTTCTCCCTCCTTCTGG - Intergenic
931938503 2:67225455-67225477 GTTCACTTTTCCTCCCCTCTAGG + Intergenic
932738935 2:74276970-74276992 GTCCTCTTTCTCTCTGCTTCTGG - Intronic
934952255 2:98584654-98584676 GTTCTTTGTTTCTCTCCTCCAGG + Intronic
936483025 2:112903247-112903269 GTGTACTTTTTCTTTGCTTCTGG + Intergenic
936511874 2:113155014-113155036 GCTCACTATTGATCTCCTTCAGG + Intergenic
936634137 2:114236096-114236118 GTTCACAATTACTCTCCTCCAGG - Intergenic
936704751 2:115058721-115058743 GTTGACTTTTTCTTTGTTTCAGG - Intronic
936918469 2:117663770-117663792 GATAACATTTTCTCTCCCTCGGG + Intergenic
937146702 2:119652584-119652606 GTTCTCTCCTTCTCTCCATCAGG + Intronic
937561155 2:123225191-123225213 TTTCTCTTTTTTTCTCATTCTGG - Intergenic
939209065 2:139147973-139147995 GTTCCCTTCTTCTCTCTTCCCGG - Intergenic
940329537 2:152459091-152459113 GTTTACTTTTTCTGTGTTTCAGG + Intronic
941044061 2:160652799-160652821 TCTCACCTTTTCTCTCCTTTGGG + Intergenic
943480541 2:188411839-188411861 TTTCCCTTCTTCTGTCCTTCAGG + Intronic
943722503 2:191219789-191219811 TCCCACTTTTTCTCCCCTTCAGG - Intergenic
943790253 2:191923347-191923369 TTTCATTTTTTCTTTCCATCTGG + Intergenic
946633347 2:221696595-221696617 GTTAACTCTTTAACTCCTTCTGG + Intergenic
946886064 2:224224405-224224427 GTTCAATTTTTATTTCCATCTGG - Intergenic
947032050 2:225807417-225807439 TTTCGCTCTCTCTCTCCTTCAGG + Intergenic
1168864281 20:1071773-1071795 GTTCATATTTTCTTTCCTTAAGG + Intergenic
1169328255 20:4694899-4694921 ATTCTCTTTTTCTATCCTTTTGG + Intronic
1169471150 20:5886698-5886720 GTTCACTGATTGCCTCCTTCTGG + Intergenic
1170340734 20:15324206-15324228 GTTCAATTTTTTACTGCTTCAGG + Intronic
1170579000 20:17683949-17683971 GTTCACTGTTTATCTTTTTCCGG + Intergenic
1171073475 20:22098770-22098792 TTTCTCATTTTCTCTCCTTTGGG - Intergenic
1171381922 20:24740320-24740342 GTTCACTTTTTCTTTAATTGTGG + Intergenic
1173890009 20:46499841-46499863 ATTCAGTTTTTATGTCCTTCAGG - Exonic
1174142436 20:48425277-48425299 GCTCACTCCTTCTCCCCTTCAGG + Intergenic
1175197821 20:57257024-57257046 GTTCACATTATCTTTCCTTCTGG + Intronic
1175420868 20:58832296-58832318 GGTCACTATTTCTCTCATTAAGG - Intergenic
1178022821 21:28429580-28429602 TTTCACTTTTTCTTTCCTTCAGG - Intergenic
1178711656 21:34922564-34922586 GATCACTGTTTCTCTCTTTCTGG - Intronic
1180932557 22:19602974-19602996 GAGCACTTTTAATCTCCTTCAGG + Intergenic
1182566826 22:31206375-31206397 GTGCTCTTTTTATCACCTTCTGG + Exonic
1183009722 22:34934909-34934931 GTTCAATTTTTCACCCCTTCTGG + Intergenic
1184433801 22:44457949-44457971 TATCACTTTTTCTCTCCTCCAGG - Intergenic
1184537801 22:45099527-45099549 CTTCAGCTTTTCTCTCCCTCAGG - Intergenic
1184895506 22:47404317-47404339 TTTCACTTTCTCTCTCTTGCTGG - Intergenic
949138232 3:598667-598689 AATCAGTTTCTCTCTCCTTCTGG + Intergenic
949276188 3:2284742-2284764 GTTAACTTTTTCTCTCCTGTTGG - Intronic
