ID: 1092764713

View in Genome Browser
Species Human (GRCh38)
Location 12:11842100-11842122
Sequence AAGAAGAAGGAGATGTAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1098
Summary {0: 1, 1: 0, 2: 4, 3: 96, 4: 997}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092764710_1092764713 2 Left 1092764710 12:11842075-11842097 CCGTCTCAAAAAAAAAAAAAAAA 0: 83672
1: 60776
2: 74199
3: 114646
4: 163091
Right 1092764713 12:11842100-11842122 AAGAAGAAGGAGATGTAGGCTGG 0: 1
1: 0
2: 4
3: 96
4: 997
1092764709_1092764713 23 Left 1092764709 12:11842054-11842076 CCTGGGCGACAGAGCGAGACTCC 0: 20329
1: 57869
2: 114465
3: 140937
4: 148571
Right 1092764713 12:11842100-11842122 AAGAAGAAGGAGATGTAGGCTGG 0: 1
1: 0
2: 4
3: 96
4: 997
1092764708_1092764713 27 Left 1092764708 12:11842050-11842072 CCAGCCTGGGCGACAGAGCGAGA 0: 26768
1: 89687
2: 191248
3: 194442
4: 151704
Right 1092764713 12:11842100-11842122 AAGAAGAAGGAGATGTAGGCTGG 0: 1
1: 0
2: 4
3: 96
4: 997

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092764713 Original CRISPR AAGAAGAAGGAGATGTAGGC TGG Intronic
900932855 1:5747714-5747736 AGGAAGAAGGAGATGGAGGAGGG + Intergenic
901144334 1:7054940-7054962 AAGATGAAGGGGAAGTAGGCTGG + Intronic
901291428 1:8127225-8127247 AAGAAGAACGTGAAGTAGACAGG + Intergenic
901319288 1:8329932-8329954 AAGTGGAAGGGGATGTAGGCAGG + Intronic
901382219 1:8882044-8882066 AAGAAAAAAGAAATGGAGGCCGG + Intergenic
901472920 1:9470224-9470246 AAGAAGAAAGAGAGGGAGGAAGG + Intergenic
901520342 1:9779040-9779062 AAGAAGAAGAAGAAGAAGGCTGG + Intronic
902006714 1:13238021-13238043 AAGGAGAACGAGATGTTGGGCGG + Intergenic
902025821 1:13382728-13382750 AAGGAGAACGAGATGTTGGGCGG + Intergenic
902224495 1:14988179-14988201 AGGAAGAAGGAGCTGCAGGCAGG + Intronic
902565954 1:17311505-17311527 AAGAAGAAGGAGACTTTGGGAGG - Intronic
902636918 1:17740747-17740769 AAGAGGAAGGGGGTGTGGGCAGG - Intergenic
902726702 1:18340959-18340981 AAGAAGAAGGAGAAGAAGGAGGG - Intronic
903337172 1:22632947-22632969 AAGAAGAAGAAGATGGATACTGG + Intergenic
903559227 1:24215511-24215533 AAGCAGAAGGAGAGGAGGGCAGG + Intergenic
903748140 1:25602386-25602408 AAGACAAAGGGGATGCAGGCAGG - Intergenic
903813950 1:26050969-26050991 AAGAAGAGGCAGATTAAGGCTGG - Intergenic
904295769 1:29518898-29518920 AAGAAGAAGGAGAAGGAAGAAGG - Intergenic
904560682 1:31395206-31395228 AAGAAGAAGAAGAAGAAGGCGGG - Intergenic
904849779 1:33448592-33448614 AAAAAGAAGTAGAAGAAGGCAGG + Intergenic
905120793 1:35680242-35680264 AAGAAAAAGGTGAAGTTGGCCGG - Intergenic
906058340 1:42932685-42932707 CAGAAGAAGAAGGTGTGGGCAGG + Intronic
906114966 1:43350338-43350360 AAGAAGCAGCAGATGAAGGATGG - Intronic
906180828 1:43817431-43817453 AAGAAGAAGGAGAAGGAAGAAGG - Intronic
906334846 1:44920014-44920036 AAGAAAAAGGACATTCAGGCCGG - Intronic
906708060 1:47909447-47909469 AAGAAGAAGGAGAAGGAGAAGGG + Intronic
906852952 1:49271705-49271727 GAGAAGAAGGAGGGGTAGGGAGG - Intronic
907773904 1:57493725-57493747 AAGAAGAAAAAGAGGGAGGCAGG + Intronic
908214787 1:61939968-61939990 AAGAATAAGCATATATAGGCCGG - Intronic
908274057 1:62450927-62450949 TAGAAGTAGGAGATGTAGAAGGG - Exonic
908694318 1:66820906-66820928 AACAAGAAGGAAATGTGGCCAGG - Intronic
909660005 1:78071531-78071553 AAGAAGAAGGAGAAGGAAGGAGG - Intronic
909679709 1:78278213-78278235 GAGAAGATGGAGAGGTAGACAGG + Intergenic
910162144 1:84284808-84284830 AAGAAGAAGGAGGGGAAGGAGGG + Intergenic
910536163 1:88300249-88300271 AAGAAGAAGAAGATGGCTGCAGG + Intergenic
910593552 1:88953885-88953907 AAGAAGAAGAAGAAGAAGGAGGG - Intronic
911053211 1:93689594-93689616 AAGAGGGAGGAGTTGTAGGGGGG + Intronic
911302782 1:96195672-96195694 AAAAAGAAGGAGATGAAAGAAGG + Intergenic
911629820 1:100170692-100170714 AAGAAGAAAGGGATGGAGGGAGG - Intronic
912114514 1:106388638-106388660 AAGGAGAAGGAGAAGTAGTAGGG + Intergenic
912228636 1:107766238-107766260 AAGAAGAAGAAGAAGGAGGAGGG - Intronic
912233748 1:107825500-107825522 AAGAGGAAGGAAATGTAGGCAGG + Intronic
912519386 1:110234775-110234797 AAGAATAAGGAGAGGCAAGCAGG - Intronic
912567967 1:110602179-110602201 AAGAACAGGGATAGGTAGGCTGG + Exonic
912791587 1:112657258-112657280 ACAAAGAAGGAGAAATAGGCCGG - Intronic
912918023 1:113837149-113837171 AAGAAGAAAGAGAAGGAAGCAGG + Intronic
913424549 1:118712993-118713015 AAAATGAAGGAGCTGCAGGCTGG + Intergenic
914121092 1:144783186-144783208 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
914805908 1:150991529-150991551 AAAAAGAAGAAGAAGAAGGCCGG - Intronic
915035307 1:152918726-152918748 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
915047181 1:153028002-153028024 AAGGAGAAGGAGAAGGAGGGAGG - Intergenic
915075972 1:153308288-153308310 ATGAAGAAAGAGAAGGAGGCTGG - Intronic
915220983 1:154374166-154374188 AAGAAGTAGGAAATATGGGCTGG + Intergenic
915271374 1:154756065-154756087 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
915997320 1:160576468-160576490 AGGAGGAAGGAGCTGTTGGCAGG - Intronic
916026662 1:160838938-160838960 AAGAGGAAGGAGAAGCAGTCAGG - Exonic
916252749 1:162754632-162754654 CAGAAGAAGGGGATGGAGCCTGG + Exonic
916604661 1:166328821-166328843 AAGAAGAAGGGGAGGGATGCTGG - Intergenic
916840771 1:168598179-168598201 AAGCATAATGAGATGTTGGCAGG - Intergenic
916987324 1:170205861-170205883 AAGAAGGAGGAGAAGGAGGTAGG - Intergenic
917049492 1:170903675-170903697 AAGATGCAGGAGATGAGGGCTGG - Intergenic
917070171 1:171141899-171141921 GAGAAGAAGGAGAGGTGGGAAGG - Intronic
917313592 1:173702588-173702610 AGGAAGAAGGAGAAGGAGGAAGG + Intergenic
918179499 1:182074127-182074149 AAGAAGAAGGAGGAGGAGGGTGG + Intergenic
918200067 1:182258343-182258365 AAGAAGAAGGGGAAGAAGGAAGG - Intergenic
918533882 1:185552858-185552880 AAAAAGAAGGGGTGGTAGGCCGG - Intergenic
919595845 1:199561519-199561541 AAGAAGAAGGAGAAGGAGGAGGG - Intergenic
919710429 1:200722018-200722040 AAGGAGAAGGTGAAATAGGCTGG + Intergenic
919887368 1:201944681-201944703 AAGAAGAGGGAGAAGGAGGGAGG - Intronic
920063269 1:203244069-203244091 AAGAAGAAGGGGAGGAAGGAGGG + Intronic
920073263 1:203318540-203318562 AAGAAGGAGGAGAGGAAGGAAGG - Intergenic
920079110 1:203359473-203359495 AAGAAGTAGGAGATGGGGGAGGG - Intergenic
920222064 1:204411401-204411423 AAGAAAAAGGAGATGGAGCCGGG - Exonic
920433002 1:205930656-205930678 AAGAGGATGGAAAAGTAGGCAGG - Intronic
921760528 1:218908597-218908619 ATGAAGAAATAAATGTAGGCTGG - Intergenic
922592839 1:226791519-226791541 AAGAAGAAGAAGAAGAAGGGAGG - Intergenic
922707962 1:227800351-227800373 AAGGAGAAGGAGAAGGAGGGGGG - Intergenic
922985480 1:229863057-229863079 AAAAAGAAGGAGATTCTGGCTGG - Intergenic
923114282 1:230919977-230919999 GAGAAGGAGGCCATGTAGGCTGG - Intronic
923663789 1:235981025-235981047 GACAAGAAGCAGATGTTGGCAGG + Intronic
923737297 1:236622676-236622698 AACAAGCAGGGGATGGAGGCTGG + Intergenic
923814445 1:237359678-237359700 AGAAGGAAGGAGATGAAGGCAGG - Intronic
924061374 1:240178427-240178449 AAGAAGAAGAAGAAGAAGGGGGG - Intronic
924375895 1:243408493-243408515 AAGAAGAAGGAGAACTAGCTTGG + Intronic
924544845 1:245016802-245016824 AAGAATAAGGCAAGGTAGGCAGG + Intronic
924583602 1:245342719-245342741 AAGAAGAAGGGGAGGGAGGGAGG + Intronic
924608669 1:245556299-245556321 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
924748161 1:246858253-246858275 TAGAAGAAGAAGGTGTTGGCCGG - Intronic
924837816 1:247672152-247672174 CAGAATAGGGAGATGCAGGCAGG - Exonic
1062936556 10:1394896-1394918 AAGAAGAAGGAGGAGGAGGGAGG - Intronic
1063057221 10:2518961-2518983 AAGAAGAAGAAGAAGAAGGGGGG + Intergenic
1063147891 10:3312987-3313009 AAGGAGAGGGAGATGAAGCCAGG - Intergenic
1063485829 10:6419983-6420005 AAAAAAAAGGAGATTTCGGCTGG - Intergenic
1063621037 10:7649314-7649336 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1063847246 10:10144336-10144358 AAGATGAAGGAGATGGTGGCTGG - Intergenic
1064119622 10:12607223-12607245 AAGAAGAAAGGGAGGGAGGCCGG - Intronic
1064210589 10:13357596-13357618 AAAAAGAAAGAAAAGTAGGCCGG - Intergenic
1064360618 10:14661076-14661098 AAGGTGAAGGGGAAGTAGGCAGG - Intronic
1064490562 10:15851377-15851399 GTGAAGAGGGAGATGCAGGCAGG - Intronic
1064635241 10:17358592-17358614 AAGAAGGAGGAGAAGGAGGGAGG + Intronic
1065185294 10:23164991-23165013 AGGAAGAAGGAGATGTGAGTGGG + Intergenic
1065383791 10:25114866-25114888 AATAAGAAGGAAATCCAGGCTGG - Intergenic
1065435287 10:25699168-25699190 CAGAAGTAGGAGATGAAGTCAGG + Intergenic
1065966987 10:30778727-30778749 AAGAAGAAGGATAAGGAGGGGGG + Intergenic
1066017335 10:31260916-31260938 AAGGAGAAGGAGTAGTAGGAGGG - Intergenic
1066187183 10:33021591-33021613 ATAAAGAAGGAAATGGAGGCTGG + Intergenic
1066984798 10:42455258-42455280 ATGGAGAAGGAGGTGGAGGCAGG - Intergenic
1067150654 10:43730039-43730061 AAGAAGAAGAAGAAGAAGACAGG + Intergenic
1067220397 10:44339970-44339992 AAAATGAAGGAGATGTGGACTGG - Intergenic
1067370495 10:45677909-45677931 ATGGAGAAGGAGGTGGAGGCAGG + Intergenic
1067389285 10:45848247-45848269 ATGGAGAAGGAGGTGGAGGCAGG - Intronic
1067416785 10:46108711-46108733 ATGGAGAAGGAGGTGGAGGCAGG + Intergenic
1067444971 10:46336302-46336324 ATGGAGAAGGAGGTGGAGGCAGG + Intergenic
1067502184 10:46815594-46815616 ATGGAGAAGGAGGTGGAGGCAGG + Intergenic
1067592401 10:47524426-47524448 ATGGAGAAGGAGGTGGAGGCAGG - Intronic
1067639517 10:48032499-48032521 ATGGAGAAGGAGGTGGAGGCAGG - Intergenic
1067873978 10:49987806-49987828 ATGGAGAAGGAGGTGGAGGCAGG + Intronic
1068466563 10:57400304-57400326 AAGAAAAACGAGATTTGGGCTGG - Intergenic
1068715583 10:60184211-60184233 GAGAAGAGGGAAAGGTAGGCAGG + Intronic
1068802473 10:61157766-61157788 AAGAAGAAGGTGATCTTGGAAGG + Intergenic
1068960824 10:62864639-62864661 AGGAAGAAGGACATGTAAACTGG - Intronic
1069277892 10:66615454-66615476 AAGAAGAAGGAGACACAGGAAGG + Intronic
1069455390 10:68549924-68549946 AAAAAGAAGAAGAAGAAGGCTGG + Intergenic
1069668738 10:70183598-70183620 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1069685737 10:70317270-70317292 AAGCAGAAGGAGGTGTAAGAGGG + Intronic
1069819715 10:71219976-71219998 AAGAGTAAGGAGAGGTCGGCTGG - Intronic
1069941859 10:71962143-71962165 AAGAAAGAGGAGTTGTCGGCTGG + Intergenic
1070136502 10:73698649-73698671 ATGGAGAAGGAGGTGGAGGCAGG - Intergenic
1070331132 10:75418100-75418122 AAGAAGAGGGAGATGGAGAGTGG - Intergenic
1070332598 10:75429116-75429138 AAGAACAAGGAGAAGGAGGAGGG - Intergenic
1070618120 10:77985144-77985166 AACAAGAAGGAAATGAAAGCAGG + Intronic
1070928565 10:80243393-80243415 AGGGAGATGGAGATGAAGGCAGG + Intergenic
1071110774 10:82152766-82152788 AAGGAGAAGGAGAAGAAGGAAGG - Intronic
1071519026 10:86317573-86317595 AGGAAGAAGAAGAGGTGGGCAGG + Intronic
1072230425 10:93409705-93409727 AAGATGAAGGTGATGAAGACAGG - Exonic
1072841355 10:98777750-98777772 AAGAAGAAGGACAAGGAGGCAGG - Intronic
1073458340 10:103651152-103651174 AAGAAGAAGGCACTGTAGGCTGG + Intronic
1073748881 10:106501274-106501296 AAGAAGAAAGAGAGGGAGGAAGG + Intergenic
1074002732 10:109388685-109388707 AAGAAGGAAGAAAAGTAGGCAGG + Intergenic
1074007854 10:109446406-109446428 AAGAAGCAGGAGTTGCAGGTGGG - Intergenic
1074081790 10:110173756-110173778 AAGAAGTATGACATGTCGGCTGG - Intergenic
1074146152 10:110718910-110718932 AAAAAGAAGTAGAATTAGGCTGG - Intronic
1074491238 10:113941532-113941554 AAGAAGCAGGAGAAATGGGCTGG - Intergenic
1074691126 10:116005054-116005076 GAGGAGAAGGAGATGGAGGGGGG - Intergenic
1074784666 10:116828422-116828444 AAGGAGATGGAGAGGTAGGAAGG - Intergenic
1076850946 10:133092728-133092750 ATGAAGAAGGAGAAATAGGGAGG + Intronic
1077996512 11:7457074-7457096 TATAAGGAGGAGATGGAGGCAGG - Intronic
1078239421 11:9516779-9516801 AAGAACAAGTTGATGAAGGCAGG - Intronic
1078279118 11:9881824-9881846 AATAAGAAGAAGAAATAGGCTGG + Intronic
1078612938 11:12837707-12837729 AAGAAGAAGGAGAAGGAGAAGGG - Intronic
1078696959 11:13644004-13644026 AATAAGACAAAGATGTAGGCTGG + Intergenic
1078894904 11:15589353-15589375 AAGAGGAAGGAATTGAAGGCTGG - Intergenic
1079006307 11:16793704-16793726 AAGAAATAGGAGATGTGGTCAGG - Intronic
1079301834 11:19285379-19285401 AAGAAGATGCAGATTTGGGCCGG + Intergenic
1079399610 11:20095676-20095698 AATAAGAAAGAGATGTGGTCTGG - Exonic
1079519223 11:21304989-21305011 AAGAAGATGGGACTGTAGGCAGG + Intronic
1079619426 11:22535157-22535179 GAGAAGAAGGAGCTGTAAGGAGG - Intergenic
1079989941 11:27235899-27235921 AAGAAGAAAGAGAGGAAGGAAGG + Intergenic
1079996665 11:27302559-27302581 AAGAAGAACAAGGTGTAGGGGGG - Intergenic
1080062008 11:27966739-27966761 AAAAAGAAAGAGATGCAGGGTGG - Intergenic
1080417526 11:32082818-32082840 AGGAAGGAGGAAATGCAGGCAGG - Intronic
1082013884 11:47469898-47469920 GAGAAGAAGGGGATGTGGGAAGG + Intronic
1082672225 11:56047629-56047651 AAGAAGAAAGAGAGGGGGGCAGG - Intergenic
1082928117 11:58572946-58572968 AAAAAGAAGGACAAATAGGCCGG + Intronic
1083047334 11:59748805-59748827 AGGAAGAAGTACATGGAGGCTGG - Intronic
1083054223 11:59804268-59804290 AAGAGGAAACAGATGTAGGGTGG - Intergenic
1083953561 11:65970447-65970469 AAGAAGAAAAAGATCTCGGCAGG + Intronic
1084502741 11:69544517-69544539 AAGGAGGAGGAGAAGCAGGCAGG + Intergenic
1084854440 11:71973194-71973216 AAAAAGAGGGAAATGTAGGCTGG + Intronic