949669599 3:6383498-6383520 GCTCACTCTTTCTGTCCTGCAGG - Intergenic
950913600 3:16619844-16619866 TTTCTCTTTTTATCTGCTTCTGG - Intronic
951507781 3:23467883-23467905 CTTCACTGTCTCTCTCCTGCAGG - Intronic
951744761 3:25965718-25965740 GCTGTCTTTTTCTCTCCTTGTGG + Intergenic
953686118 3:45079638-45079660 TGTCTCTTTTTCTTTCCTTCAGG - Intergenic
954285094 3:49613422-49613444 GTTTACACTTTCTCTCCCTCAGG - Intronic
954629711 3:52041220-52041242 GTACACATTTTCCCTCCTCCGGG + Intergenic
954980522 3:54741261-54741283 GTTCTATTTTTCTCTCTTTAGGG + Intronic
955549004 3:60062920-60062942 TTTCACTTCTTCTCTCCTACTGG - Intronic
956054154 3:65280683-65280705 CTTCTCTTTTTCTCTCTCTCTGG + Intergenic
956873754 3:73442384-73442406 GTTCTCCTTTTCTCTCCTTAGGG - Intronic
957496581 3:80999421-80999443 GTTCAGTTAATCTCTTCTTCTGG + Intergenic
957568049 3:81909427-81909449 ATTCACTTTAACTTTCCTTCAGG - Intergenic
958415548 3:93868981-93869003 GTTGTCTTTTTCTCTCCTCCTGG + Intergenic
958698533 3:97557611-97557633 ACTCACTTTTTCTCCACTTCAGG + Intronic
959174715 3:102892460-102892482 GTTCTGTTTTTCGCTCCTTGAGG + Intergenic
959767951 3:110055769-110055791 GTTCATTTTTTGTCTTCTTTGGG - Intergenic
960239147 3:115319843-115319865 GATCACTTTCTGTCTCCTTTGGG - Intergenic
960246219 3:115403288-115403310 TTTCCCTTTTTCCCTCCTGCCGG - Intergenic
960385846 3:117020838-117020860 GGTGTCTTTTTCTCTTCTTCTGG - Intronic
960498012 3:118399205-118399227 TTGCACTTTTTCTCCCCTTTAGG - Intergenic
960541763 3:118869630-118869652 GTTCTGTCTTTCTTTCCTTCTGG + Intergenic
960562660 3:119102318-119102340 GTCCACACTTTCTCTCCTTAAGG + Intronic
961921153 3:130427938-130427960 CTTCCCTTTTTCTCTCCCTGTGG - Intronic
962068115 3:132004944-132004966 CATCCATTTTTCTCTCCTTCTGG + Intronic
962334467 3:134514371-134514393 TCTCATTTTTTTTCTCCTTCAGG - Intronic
964292616 3:155198330-155198352 GTTTATTTTTTTTCTCCATCGGG + Intergenic
964778437 3:160307503-160307525 GTTCACTTTCTCTCACTTCCGGG + Intronic
967247612 3:187503743-187503765 CTTCACTTTATCTCTTCTACAGG + Intergenic
967882729 3:194313457-194313479 GTTCTCTTTTCCTCTCTTTGGGG - Intergenic
967913766 3:194563104-194563126 GCTCCCTTCTTCTCTCCATCAGG + Intergenic
969809449 4:9636741-9636763 CTTCACTTTTTCTCCCCTCTTGG - Intergenic
971336196 4:25726143-25726165 GCTCAGGTTTCCTCTCCTTCAGG - Intergenic
974741573 4:66014100-66014122 GCTGACTTTGCCTCTCCTTCTGG - Intergenic
975465504 4:74704842-74704864 GTTCACTGTTTCTCTTCATAAGG + Intergenic
975470738 4:74763617-74763639 GTTCCCTTTCTCTCCCATTCAGG - Intronic
975493697 4:75015084-75015106 CTTCACTTTCTGTCCCCTTCAGG + Intronic
976688451 4:87842330-87842352 ATGCTCTTTTTCTCTCCATCAGG + Intronic
977887349 4:102267923-102267945 CTGCACCTTGTCTCTCCTTCAGG - Exonic
978200243 4:106017115-106017137 GCTCACTTGCTCTCTCCCTCTGG + Intergenic
978319944 4:107482282-107482304 GCTCACTTTTTCTCTGCTGCAGG - Intergenic