1084892310 11:72242641-72242663 AAGAAGAAGAAGAAGAAGACTGG - Intronic
1085281712 11:75335286-75335308 CAGAAGAAGCAGATCTTGGCCGG + Intronic
1086079574 11:82889397-82889419 AAGAAGAAGGAGAAGGAGGAGGG + Intronic
1086259616 11:84923432-84923454 AAGAAGAAGAAGAAGGAGGGGGG + Intronic
1086276813 11:85139765-85139787 AGGAATGAAGAGATGTAGGCTGG - Intronic
1086737935 11:90329940-90329962 AAGAAGAAGGAGGAGAAGGAGGG - Intergenic
1086965602 11:93024625-93024647 AAGAAGGAGGAAAAGCAGGCAGG + Intergenic
1086970537 11:93075977-93075999 AAGAGGAAGGAAATCTTGGCAGG - Intergenic
1087406986 11:97743016-97743038 AGGAAGAAAGAGATAAAGGCAGG - Intergenic
1087530490 11:99375004-99375026 AAGAAAATGGAGAGCTAGGCCGG + Intronic
1087583979 11:100094676-100094698 AAGAAGAAAGAAATGAAGGAAGG + Intronic
1087625040 11:100586319-100586341 AAGTAGAATGAGATGCAGGGAGG + Intergenic
1087700530 11:101431718-101431740 AAGAAGAGGGAAATTCAGGCTGG - Intergenic
1087843276 11:102942271-102942293 AAGGAGAAGGAGAAGAAGCCAGG - Intergenic
1088489584 11:110373881-110373903 AAGAAGAAGAAGATATAAGGAGG + Intergenic
1088565921 11:111173013-111173035 AAGAAGAAGGAGAAGTACAGTGG + Intergenic
1088661580 11:112052746-112052768 AAGGGGAGGGAGATGTAGGCTGG - Intronic
1088695477 11:112362479-112362501 AAGAAGTAGGAAATGAGGGCAGG + Intergenic
1089028605 11:115298376-115298398 AAGAAGAAAGGGAAGGAGGCAGG + Intronic
1089399546 11:118156547-118156569 AAGAGGAGGGAGAGGGAGGCAGG - Intergenic
1089417241 11:118302367-118302389 AAAAAGATGGAGATTTGGGCAGG - Intergenic
1089596043 11:119580963-119580985 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1089665357 11:120014476-120014498 AAGAGGCAGGGGAGGTAGGCGGG - Intergenic
1089938647 11:122392694-122392716 AAGAAGTGGGAGAGGCAGGCGGG - Intergenic
1090204819 11:124878368-124878390 AAGAAGGAGGAGGTGGGGGCAGG - Exonic
1090267439 11:125362159-125362181 AAGAGGCAGGAGGTGTAGGGGGG - Intronic
1090328053 11:125905580-125905602 ATGATGAAGAAGATGTAGGTAGG + Exonic
1090893483 11:130948558-130948580 AAATAGAAGGAGATGTAGCTAGG - Intergenic
1091061591 11:132468099-132468121 AAGCAGAAAGAGAGGGAGGCTGG - Intronic
1091263476 11:134252653-134252675 AAGAAAAAGGAACTGTAGGTAGG + Intronic
1091363972 11:135001655-135001677 AAGAAGACGGAGAAGCAGGAAGG + Intergenic
1092252162 12:6905534-6905556 ACGATGAAGGAGCTGAAGGCTGG + Intronic
1092763917 12:11835606-11835628 AAGAGGAGGGAGGTGTAGGTGGG - Intronic
1092764654 12:11841784-11841806 GTTAAGAAGGAGATGTAGGCCGG + Intronic
1092764713 12:11842100-11842122 AAGAAGAAGGAGATGTAGGCTGG + Intronic
1093084579 12:14852466-14852488 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1093182047 12:15977752-15977774 GTGAAGCATGAGATGTAGGCTGG - Intronic
1093204661 12:16232971-16232993 AAGAAGAAAGAGAGGGAGGGAGG + Intronic
1093461101 12:19407596-19407618 AAGAAAAAAGAGATGGAGGCTGG - Intronic
1094129893 12:27063500-27063522 AAGAAGAAGGAGGAGGAGGAAGG - Intronic
1094203577 12:27817377-27817399 AAGAAGAAGGAGGGGAGGGCAGG - Intergenic
1094332484 12:29310111-29310133 TAGAAGAAAGAGTTGAAGGCAGG - Intronic
1094619249 12:32064558-32064580 AAGAAGAAGGAGAGGGAAGAAGG + Intergenic
1095650581 12:44604189-44604211 AAGAAGAAAGAGAAGGAGGGAGG + Intronic
1095730287 12:45498940-45498962 AAGAAAAACCATATGTAGGCTGG - Intergenic
1096149468 12:49299564-49299586 AAGAAGAAGAAGAAGAAGCCCGG + Intergenic
1096252917 12:50044796-50044818 TAGAGGTAGGAGATGGAGGCCGG - Intergenic
1096317925 12:50584950-50584972 ACGAAGCAGGAGAAGCAGGCAGG - Intronic
1096322990 12:50631726-50631748 AAGAAGAAGAAAATTTAGCCAGG - Intronic
1096632086 12:52934263-52934285 AAGGAGAAGGAGAAGAAGCCGGG + Intronic
1096692977 12:53332597-53332619 AAAAAGAAGCAGAAATAGGCAGG + Intronic
1097394303 12:59054905-59054927 AGGAAGAAGGAGACAAAGGCTGG + Intergenic
1097548038 12:61029303-61029325 AAGGAGAAGGAGAAGAAGACAGG - Intergenic
1097564335 12:61249859-61249881 CATAGGAAGAAGATGTAGGCTGG + Intergenic
1097738633 12:63212130-63212152 AAGGAGAAGGGGATGGAAGCAGG - Intergenic
1098005263 12:65989875-65989897 ATGAAGAAAGAGAGGTAGCCAGG + Intergenic
1098050329 12:66446237-66446259 AATAAGATGGAGATGTCTGCTGG - Intronic
1098136906 12:67412724-67412746 AAGAAGTGGGAGATTGAGGCTGG + Intergenic
1098217502 12:68235858-68235880 GAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1098495878 12:71135279-71135301 AAGAAGAAGAAGAAGGAGGAGGG + Intronic
1098630174 12:72713341-72713363 AAGAAGGAGGAGAAGAAGGAAGG + Intergenic
1098701310 12:73631187-73631209 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1098783436 12:74718348-74718370 AAGAAGAAGAAGAAGAAGACAGG - Intergenic
1098952477 12:76655270-76655292 AATAAGAAGAAAATTTAGGCTGG - Intergenic
1099157900 12:79202521-79202543 AAGAAGAAAGAGAAGGAGTCAGG + Intronic
1100129618 12:91475244-91475266 AAGAAAACAGAGATGTACGCAGG - Intergenic
1100455973 12:94752136-94752158 AAGAAAAAGGAAAGGAAGGCCGG - Intergenic
1100779395 12:98008003-98008025 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1100828768 12:98498907-98498929 AAGGTGAAGGAGATGAAGACAGG + Intronic
1100974875 12:100112036-100112058 AAGGAGAAGTAAATCTAGGCTGG - Intronic
1101358401 12:104003045-104003067 AAGAAGAAGAAGAGGTAGGGAGG + Intronic
1101545686 12:105710284-105710306 ATGAAGTTGGAGAAGTAGGCAGG - Intergenic
1102052163 12:109870626-109870648 AAGCAGAAGGAGAGGAAGGAAGG + Intronic
1102166750 12:110813006-110813028 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1102301215 12:111772956-111772978 AAAAAGAAATAGATTTAGGCAGG + Intronic
1102508780 12:113400310-113400332 AAGAAGAAAGAGAATTAGCCAGG + Intronic
1102562430 12:113771772-113771794 AAAAGGAATGAGATGAAGGCTGG - Intergenic
1102633214 12:114300170-114300192 CAGAAAAAGGATATCTAGGCTGG - Intergenic
1102777677 12:115534823-115534845 AAGAAAAAGGAGGAGTAGGCAGG + Intergenic
1103070209 12:117935122-117935144 AAGAAGAAGAATAAGAAGGCAGG - Intronic
1103371578 12:120423335-120423357 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1104309888 12:127645076-127645098 AAGAGGAAGTAGTGGTAGGCTGG + Intergenic
1104703431 12:130924677-130924699 AAGAAGAAGAAGAAGAAGACTGG - Intergenic
1105210762 13:18255509-18255531 AAGAGGATGAAGATGCAGGCTGG + Intergenic
1105715661 13:23061427-23061449 AGGAAGAAAGAGATGGAGGGGGG + Intergenic
1105977212 13:25482582-25482604 AAGAAGAAGGTGATGTGGTTTGG + Intronic
1106049442 13:26176634-26176656 AAGAAGAGGAAAATGCAGGCTGG + Intronic
1106139251 13:26997830-26997852 AAACAGAAGCAGATGGAGGCTGG - Intergenic
1106176073 13:27333033-27333055 AAGAAGAAGAAGAAGAAGGCTGG + Intergenic