979081698 4:116352007-116352029 TTTCACTTTTTCTCCCAATCTGG - Intergenic
979801477 4:124914347-124914369 CTTATCTTTTTCTCTCTTTCTGG + Intergenic
979932854 4:126653844-126653866 GTTCATTGTTTACCTCCTTCAGG + Intergenic
980816227 4:137950065-137950087 GTTCTCTTTCCCTCTCTTTCAGG + Intergenic
981799510 4:148638729-148638751 GTTGACATTTTTTCTCCTTGTGG + Intergenic
982351475 4:154420169-154420191 TCTCACTTCTTCTCTCCATCTGG - Intronic
982830031 4:160047491-160047513 CTTCATTATTTCTTTCCTTCTGG - Intergenic
982917806 4:161234836-161234858 TGTCACTTTTTCTCTCCTACTGG - Intergenic
983861194 4:172709138-172709160 ATGCAGGTTTTCTCTCCTTCTGG + Intronic
984931577 4:184852441-184852463 GTTAACTTGTTTTCTCTTTCAGG - Intergenic
985011161 4:185583509-185583531 GTTCGCTATTTCTTTCCCTCGGG + Intergenic
985420692 4:189782320-189782342 GTTTATTTTTTCTTTCCTTCAGG - Intergenic
985476090 5:80077-80099 GTTCACTTATTTTCTGCTGCAGG - Intergenic
986085862 5:4445495-4445517 GTCCACTTATTTTATCCTTCAGG - Intergenic
986232009 5:5874150-5874172 TTTCTCTTTTTCTCTCCTCCTGG + Intergenic
986556518 5:9015279-9015301 CTTCCCTTTTTCTCTCCCTCAGG + Intergenic
986846553 5:11763101-11763123 CTTCACTCTCTCTCTCCTGCTGG + Intronic
987341920 5:16946900-16946922 CTTCACTCTCTCTCTCCTGCTGG + Intergenic
987426876 5:17783018-17783040 CTTCACTTTTTCTCTGTTACTGG - Intergenic
988282596 5:29169538-29169560 GTTCTCTTTCTCTCTCTCTCAGG + Intergenic
988370924 5:30365945-30365967 CTTCTCTTTCTCTCTCCTGCAGG - Intergenic
989644331 5:43613337-43613359 GATCACTTTTTCTCTCCTCATGG - Intronic
991563596 5:67981698-67981720 GATCACTTCTTCTCTACTTGAGG + Intergenic
991938384 5:71826507-71826529 GTTCCCTTCTCTTCTCCTTCTGG + Intergenic
992672912 5:79077458-79077480 GTGCTTTTTTTCTCTTCTTCAGG + Exonic
993636814 5:90353963-90353985 GTTGACATTTTCTCTGCATCTGG - Intergenic
994133998 5:96263842-96263864 GTTCTCTTTGTCTCTCCTCCTGG - Intergenic
994712687 5:103284339-103284361 GCTCAATTTTTCTCTCTTTAAGG + Intergenic
994937394 5:106272671-106272693 GTTCCCTTTTTCTCTCTTTTAGG - Intergenic
996188722 5:120512658-120512680 ATTCAGTTTATCTTTCCTTCAGG + Intronic
996349732 5:122525142-122525164 TTTGACTTTTTTTCTCTTTCAGG - Intergenic
997995984 5:138586846-138586868 CTTCTCTTTTTTTCTCTTTCAGG - Intergenic
998722301 5:144966788-144966810 ATTCAATTTTTCTCTCTTTAGGG - Intergenic
998766049 5:145488325-145488347 GGTCAATCTTTCTCTCCATCAGG - Intronic
999078239 5:148817784-148817806 TTTCACTTCTTCTTTCCTCCAGG + Intergenic
999398757 5:151248465-151248487 GTTCTCTTTTTCCTTCCTCCAGG + Intronic
1001794386 5:174490066-174490088 GTTTCCTCTTTCTCTCCATCAGG - Intergenic
1002885354 6:1289145-1289167 TTTCAGTTTTTCTCACCTTGCGG + Intergenic
1003538970 6:7001635-7001657 CATCACTTTTTCTCAGCTTCTGG + Intergenic
1004269339 6:14179916-14179938 TTTCACTTTTTGTCTCCATGGGG + Intergenic
1004752834 6:18581543-18581565 ATTCTCTTTTTCTCTCCTCAAGG + Intergenic
1004938944 6:20535760-20535782 GTTCTCTTTTTCTTCCCCTCTGG + Intronic
1005032060 6:21518665-21518687 GTTTTCTTTCTCTCTCCTGCAGG - Intergenic
1005289781 6:24368255-24368277 ATTCTCTTTGTGTCTCCTTCTGG - Intergenic
1005516084 6:26555812-26555834 GAGCATTTTTTCTCTCCTCCTGG + Intergenic
1006043871 6:31277137-31277159 GTTGACTTTTTCTGTACTTCTGG - Intronic
1006753475 6:36394616-36394638 TTGAAATTTTTCTCTCCTTCTGG - Intronic
1007893717 6:45324552-45324574 TTTCCCTTTCTTTCTCCTTCAGG - Intronic
1008871756 6:56280467-56280489 GTTCACTTTTCATCTCCAGCGGG - Intronic
1009925060 6:70110698-70110720 TTTCTCTTTTTCTCTCCCTACGG + Intronic
1009951962 6:70407813-70407835 CTTCACTTTTTTTATGCTTCAGG - Intergenic
1010257321 6:73773834-73773856 TTTTATTTTTTCTCTCCTTCTGG + Intronic
1011050566 6:83144134-83144156 GTTCACTTTTTCTTGGCTACTGG + Intronic
1011873982 6:91933334-91933356 TTTCACTTTTTCTTTCCTGAAGG - Intergenic
1012817847 6:104046892-104046914 ATTCACTGTTTCTCTGCTTCAGG - Intergenic
1014334499 6:120116043-120116065 GTTCACTTCTTCTCACTTTCAGG + Intergenic
1014931050 6:127336690-127336712 TATCACTTTATTTCTCCTTCAGG - Intronic
1015267292 6:131301564-131301586 GTCCATTTTTTTTCTCTTTCTGG - Intergenic
1015389494 6:132665122-132665144 CTTCACTCTTTCTTTCCTTCTGG - Intergenic
1015418285 6:132975650-132975672 GTGCTCTTTTTCTCCCCTTCTGG + Intergenic
1015846554 6:137526049-137526071 CTTCACTCTCTCTCTCCTACTGG + Intergenic
1020438178 7:8188742-8188764 GTTCTCTCTTGCTCTCCTTGGGG - Intronic
1020571944 7:9874575-9874597 TTTCAATGTTTCTGTCCTTCTGG - Intergenic
1022803302 7:33796129-33796151 GTTTTCTCTTTCTCTCCTGCAGG - Intergenic
1023686982 7:42746041-42746063 TTTCACTTTTCTCCTCCTTCAGG + Intergenic
1023892574 7:44403806-44403828 GTTTCCTTTTTTTCTCCTACTGG - Intronic
1023999203 7:45179871-45179893 GCTCATTTTTTTCCTCCTTCTGG - Intronic
1024387132 7:48765218-48765240 TTTTGCTTTTTCTCTCCTTGTGG + Intergenic
1028232644 7:88323948-88323970 TTTCACTTTTTTTCCCCTTTTGG + Intergenic
1028610710 7:92708070-92708092 TTTCGATTTTTCTCTCCTTGGGG - Intronic
1030184182 7:106744460-106744482 GTTCATTTATTTTCTCTTTCTGG + Intergenic
1030823630 7:114126860-114126882 CTTCACTTTTTCTTTTCTTTTGG + Intronic
1032681174 7:134185068-134185090 TTTTTCTTTTTCTTTCCTTCAGG + Intronic
1033265187 7:139879473-139879495 GATTACTTGTTATCTCCTTCAGG + Intronic
1033770713 7:144548602-144548624 GATCATTTCTTGTCTCCTTCAGG - Exonic
1034055120 7:148026131-148026153 GTACACTTTTTCTTTACTTTTGG - Intronic
1035988677 8:4463565-4463587 GTTCACTTCTTCTGTATTTCTGG - Intronic
1036069970 8:5430668-5430690 TTTTACTTCTTTTCTCCTTCTGG - Intergenic
1036371484 8:8166475-8166497 CTCCACTTTTTCTCTCCTCTTGG - Intergenic
1036879419 8:12499169-12499191 CTCCACTTTTTCTCTCCTCTTGG + Intergenic
1037672676 8:21028735-21028757 ATTCACTCTTTCTTTCCCTCTGG - Intergenic