1106771517 13:32965290-32965312 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1106981337 13:35285848-35285870 ATGAAGACAGAGAGGTAGGCAGG - Intronic
1107182775 13:37481194-37481216 AAGAAAAAGGAGATGTAAATGGG - Intergenic
1107676103 13:42798806-42798828 CAGAAGAAGGATTTGTAGGTAGG - Intergenic
1108465984 13:50715638-50715660 AAGAAGTCGGAGATGGAGGAGGG + Intronic
1108681094 13:52781058-52781080 AAGATGATGCAGATGCAGGCTGG + Intergenic
1109140242 13:58705647-58705669 AAAAAGAAGGAGAGGAAGGGAGG - Intergenic
1109512314 13:63394331-63394353 AGGAAGAAGGGGATGGAGGAAGG + Intergenic
1109722866 13:66298629-66298651 AGGAAGATGGAGATGGAGGGAGG + Intergenic
1110813078 13:79831843-79831865 AAGAACAAAGAGGTGTATGCAGG + Intergenic
1111654320 13:91132860-91132882 GAAAAGTAGGAGATGTAGCCAGG - Intergenic
1111706446 13:91755359-91755381 CAGAAGAAGGAAATGTTGGAAGG - Intronic
1112606309 13:100910147-100910169 ATGAAGCTGGAGAGGTAGGCAGG + Intergenic
1112698523 13:101977543-101977565 AGGAAGAAGGAGGAGTAGGGAGG - Intronic
1112878266 13:104073331-104073353 AAGAAGGTGGAGATGGAGACTGG - Intergenic
1113672434 13:112184150-112184172 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1113898838 13:113784548-113784570 AAGAAGAAGGAGGAGAAGGGAGG + Intronic
1114337383 14:21705172-21705194 AAGAATAAAAAGATGTAGTCTGG + Intergenic
1114443550 14:22770464-22770486 ATGAAGAAGGAGATGAAGATTGG - Exonic
1114831514 14:26148275-26148297 AAGAAAAAACAGATGTTGGCAGG + Intergenic
1115154540 14:30323052-30323074 CAGAGGAAGGAGAGGCAGGCAGG - Intergenic
1115275589 14:31605751-31605773 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1115298874 14:31861565-31861587 AAGAAGGAGGAGAAGAGGGCAGG - Intergenic
1115529365 14:34312808-34312830 AAGAAGAAGGAGAAGGAGAAGGG - Intronic
1115616830 14:35103222-35103244 ATGAAGTTGGAGAAGTAGGCAGG - Intronic
1115659133 14:35474601-35474623 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1116925848 14:50636001-50636023 TAGAAGAATTATATGTAGGCCGG - Intronic
1117488852 14:56226084-56226106 AAGAAGAAGAAGAAGAAGTCAGG + Intronic
1117803544 14:59467674-59467696 AAGTAGCAGGACATGTAGGTTGG - Intronic
1118304946 14:64647994-64648016 AAGCAGAAGAGGAGGTAGGCCGG + Intergenic
1118413348 14:65505606-65505628 AATAAAACTGAGATGTAGGCCGG - Intronic
1119400354 14:74358503-74358525 GAGAAGCAGGAGAAGGAGGCTGG + Exonic
1119638947 14:76299657-76299679 AAGAAGAAAGAGAGGAAGGAAGG - Intergenic
1119656737 14:76422505-76422527 TATAAGAAGGAAATGTCGGCCGG - Intronic
1119947567 14:78711009-78711031 AAGAAGAAGAAGAAGTATGGGGG - Intronic
1120050779 14:79862966-79862988 AAGAGGAAGGGGAGGTGGGCTGG + Intronic
1120191657 14:81445534-81445556 AAGAAGAAAGTGATCTGGGCTGG + Intergenic
1120281459 14:82443675-82443697 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1120371082 14:83636822-83636844 AAGGAGAAGGTGATGTGTGCAGG - Intergenic
1120395958 14:83967002-83967024 AAGAAGAAAGAGAAGAAGGAAGG - Intergenic
1120510783 14:85411789-85411811 AAGAAGAAGGAAATGTTGGCAGG + Intergenic
1120574105 14:86159317-86159339 AAAAAGAAGGAGATCTGGGAAGG - Intergenic
1120766272 14:88329521-88329543 AAGAAGAAAGAGATTTAGACTGG - Intergenic
1121080438 14:91103515-91103537 ATGCAGAAGTAGATGTAGGAAGG - Intronic
1121432973 14:93900377-93900399 CAGCAGAAGGAGATGGAGTCAGG - Intergenic
1122363882 14:101183143-101183165 AAGAAGGAGCAGGGGTAGGCAGG - Intergenic
1122531665 14:102432107-102432129 AAGAAGAAGAAGAAGAAGACAGG + Exonic
1124179225 15:27457049-27457071 AAGTAGAAGGAGCTGGAGGAGGG + Intronic
1124459631 15:29877610-29877632 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1124673041 15:31658419-31658441 AAGAAGACGGAATTGAAGGCAGG - Intronic
1125003892 15:34796826-34796848 AGGAAGAGGGAGATGTAAGAAGG + Intergenic
1125019720 15:34972537-34972559 AAGAAGAAGGAACTGTGGGGAGG + Intergenic
1125311119 15:38379082-38379104 AAGAAGAAGAAGAAGAAGTCAGG - Intergenic
1126013501 15:44326946-44326968 AAAAAAAAGCAGATGTTGGCTGG - Intronic
1126041754 15:44597886-44597908 AAGAAGAGGATGATGTAGGATGG - Intronic
1126118637 15:45231519-45231541 AAGTAGAAAGAGATGAAGGAAGG + Intergenic
1126432128 15:48597557-48597579 AAGAGGAAGCAGAAGTAGGAGGG - Intronic
1126496377 15:49295147-49295169 AAGAAGAAAGAGAAGAAGGAGGG + Intronic
1126764161 15:51996690-51996712 AAGAAGAAGGAGGAGGAGGACGG - Intronic
1126852167 15:52804144-52804166 AAGAAGTAGGGGCGGTAGGCCGG - Intergenic
1126965892 15:54053326-54053348 AAGAATAAGAAAATTTAGGCTGG - Intronic
1127272364 15:57413152-57413174 AGAAAGAAGGAGAAGAAGGCCGG - Intronic
1127647075 15:60969574-60969596 ATGGAGAAGGAGATGAAGACAGG + Intronic
1127719159 15:61682968-61682990 AAGAGGAAGGAGGAGTGGGCAGG + Intergenic
1128095618 15:64952324-64952346 AAGAAGAAGGAGAAGGAAGAAGG - Intronic
1128095631 15:64952461-64952483 AAGAAGAAGGAGAAGGAAGAAGG - Intronic
1128116665 15:65111779-65111801 AAAAAAAAAGAGATATAGGCTGG - Intronic
1128438750 15:67682841-67682863 AAAAAAAAAGAGTTGTAGGCTGG + Intronic
1129038643 15:72665868-72665890 AAGGAGGAGGAGATGAAGGTAGG + Exonic
1129057140 15:72828440-72828462 AAGTAGAAAGAGATGTAGCTCGG + Intergenic
1129211247 15:74071362-74071384 AAGGAGGAGGAGATGAAGGTAGG - Exonic
1129399156 15:75269725-75269747 AAGGAGGAGGAGATGAAGGTAGG + Exonic
1129402763 15:75294001-75294023 AAGGAGGAGGAGATGAAGGTAGG + Exonic
1129476292 15:75786422-75786444 AAGGAGGAGGAGATGAAGGTAGG + Intergenic
1129496625 15:75988481-75988503 CATTAGAAGGAGTTGTAGGCTGG - Intronic
1129728380 15:77915635-77915657 AAGGAGGAGGAGATGAAGGTAGG - Intergenic
1130914395 15:88293446-88293468 AAGAAAGAGGAGATGGATGCAGG + Intergenic
1131284840 15:91048191-91048213 AAGAAGAAGAAGAAGAAGGAGGG - Intergenic
1131465888 15:92654812-92654834 AAGAAGAAGAAAAAGTAGGCGGG + Intronic
1131821740 15:96280887-96280909 AAGAAGGAGGAGGAGGAGGCAGG + Intergenic
1131890395 15:96965961-96965983 GATAAGAGTGAGATGTAGGCTGG + Intergenic
1132791218 16:1689764-1689786 AAGAAGATGGATATGAAGGAAGG + Intronic
1133556707 16:6912914-6912936 AAAAACAAGGAGCTCTAGGCTGG - Intronic
1133817656 16:9210468-9210490 AAGAAGAAGGAGCCAGAGGCTGG - Intergenic
1133867068 16:9654255-9654277 AAGGAGAAGGAGAGGAAGGAAGG + Intergenic
1133878959 16:9763035-9763057 AAGAGGAAGAAGATGTAGGGAGG - Exonic
1133937009 16:10277624-10277646 AAGAAGAGGGGGAAGTAGGAGGG - Intergenic
1134013470 16:10872063-10872085 AAAAAGAAGTAGATATAGGAAGG - Intergenic
1134676880 16:16096971-16096993 AAGAAGAGGGACATGAAGGCTGG - Intronic
1134856040 16:17520112-17520134 ATGAAGATGGAGAAGGAGGCAGG + Intergenic
1135031165 16:19039817-19039839 CTGAAGAAGGAGATGGCGGCCGG + Intronic