1037700677 8:21271550-21271572 GTTTCATTTTTCTCTCCTTAGGG + Intergenic
1037744640 8:21632968-21632990 GTTGGCTTCTCCTCTCCTTCAGG + Intergenic
1038119820 8:24600654-24600676 TTTCTCTTTTTCTCTTCTTTTGG + Intergenic
1038276782 8:26127905-26127927 ATTCACTGTCTCTCACCTTCAGG - Intergenic
1039074554 8:33678022-33678044 GGTGACATTTTCTCTCCTTGGGG + Intergenic
1039690314 8:39857597-39857619 GTTCTTTTTTTAGCTCCTTCAGG - Intergenic
1040089060 8:43377564-43377586 GTTCACGTTTTCTTTTCATCAGG + Intergenic
1040430421 8:47336046-47336068 TGTCCCTTTTTCTCTGCTTCTGG + Intronic
1040633827 8:49248647-49248669 GTTCCCTCTTTCAGTCCTTCTGG + Intergenic
1040643393 8:49368310-49368332 CTTCTCTTTATTTCTCCTTCTGG + Intergenic
1040648791 8:49427825-49427847 TTCCACTTTTCCTCTACTTCTGG + Intergenic
1040990815 8:53347632-53347654 GTTTGTCTTTTCTCTCCTTCAGG + Intergenic
1041013198 8:53564504-53564526 GTTTTCTTTTTCTCTCCTGCTGG + Intergenic
1041079203 8:54200493-54200515 GTTCCCTTCTCTTCTCCTTCTGG + Intergenic
1041995288 8:64048621-64048643 GTTGACTTTTTCTTTCCCTCTGG - Intergenic
1042159843 8:65881607-65881629 GTGAACTTTTTCTTTTCTTCTGG + Intergenic
1042752084 8:72169318-72169340 GGTTTCTTTCTCTCTCCTTCAGG + Intergenic
1042764772 8:72308933-72308955 GTTCACTTTTTCTCCCCCACTGG - Intergenic
1043028985 8:75107191-75107213 TTTCACTCTCTCTCTCCTGCTGG + Intergenic
1043124756 8:76376619-76376641 GTTTTCTCATTCTCTCCTTCAGG - Intergenic
1043256794 8:78148490-78148512 TTCCACTTTTTCTGTACTTCTGG + Intergenic
1043700002 8:83274114-83274136 GTTCACTTTTCTTCTCCCTAAGG - Intergenic
1043731373 8:83687497-83687519 GTTCACTTTGTCTCAACATCTGG + Intergenic
1044219443 8:89651563-89651585 TTCCCCTTTTTCTCTCCTTCTGG - Intergenic
1044946690 8:97396200-97396222 GTCCACTGTTTGTGTCCTTCAGG + Intergenic
1045889848 8:107142782-107142804 GTGCCTTTTTTCTCTCCTCCAGG - Intergenic
1046662894 8:116967887-116967909 GTCCCGGTTTTCTCTCCTTCTGG + Intronic
1046732311 8:117738765-117738787 ATTCACTTATCCTCTGCTTCAGG - Intergenic
1047440099 8:124870241-124870263 GTCTTCTTTTTCACTCCTTCTGG + Intergenic
1049462646 8:142737239-142737261 GTTCCCGGTTTCCCTCCTTCAGG + Intergenic
1049737134 8:144214681-144214703 GTTCCCTTTGTCTCCTCTTCTGG + Intronic
1049993187 9:1009458-1009480 GCTCACTGTTCCTCTCTTTCTGG + Intergenic
1050548122 9:6726410-6726432 GTTCTCTTTCCCTGTCCTTCTGG + Intronic
1050757196 9:9019877-9019899 GTTCACTTTTTTTTTCTTTTTGG + Intronic
1052354586 9:27491278-27491300 TTTCTCTTTTTCTAACCTTCTGG - Intronic
1054823304 9:69545605-69545627 GTTCAATCTGTCTCTCCCTCTGG + Intronic
1054926247 9:70591549-70591571 GCTAACTTTTTCTCTGCTCCTGG + Intronic
1055199019 9:73634413-73634435 TTTTACTTTATCTCTGCTTCAGG - Intergenic
1055391866 9:75830746-75830768 CTTCCATTTTTCTCTGCTTCTGG + Intergenic
1055435225 9:76286150-76286172 GTTCACTTTGTCTCTGTTTATGG - Intronic
1056746178 9:89305471-89305493 GTTTATTTTTTCTCTCCCTTTGG + Intergenic