1135505037 16:23029020-23029042 GAGAAGAAGGAGACCTGGGCAGG - Intergenic
1135523585 16:23196365-23196387 ATGAGGAGGGAGAAGTAGGCAGG + Intronic
1135588391 16:23688682-23688704 CAGAAGATGGGGATGCAGGCAGG - Exonic
1135846922 16:25927330-25927352 AGAAAGAAGAAGATGTAGGATGG + Intronic
1136017567 16:27412376-27412398 AAGGAGAAGGAGAAGAAAGCTGG - Intronic
1136080573 16:27849949-27849971 AAGATGAAGAAGATGAAGGGAGG + Intronic
1136585383 16:31180901-31180923 AAAAAGAAAGAAATTTAGGCGGG - Intronic
1136589050 16:31206237-31206259 AAGAAGAAAGAGAGGAAGGAAGG - Intergenic
1136620187 16:31423463-31423485 AAGAAAGAGGAGAGATAGGCGGG - Intronic
1136993274 16:35170190-35170212 AAGAAGGAGGAGTAGTCGGCGGG - Intergenic
1137397610 16:48127322-48127344 AGCAAGAAGGAGATGCATGCAGG + Intronic
1137556975 16:49477040-49477062 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1137557141 16:49477641-49477663 AAGAAGAAGGAGAAGAAGGAGGG + Intergenic
1137612804 16:49830184-49830206 CAGAAGAAGGAGAAGGAGCCAGG + Intronic
1137633199 16:49962555-49962577 AGGAAGAAGGAGATGAAGGGTGG + Intergenic
1137665793 16:50248222-50248244 AGGAAGAGGGAGAGGTGGGCGGG - Intronic
1137910232 16:52370573-52370595 AAGAATAAGGAAATGCAGACAGG - Intergenic
1138091940 16:54181987-54182009 AAGAAGAAGAAGAAGTTGGAGGG - Intergenic
1138933868 16:61695073-61695095 AAAAAGAAGAAGAAGAAGGCCGG - Intronic
1139108916 16:63864641-63864663 ACAAAAAAGGAGATGCAGGCCGG + Intergenic
1139503358 16:67386455-67386477 AAGAAGAGGCAGAGGCAGGCCGG + Intergenic
1140288701 16:73629569-73629591 AATGAGAAGAAGATGGAGGCTGG + Intergenic
1140406486 16:74714530-74714552 AAGGGGAAGGAGATGGAGGTGGG - Intronic
1140787765 16:78360287-78360309 TAGAAGTTGGAGAAGTAGGCTGG + Intronic
1141031061 16:80589001-80589023 AAGAGGAAGGAGAAGAAGACTGG + Intergenic
1141267651 16:82511476-82511498 CACAAGAGGAAGATGTAGGCTGG - Intergenic
1141275546 16:82584648-82584670 GAGAAGAAGAAGAAGTAGGGAGG + Intergenic
1141775723 16:86121615-86121637 AAGAAGAAGGAGGAGGAGGGAGG - Intergenic
1141824258 16:86468015-86468037 AAGAAGGAGGAGACCTATGCTGG + Intergenic
1141924611 16:87159940-87159962 AAGGAGAAGGAGAAGGAGACAGG + Intronic
1142400826 16:89857864-89857886 AAAAAGAAGAAGAACTAGGCTGG - Intronic
1142499692 17:325373-325395 AGGAAGATGGAGAGGTAGGCAGG - Intronic
1142607385 17:1089661-1089683 AAGAAGAAGGAAATGCAGGCCGG + Intronic
1142716369 17:1749129-1749151 AAAAAGAAGGTGATTTTGGCCGG + Intronic
1142886102 17:2912879-2912901 AAGAACATGGAGATGTTGGCTGG + Intronic
1143255819 17:5557299-5557321 AAAAAAAAAGATATGTAGGCTGG - Intronic
1143297758 17:5883880-5883902 AAGCAGGAGGAGATGGAGGCGGG - Intronic
1143622943 17:8091368-8091390 AGGGAGACGGAGATGGAGGCAGG + Intergenic
1143924786 17:10359970-10359992 AAGAAGAAGGAGACACAGCCAGG - Exonic
1144035034 17:11357217-11357239 AAGAAGAAGAAGAAGCAGGGAGG + Intronic
1144360242 17:14485223-14485245 AAGAAGAAGAAGAAGAAGGGGGG + Intergenic
1144615355 17:16766443-16766465 TATAAAAAGCAGATGTAGGCCGG + Intronic
1144712266 17:17409616-17409638 AGGAAGAAGGAGGAGTTGGCCGG - Intergenic
1144897346 17:18549219-18549241 TATAAAAAGCAGATGTAGGCCGG - Intergenic
1145135026 17:20396502-20396524 TATAAAAAGCAGATGTAGGCCGG + Intergenic
1145204415 17:20974913-20974935 AGGATGGAGGAGATGCAGGCAGG + Intergenic
1145240319 17:21237126-21237148 TTGAAGAAGGAGATGTGGGCTGG - Intergenic
1145901380 17:28492583-28492605 ATGAAGCTGGAGAAGTAGGCAGG + Intronic
1146247847 17:31306327-31306349 AGGACAAAGAAGATGTAGGCTGG - Intronic
1146264932 17:31446549-31446571 AAGAGGATGGAGATGTGGCCTGG - Intronic
1146571097 17:33954055-33954077 AAGAAGAAATGGATGTTGGCAGG - Intronic
1146758755 17:35456715-35456737 AAGAATCTGAAGATGTAGGCTGG - Intergenic
1146884110 17:36459504-36459526 ATGAGGAAGGAGATGGAGCCTGG + Intergenic
1147202835 17:38814972-38814994 AAGATGGAGGAGAAGGAGGCAGG - Exonic
1147257676 17:39191811-39191833 AGCAAGCAGGAGATGAAGGCAGG + Intronic
1147501966 17:40974493-40974515 AAGAAGAAGGAAAGGAAGGAAGG - Intergenic
1147501980 17:40974551-40974573 AAGAAGAAGGAAAGGAAGGAAGG - Intergenic
1148012665 17:44496164-44496186 TAGAAGAAGTAAAGGTAGGCTGG - Intronic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1149114907 17:53081551-53081573 ATGAAGCAGGAGAGGAAGGCAGG + Intergenic
1149487767 17:57056650-57056672 AAAAAGTAGAAAATGTAGGCTGG + Intergenic
1149783141 17:59414002-59414024 ATGAAAAAGTACATGTAGGCTGG - Intergenic
1150423612 17:65058952-65058974 AAGAAGAAGAAGAAGGAGGAAGG + Intergenic
1150564747 17:66328870-66328892 AAGAGGCTGGAGAGGTAGGCAGG + Intronic
1150801580 17:68287311-68287333 AAAAAGAAGAAGAAGAAGGCTGG - Intronic
1151486087 17:74401455-74401477 AAAAAGAAGGAAAGGTTGGCTGG - Intergenic
1152350893 17:79783704-79783726 AAGATAAAGGAGAAGTTGGCTGG - Intronic
1152516120 17:80825914-80825936 AAGTAGACGGAGACGGAGGCTGG + Intronic
1152836754 17:82538227-82538249 AAGAAAAAAAAGATATAGGCCGG + Intronic
1153318573 18:3749447-3749469 AAATAGAAGGAGATGTTGGCCGG - Intronic
1153318835 18:3751857-3751879 AAGAAGAAGAAGAAGAAGTCCGG - Intronic
1153370759 18:4313270-4313292 AAGAAAAAGTAGATGTGGGTTGG + Intronic
1153666420 18:7370866-7370888 AAGAAGAATGAGATCAACGCTGG + Intergenic
1153745942 18:8179762-8179784 AAAAAGAGGGATATTTAGGCCGG - Intronic
1154217524 18:12426256-12426278 AAGAAAAAGAAAATATAGGCCGG + Intronic
1154272524 18:12932420-12932442 AAGAAGAAGTCGTTGTAGCCAGG - Intergenic
1154981044 18:21502634-21502656 AAAAACAAGGAGATGTAGATGGG - Intronic
1155033320 18:22002856-22002878 AACAAGAAAGAGGTGGAGGCAGG + Intergenic
1155231853 18:23781816-23781838 TAGAAGCAGCAGATGTAGGAAGG - Intronic
1155233675 18:23798079-23798101 AAAAAGGAGGAGACGAAGGCAGG - Intronic
1155372818 18:25121252-25121274 AGGAAGAAGAAGAAGAAGGCTGG - Intronic
1156281966 18:35648033-35648055 AAGAAGAAGAAGAAGAAGGAAGG + Intronic
1156549291 18:37998633-37998655 AAGAATAAGGAGACATAGTCTGG + Intergenic
1156638234 18:39057279-39057301 AAGAAGAAGAAGAAGAAGCCAGG - Intergenic
1156701862 18:39835503-39835525 TAGGAAAAGGAGTTGTAGGCAGG - Intergenic
1156903707 18:42330403-42330425 AAGAAGGAGGAGATGTCTGCAGG - Intergenic
1157154102 18:45248154-45248176 AAGAGGAAGGAAATGTAGGGAGG + Intronic
1158646645 18:59254481-59254503 AAGAAGAAGAAGAGATAGGCTGG - Intergenic
1158860782 18:61590186-61590208 ATGAAGAAGGGGAGGGAGGCAGG - Intergenic
1158941922 18:62412496-62412518 TAGAAGAGGGAGGTGGAGGCTGG - Intergenic
1159109676 18:64042391-64042413 AAGAAGATGGAGAGGCAGGATGG + Intergenic
1159149575 18:64504257-64504279 AAAAAGAAGGAAAAGCAGGCAGG - Intergenic
1159181627 18:64913984-64914006 AAGAAGGAGGAGAGGAAGGAGGG - Intergenic
1159977877 18:74738441-74738463 AAAAAAAAGGAGAAGTTGGCCGG + Intronic
1161366940 19:3885564-3885586 AAGAAGAAGGAGAAGGAGAGAGG + Intronic
1161483006 19:4519990-4520012 GAGAAGAAGGAGAGGAAGGTGGG - Intergenic
1161564032 19:4989635-4989657 AAGAAGAAGAAGAAGAAGACTGG - Intronic
1161635117 19:5383652-5383674 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1161701201 19:5796620-5796642 AAGCAGAAAGAGTTGGAGGCCGG + Intergenic
1161740488 19:6018264-6018286 CATAAAAAGGAGATGAAGGCCGG - Intronic
1161904285 19:7143756-7143778 ATAAAGAAGAAAATGTAGGCTGG + Intronic
1161914944 19:7221410-7221432 AAGAAGAAGAAGAAGAAGGCTGG + Intronic
1162206419 19:9059574-9059596 AAAAAGGGTGAGATGTAGGCTGG + Intergenic
1162583065 19:11542182-11542204 AAGAAGAAGAAGAAGAAGGTCGG - Intronic
1162835988 19:13318368-13318390 AAGAGGAAGGTGGTGAAGGCAGG + Intronic
1162950036 19:14065839-14065861 AAGAAGAAGAAGAAGAAGGCTGG + Intergenic
1163113059 19:15173045-15173067 AAGAAGAAGAAGAGGGAGGAGGG - Intronic
1163387259 19:17007459-17007481 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1163480273 19:17551389-17551411 AAAAAAAAAGAAATGTAGGCCGG - Intronic
1163523986 19:17809128-17809150 ATAAACAAGGAGATGTTGGCCGG - Intronic
1163620662 19:18357866-18357888 AGGAAGACTGAGATGGAGGCTGG - Intronic
1163630652 19:18416615-18416637 AAGAAGAGGGGGATGATGGCAGG - Intergenic
1163673340 19:18642222-18642244 AAGAGGAAGGAGACGTGGGCAGG - Intronic
1163703960 19:18801527-18801549 AAGAAGAAGAAGAAGAAGGGAGG - Intergenic
1163771257 19:19192583-19192605 AAGAAGTAGGGGAAGTACGCGGG - Exonic
1164156958 19:22602875-22602897 GACAAGGAGGAGATGAAGGCAGG + Intergenic
1164311106 19:24047343-24047365 AAGAAGAAAGAAAGGTAGGAAGG - Intronic
1164539965 19:29115065-29115087 AAGAAGCAGGAGAGGAAGGAAGG - Intergenic
1164839257 19:31380361-31380383 AAGAAGGAGGAAAGGGAGGCTGG - Intergenic
1164858312 19:31542575-31542597 AAGAAGAAGAAGAAGAAGACAGG - Intergenic
1164916757 19:32058238-32058260 AGGAAGGAGGAGATGAAGGAAGG - Intergenic
1164931190 19:32177546-32177568 AAAAAGAAGGAAAGGAAGGCAGG + Intergenic
1165265888 19:34663810-34663832 AAGAAGATGGAGATGCAGAGGGG + Intronic
1165441948 19:35833525-35833547 AAGAAGATGGAGGTGGAGGAGGG + Intronic
1165682442 19:37789471-37789493 AAGAAGAAGAAGAAGATGGCCGG + Intronic
1166073094 19:40397924-40397946 AAGAAGAAGAAGATGGTGCCTGG - Exonic
1166674950 19:44734663-44734685 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1167322721 19:48806464-48806486 AAGGAGGAGGAGATGCAGACAGG + Intronic
1167553401 19:50176893-50176915 AAGATAAAGGAGAAATAGGCTGG - Intergenic
1167702110 19:51054962-51054984 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1168054207 19:53852568-53852590 AAGAAGAAGAAGAAGAAGGCTGG - Intergenic
1168064243 19:53910042-53910064 AGGAATAAGGAGATCTGGGCGGG + Intronic
1168249712 19:55134775-55134797 AAGAAGAAGGGGAGGGAGGGAGG + Intronic
1168278562 19:55290935-55290957 AAAAAGCATGAGGTGTAGGCCGG - Intronic
1168309583 19:55453649-55453671 AAGAAGAGGAAGGTGTAGACAGG - Intronic
1168527791 19:57102720-57102742 AAAACGAGGGAGATGAAGGCAGG - Intergenic
1168531521 19:57133614-57133636 ATGAAAAAAGAAATGTAGGCCGG + Intergenic
1168721759 19:58558329-58558351 AAGAAGGAGGAGGAGTCGGCGGG - Exonic
926725054 2:15991206-15991228 AAGAAGAAGAAGAAGGTGGCCGG - Intergenic
926825164 2:16898903-16898925 AAGGATAAGCAGATGGAGGCTGG + Intergenic
927323827 2:21779929-21779951 AAGCAGTAGGAAATGCAGGCAGG - Intergenic
927374581 2:22398992-22399014 CAGAAGAGGTAGATGTAGACAGG - Intergenic
927393754 2:22625922-22625944 AAGAAAGAAGAGATGTAGGGAGG + Intergenic
927478550 2:23432811-23432833 AAGAAGAAGTTGAAGTTGGCTGG + Intronic
927775000 2:25895884-25895906 AAGATGTGGGAGAGGTAGGCAGG + Intergenic
927791162 2:26010687-26010709 AAATAAAATGAGATGTAGGCCGG + Intergenic
928449603 2:31366766-31366788 AGGAAGAGGGAGATGTGGGCTGG - Intronic
928489837 2:31770457-31770479 AAGAAGAAGAAGATATAAGGAGG + Intergenic
928589941 2:32803711-32803733 AATAAGAAAAAAATGTAGGCCGG + Intronic
928628769 2:33169040-33169062 AATAAAAAGGAGTTGTAGTCGGG + Intronic
928662439 2:33516876-33516898 ATGAAGCAGGAACTGTAGGCTGG + Intronic
928838815 2:35580619-35580641 AAAAAGAAAGACATGTTGGCAGG - Intergenic
929408097 2:41666095-41666117 AAGAGGAAGGATATGAAGACAGG + Intergenic
929606577 2:43238794-43238816 AAGAAGCAGGAGGTCTAGGTGGG + Intronic
929877101 2:45805893-45805915 ATAAAGAAGGTAATGTAGGCTGG - Intronic
929951126 2:46410334-46410356 AGGAAGCAGGAGATGGAGGTAGG + Intergenic
930364680 2:50424289-50424311 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
930959036 2:57236214-57236236 AAGGAGAAGGAGATGTGAGGGGG - Intergenic
931152014 2:59585026-59585048 AAGAAGAAGGAGGGGAAGGAGGG + Intergenic
931228563 2:60354694-60354716 AAGAAGAACGAGGCTTAGGCGGG - Intergenic
931380230 2:61746059-61746081 AAGAAGAAGGAGAAGAAGAAAGG + Intergenic
931538532 2:63303978-63304000 AAAAAAAAACAGATGTAGGCAGG + Intronic
932075929 2:68662971-68662993 GAGTAGAAAGAGATGTAGACCGG - Intergenic
932196562 2:69788885-69788907 AAGAAGGAGGAGAGGGAGGGAGG + Intronic
932330094 2:70893921-70893943 AAGAAGAGGGAGATGGAGGAAGG + Intergenic
932701998 2:73998432-73998454 ACGAAGATGGAGTTGTTGGCTGG + Intronic
933010231 2:77052463-77052485 ATGAAAAGGGAGATGTCGGCTGG - Intronic
933726693 2:85431110-85431132 AAGGAGGAGGAAATGGAGGCTGG + Intronic
934016496 2:87891325-87891347 AGGGAGAAGGAGATATAGGGTGG - Intergenic
934658428 2:96130033-96130055 AAGCAGAGGGAGAAGAAGGCAGG + Intronic
934851877 2:97706979-97707001 AAGATGAGGGAGATGAGGGCCGG + Intergenic
935029067 2:99304642-99304664 AAGAAGATGAAGTTTTAGGCTGG + Exonic
935161312 2:100531806-100531828 AAAAAAAAAGAAATGTAGGCAGG + Intergenic
935458761 2:103302639-103302661 AAGAAGAAGAAGCAGAAGGCTGG - Intergenic
935942252 2:108252851-108252873 AAAAAGGAGGAGAAGTAGGGGGG + Intronic
937345966 2:121125482-121125504 AAGGAGAAGGAGAAGAAGGAAGG + Intergenic
937495203 2:122411866-122411888 AAGCAGAAGGAGAAGTGGGTGGG - Intergenic
937720189 2:125085989-125086011 AAGAAGAAGGAAATGTGGGAAGG + Intergenic
938027637 2:127964195-127964217 AAAAATAAGGAAATTTAGGCTGG + Intronic
938645759 2:133328467-133328489 AGGCAGAAGGAGAAGTAGGCTGG + Intronic
938899059 2:135783139-135783161 AATAAGAAGCTGATGGAGGCAGG - Exonic
939459159 2:142476769-142476791 ATGAAGAAGCAGATTTAGGCTGG - Intergenic
940126377 2:150330532-150330554 AGGAAGAAGAAGAAGAAGGCTGG + Intergenic
940372921 2:152922683-152922705 AAGAAGAAAGGGATGGAGGGAGG - Intergenic