1057202454 9:93149377-93149399 GGTCACTTCTTCTCACATTCAGG + Intergenic
1057544721 9:96009426-96009448 GTTCAGTCCTCCTCTCCTTCCGG + Intronic
1058069338 9:100585743-100585765 CTTTGTTTTTTCTCTCCTTCAGG + Exonic
1058102844 9:100936376-100936398 GTTTACTTTTTCTCCTCTTTTGG + Intergenic
1058127121 9:101207828-101207850 GTTCTCTTATAATCTCCTTCTGG - Intronic
1058237715 9:102513806-102513828 GTTTACTTTTTATCTCCTTTTGG - Intergenic
1058572044 9:106357554-106357576 GTTCCCTTTTTCTCTCTTTCAGG + Intergenic
1059120255 9:111635473-111635495 GTGCAATTTTTCTCTCATGCAGG - Intronic
1059762381 9:117350640-117350662 GAGCACATTTTCTCTCATTCTGG - Intronic
1059812440 9:117870541-117870563 GTTCACTTATTTTCTACTTTAGG - Intergenic
1060137104 9:121168110-121168132 CTTCACTTTCTCTCTCTTTCTGG - Exonic
1060776718 9:126380016-126380038 GTTCACTTTCTGACTCCTTCTGG - Intronic
1060910746 9:127348101-127348123 CTTCACTTTTACTCTCAATCAGG - Intronic
1061602338 9:131679405-131679427 GTTCCCTTTTTCTTCCCATCAGG - Intronic
1062128174 9:134877641-134877663 GTTCTCCATTTCTCTCCTCCTGG + Intergenic
1186006042 X:5073238-5073260 GTTCAGTTTTTCTGTCATACAGG + Intergenic
1186362248 X:8854433-8854455 TTTCACTTGTTCTCTTCTTGGGG - Intergenic
1187123174 X:16428981-16429003 TTTCACTTATTCTCCCCTTCAGG + Intergenic
1187174709 X:16885839-16885861 TTTCTTTATTTCTCTCCTTCAGG + Intergenic
1187472265 X:19579867-19579889 GTTCACTTTTCCACTCCCTTGGG + Intronic
1188445620 X:30250412-30250434 GATCTCATTCTCTCTCCTTCAGG + Exonic
1189081660 X:37979598-37979620 CTCCACTTTCTCTCTCATTCTGG + Intronic
1189143819 X:38635582-38635604 ATTTACTTTTCCTCTCTTTCCGG - Intronic
1189730237 X:44012599-44012621 GTTCAAGTTTTATCTTCTTCAGG + Intergenic
1190406854 X:50096801-50096823 CTTGACTTTTTCTCCCCTTGAGG - Exonic
1192625054 X:72718315-72718337 GTTCATTTTATTTCTTCTTCTGG + Intergenic
1193105344 X:77664680-77664702 GTTCTTTTTTTCCCTTCTTCTGG + Exonic
1193668011 X:84348060-84348082 TTTCCCTTTTTTTCTCTTTCTGG + Intronic
1194169226 X:90561428-90561450 GCTCACTTTTTCTCTCTTTTAGG + Intergenic
1195341355 X:103909487-103909509 GTTCATTTATTTTCTCTTTCAGG + Intergenic
1195470446 X:105223604-105223626 CTTCACTTTCTCCCTCCTCCAGG - Intronic
1196076835 X:111586976-111586998 GCTCGCCTCTTCTCTCCTTCAGG + Intergenic
1197589864 X:128394968-128394990 GATCAAATTTTCTCTACTTCTGG - Intergenic
1197627614 X:128820250-128820272 GATCAATTTTTCCCTCCTTTTGG - Intergenic
1198086212 X:133285179-133285201 ATTTCCTTTTTCTCTCCCTCAGG + Intergenic
1198726857 X:139687215-139687237 GTTCACTTCCTACCTCCTTCAGG + Intronic
1199202376 X:145107609-145107631 GTTCACTTATTCACTTCTTCAGG - Intergenic
1199296282 X:146162410-146162432 GTTAACTTTCTCTATTCTTCAGG + Intergenic
1200515470 Y:4139213-4139235 GCTCACTTTTTCTCTCTTTTAGG + Intergenic
1202192878 Y:22262127-22262149 CTTCACTTTTTCTGTACTTCTGG - Intergenic