940647477 2:156406794-156406816 AAGAAGAAAGAGCTTTAGGAAGG - Intergenic
941119208 2:161508502-161508524 TAGATGAAGAAAATGTAGGCTGG - Intronic
941176698 2:162205806-162205828 AATAAGAAGGAGACATAGGCCGG - Intronic
941465190 2:165817242-165817264 AAGAAGGAGGAGAAGAAGGAAGG + Intergenic
941558660 2:167016699-167016721 AAGAAGCAGGAGCTGTAGCAGGG + Intronic
942023700 2:171892519-171892541 CTTAAGAAGTAGATGTAGGCCGG - Intronic
942207728 2:173638192-173638214 AAGAAGAAGGAGGAGGAGGCAGG + Intergenic
942466194 2:176209583-176209605 AAGAAGAGGAAAATGGAGGCCGG - Intergenic
942496027 2:176541046-176541068 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
944868872 2:203889774-203889796 AAGAAGAAGAAGAGCTAGGTAGG + Intergenic
945431462 2:209770975-209770997 AGGAAGAAGGAGAAGGAGGAGGG + Intergenic
945499201 2:210548659-210548681 AACAAGAAGGAGATGAAGAAGGG - Intronic
946169713 2:217887602-217887624 AAGAACTAGGGGATGTTGGCTGG - Intronic
946188645 2:217995824-217995846 GAGAAGAAGGACTTATAGGCTGG - Intronic
946243267 2:218369780-218369802 AAGAAAAAGGAAATTGAGGCTGG - Intergenic
946620357 2:221555296-221555318 AAACAGAAGGAGATTTTGGCTGG + Intronic
947065364 2:226218195-226218217 AAAAAGAAGCAGGGGTAGGCCGG - Intergenic
947287474 2:228532584-228532606 AGGGAGAAGGAGATATAGGGTGG - Intergenic
947452857 2:230224399-230224421 AACAAGAAGGAAAAGTATGCTGG - Intronic
947543344 2:230993438-230993460 AAGAAGAAGAAGAAGAAGGTGGG + Intergenic
947627718 2:231631014-231631036 AAGAAGAAGCAAAAGTTGGCCGG + Intergenic
947850528 2:233284138-233284160 AAGAAAAAAGAAATTTAGGCTGG - Intronic
947879203 2:233490466-233490488 AAGAAAAAGCATATGTTGGCTGG - Intronic
947898268 2:233695418-233695440 AAAAAGAAGAAGAAGAAGGCCGG - Intronic
948036206 2:234860098-234860120 GAGAAGGAGGAGATGTGGGGTGG + Intergenic
948131127 2:235601299-235601321 AAGGAGAAAGAGATGGAGACAGG + Intronic
948229219 2:236337364-236337386 GAGAAGAAGGTGGTGTGGGCTGG - Intronic
949037632 2:241824519-241824541 AAGAAGAAGAAGAAGTAGTCAGG - Intergenic
1168731132 20:82021-82043 TAAAAGAAGGAGAAATAGGCTGG + Intergenic
1168817030 20:745008-745030 AAGAATAAGGGAAGGTAGGCTGG + Intergenic
1169541650 20:6606333-6606355 AAGAAGAAAGAGAGGGAGGGAGG - Intergenic
1169598912 20:7234381-7234403 AGGAAGAAGGAGATGTAGGAAGG - Intergenic
1169625067 20:7557017-7557039 AAGAATGAGGAGATGTTGGATGG - Intergenic
1170391608 20:15880816-15880838 AGGAACAAGGAGTTATAGGCAGG + Intronic
1170506347 20:17029752-17029774 AAAAAGAAGGAGATCTGGGGAGG + Intergenic
1170664858 20:18378050-18378072 ATGAAGAAGGAGATGGGGGAAGG + Intergenic
1171200670 20:23239137-23239159 GAGAAGAAGGAGATAGAGACAGG - Intergenic
1172012278 20:31852512-31852534 TAGAAGTTGGAGATGTTGGCCGG + Intronic
1172105371 20:32514193-32514215 AGGAAGAAGTAGACGTCGGCTGG + Intronic
1172129117 20:32644150-32644172 TAGAAAAAGGAGTTGTAGCCAGG + Intergenic
1172154291 20:32812855-32812877 AAGAAAGGGGAGAAGTAGGCAGG - Intergenic
1172545147 20:35754939-35754961 AAGAAGAAGAAGAAGAAAGCAGG - Intergenic
1172569864 20:35961582-35961604 AAAAAGCAGGAGAGGGAGGCAGG - Intronic
1172764433 20:37343805-37343827 AAGAACAAGGCGAGGTAGCCAGG + Intergenic
1172928640 20:38564908-38564930 AAGAAGAAGAAGAAGAAGGGAGG - Intronic
1173122020 20:40302157-40302179 AAGAAGGAGGAGAAGGAGGGAGG + Intergenic
1173233808 20:41225417-41225439 AAAAAGAAAGAAAGGTAGGCTGG - Intronic
1173264707 20:41468716-41468738 AAGAAACAGGGGATGTAGGTGGG + Intronic
1173775124 20:45698979-45699001 AAGAAGAAGGAGGAGAAGGAGGG + Intronic
1173978592 20:47205967-47205989 AAGAAGAGGGAGATGCAGTGAGG - Intergenic
1174404084 20:50292590-50292612 AAGAGGCAGGAGATGGAGGCTGG - Intergenic
1174506456 20:51020816-51020838 AAGAACAAAGAGATGTGTGCTGG - Intronic
1174671617 20:52313357-52313379 AACAAGAAGCCGATGTGGGCTGG - Intergenic
1174707026 20:52667563-52667585 AAGAAGAAGGTGGTGAAGGAAGG - Intergenic
1174851199 20:53996861-53996883 GAGAGGATGGAGATTTAGGCAGG - Intronic
1174978935 20:55369882-55369904 AAGAAGAAGCAGAGGAAAGCGGG + Intergenic
1175094024 20:56527674-56527696 CAGAAGCAGGAGAGGGAGGCAGG + Intergenic
1175779448 20:61672955-61672977 TAGAAGAAGAAGAAGGAGGCAGG + Intronic
1176049494 20:63110194-63110216 AAGATGAAGGAGGAGCAGGCAGG + Intergenic
1176214416 20:63941502-63941524 AAGAGGAAGCAGAAGTGGGCCGG + Intronic
1176721412 21:10396801-10396823 AAAAAAAAGGAGAAGAAGGCTGG + Intergenic
1177507233 21:22034756-22034778 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1178142494 21:29699943-29699965 AAAAAAAAGAAGATGTTGGCTGG - Intronic
1178424927 21:32471620-32471642 AAAAAAAAGGAAATGGAGGCTGG - Intronic
1178643201 21:34363308-34363330 AAGAAGAAGACGATGTGGGAAGG - Intergenic
1179081804 21:38178535-38178557 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1179185399 21:39081804-39081826 AAGGAGAAGGAGAAGAAGGAGGG + Intergenic
1179200844 21:39219127-39219149 AAAAATAAGGAGAAGCAGGCAGG + Intronic
1179423369 21:41253606-41253628 AAGAAGCAGGAGGAGAAGGCAGG + Intronic
1179455452 21:41496679-41496701 AAGAAGGGGAAGATGTGGGCTGG - Intronic
1180302603 22:11049577-11049599 AAAAAAAAGGAGAGGAAGGCTGG + Intergenic
1180765493 22:18343908-18343930 AAGAGGATGAAGATGCAGGCTGG - Intergenic
1180780823 22:18518484-18518506 AAGAGGATGAAGATGCAGGCTGG + Intergenic
1180813536 22:18775791-18775813 AAGAGGATGAAGATGCAGGCTGG + Intergenic
1181199720 22:21210121-21210143 AAGAGGATGAAGATGCAGGCTGG + Intronic
1181400041 22:22645737-22645759 AAGAGGATGAAGATGCAGGCTGG - Intronic
1181412983 22:22737988-22738010 GAGAAGGAGGAGATGGAGGATGG + Intronic
1181562842 22:23715631-23715653 CAGAAAAAGAGGATGTAGGCTGG + Intergenic
1181649323 22:24250053-24250075 AAGAGGATGAAGATGCAGGCTGG + Intergenic
1181702015 22:24626835-24626857 AAGAGGATGAAGATGCAGGCTGG - Intronic
1181738087 22:24897763-24897785 AATAAGAAAGTGATCTAGGCTGG - Intronic
1181896385 22:26111583-26111605 AAAAAGAAGGAGAAGAAGGAGGG - Intergenic
1182015495 22:27036048-27036070 AAGAAGAAGAAGAAGAATGCAGG - Intergenic
1182029533 22:27147005-27147027 AGGAAGGAGGAGATACAGGCTGG - Intergenic
1182367969 22:29791381-29791403 AAGAAGAAGAAGAAGAAGGCTGG + Intronic
1182824429 22:33252352-33252374 ATGGAGAAGGAGAGTTAGGCTGG - Intronic
1182934647 22:34209572-34209594 ATGAAGATGGAAAGGTAGGCAGG - Intergenic
1183020077 22:35019851-35019873 AAGAATAAAGACATGGAGGCTGG - Intergenic
1183111770 22:35654825-35654847 AAGAAGCAGCAGATGCAGGAAGG + Intronic
1183173429 22:36204585-36204607 GAGAATAAGGAGATGGAGGGAGG + Intronic
1183257335 22:36770968-36770990 AAGAAAAAGGAGAAGCAGGCGGG - Intronic
1183466992 22:37984790-37984812 AGGAAGGAAGAGATGTAGGCTGG + Intronic
1183618346 22:38958549-38958571 AAGAAGAAAGAGAGGAAGGAAGG - Intronic
1183792855 22:40087808-40087830 GAGGAGCTGGAGATGTAGGCAGG + Intronic
1184113061 22:42406436-42406458 AAGTGGAAGGAGATGCAGCCAGG - Intronic
1184564198 22:45282053-45282075 AAGAAGAAAGAGAGGAAGGAAGG + Intergenic
1184676180 22:46044706-46044728 AAGAAGGAGGAAAAGCAGGCCGG - Intergenic
1184989886 22:48160220-48160242 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1185177876 22:49340354-49340376 AAGAAGAAAAAGAAGGAGGCTGG - Intergenic
1203227115 22_KI270731v1_random:84798-84820 AAGAGGATGAAGATGCAGGCTGG - Intergenic
1203263636 22_KI270734v1_random:1473-1495 AAGAGGATGAAGATGCAGGCTGG + Intergenic
949102541 3:163459-163481 AAGGAGAAGAAGATGGAGGAGGG - Intergenic
949242711 3:1890933-1890955 AAGAAGATGGAGAAGGAGGAGGG - Intergenic
949250082 3:1973143-1973165 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
949253388 3:2015265-2015287 AAGAAGGGAGAGATGCAGGCTGG + Intergenic
949449672 3:4171735-4171757 GAGGAGATGGAGTTGTAGGCTGG + Intronic
949747916 3:7316179-7316201 AGGAAGAGGGAGATGAAGTCAGG + Intronic
949825750 3:8163411-8163433 ATTAAGAAGGAGATAGAGGCAGG + Intergenic
950284230 3:11732279-11732301 AAGAAGAAAGGGAGGAAGGCAGG - Intergenic
950506116 3:13395612-13395634 AAAAAGAAGGAAATACAGGCTGG - Intronic
951263346 3:20538563-20538585 AACATGAAGTAAATGTAGGCTGG - Intergenic
951376843 3:21928404-21928426 AAGAAGAAAGGGATGCAGGGAGG + Intronic
951578480 3:24137641-24137663 ATGAGGAAGCAGAGGTAGGCAGG + Intronic
952276898 3:31886029-31886051 AAGGAGAAGGAGATGGGGGGTGG + Intronic
952647621 3:35680777-35680799 AAGAAGAAAGAGAAGGAGGGAGG - Intronic
952991269 3:38832998-38833020 CAGAAGCAGGAGCTGCAGGCAGG + Intergenic
953156319 3:40377585-40377607 AAGAAGAAAGAGAGGAAGGAAGG + Intergenic
954241316 3:49296033-49296055 AAAAAGTAGCAGATGCAGGCCGG + Intronic
954406314 3:50347132-50347154 AGAAAGAAGCAGATGTAGCCAGG - Intergenic
954716483 3:52529336-52529358 TAGAGGAAGGAGATGCAGGGAGG + Intronic
954804144 3:53205849-53205871 AAGAAATAGGAGAAATAGGCTGG + Intergenic
955077269 3:55625453-55625475 AAGAAGAGGGAGGAGGAGGCTGG + Intronic
955307450 3:57848549-57848571 AAGAAAAAGGAGAAGGAGGGAGG - Intronic
955429298 3:58826108-58826130 AGGAAGAAAAAGATGTAGTCCGG - Intronic
955703123 3:61701913-61701935 AAGAGGAAGGAGAGGGAGGAAGG + Intronic
956202630 3:66722314-66722336 AAGAAGAAGGAGAAAGAGGGAGG - Intergenic
956253562 3:67260180-67260202 AAGAAGCAAGAAATGTAGGCAGG - Intergenic
956565375 3:70631220-70631242 AAGAAGAAAGAGAGGAAGGAAGG + Intergenic
956598930 3:70998036-70998058 AAGAAGAAAGAGATAAAAGCGGG + Intronic
956627493 3:71281066-71281088 AAGAAGAAGAAAAAGTAGCCAGG + Intronic
956765754 3:72482887-72482909 AGGCAGAAGGAGAAGTAGGTTGG + Intergenic
958434970 3:94085458-94085480 AAGAAGATGGAAATGTTGGCTGG + Intronic
959486168 3:106929176-106929198 AAGAAGAAGAAAATTTAAGCTGG + Intergenic
959629129 3:108488602-108488624 AAAAAGAAGGAAATCTTGGCTGG - Intronic
960125184 3:113990803-113990825 AAAAAAAAGGAAATGCAGGCTGG + Intronic
960680169 3:120239391-120239413 AAGAAGAAGAAGAAGAAGGGAGG - Intronic
960709613 3:120514579-120514601 AAGAAGAAGGAGAGGGAGGGGGG - Intergenic
960813337 3:121647380-121647402 AGGAAGAAAGAGATGGAGTCAGG - Exonic
960884563 3:122381427-122381449 AAGAAGAGGAAGAGATAGGCTGG + Intronic
961345293 3:126260128-126260150 AAGAGGAAGGAGATGTGGAGAGG - Intergenic
961879406 3:130050281-130050303 AAGAAGAAGGAGAAGAAGGAAGG + Intergenic
962137828 3:132756274-132756296 AAGAAGCTGGAGATGTGAGCAGG + Intergenic
962621665 3:137186310-137186332 AAGGAGAAGGAGAGGGAGGTAGG + Intergenic
962769689 3:138600901-138600923 AAGAAGGAGGAGAAGGAGGGAGG + Intergenic
963075687 3:141344348-141344370 TAGAAGAAGAAGATGGAGGAAGG - Intronic
963214055 3:142724613-142724635 AAGAGGATGGAGAGGAAGGCAGG - Exonic
963217543 3:142766383-142766405 AAAAAAAAAAAGATGTAGGCTGG - Intronic
963831228 3:150011801-150011823 AAGAAGAAGAAGAAGAAGGCCGG + Intronic
964108105 3:153060453-153060475 AAGAAGAAAGAGAGGGAGGAAGG + Intergenic
964374401 3:156035408-156035430 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
964544738 3:157821387-157821409 AAGTAGATGGAGCTATAGGCAGG - Intergenic
965380450 3:167981678-167981700 AAGAAGAAGAAGAGGGAGACAGG - Intergenic
965802088 3:172504971-172504993 AAGAAGAGGGAAATTTGGGCCGG - Intergenic
966378054 3:179317188-179317210 ATGAAGAAACAGATTTAGGCTGG - Intergenic
966454362 3:180098554-180098576 AAGAAGAAGGAAATGATGCCAGG - Intergenic
966521900 3:180882344-180882366 AAGAAGAAGGAGACGGAAGAAGG - Intronic
966554331 3:181242435-181242457 AAGAAGAAGAAGATGATGACAGG - Intergenic
966564433 3:181360760-181360782 AAGAAGAAGAAGAAGAAGGAAGG + Intergenic
966592348 3:181696532-181696554 AAGAAGAAAGAGAGGGAGGGAGG - Intergenic
966613557 3:181891527-181891549 AAGAAAAAGAAAATGTGGGCTGG - Intergenic
966680295 3:182634818-182634840 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
966705276 3:182906790-182906812 AAGAAGAAGAAGAAGAAGGCCGG + Intronic
966764337 3:183446651-183446673 TAGAAGAAATAGATGTTGGCCGG - Intergenic
966790691 3:183666855-183666877 AAGCAGATGGAGATGGGGGCAGG - Intronic
966921858 3:184617282-184617304 AAGAAGAAGGAGAAGGAGAAGGG + Intronic
967071841 3:185969196-185969218 TAGAAAAAGTAAATGTAGGCTGG + Intergenic
967390724 3:188951460-188951482 AAGAAGAAGAACATGGAGACTGG + Intronic
967983370 3:195078522-195078544 AGGAAGAGGGGGAGGTAGGCTGG - Intronic
968318502 3:197744987-197745009 AAGAAAAGGGGGATTTAGGCTGG + Intronic
968336501 3:197918029-197918051 AAGAAGGAGGAGAAATGGGCTGG - Intronic
969268147 4:6079404-6079426 AGGTAGAGGGAGATGGAGGCAGG + Intronic
969331409 4:6475207-6475229 ATGGAGATGGAGATGAAGGCGGG + Intronic
969823717 4:9740263-9740285 AAGCAGAAGGAGAAGAAGGAAGG - Intergenic
969838398 4:9862076-9862098 AAAAAGAAGTAGATGCAGGAAGG + Intronic
970368830 4:15387887-15387909 AAAGAGAAGGAAATGTATGCAGG + Intronic
970491244 4:16576279-16576301 AAGATGAAGGAAATGAAGGTTGG + Intronic
970599004 4:17626242-17626264 AAGAAAAAGGAGATGTTGAATGG + Exonic
970614380 4:17754253-17754275 AAGAAGAAGAGAATTTAGGCTGG + Intronic
970781990 4:19748605-19748627 AAAAAGAAGGAGATGAAGCAAGG - Intergenic
971001951 4:22333150-22333172 AAGGTGAAGGAGAAGCAGGCAGG - Intergenic
971386481 4:26145011-26145033 AAAAAGAAGAAGAAGAAGGCAGG - Intergenic
971420268 4:26467987-26468009 AAGAAGAAGAAGAAGAAAGCGGG + Intergenic
971584256 4:28384875-28384897 AAGAACTAGGAAATGTAGCCAGG - Intronic
972200663 4:36710736-36710758 TAGTAAAAGAAGATGTAGGCTGG + Intergenic
972206174 4:36775437-36775459 AAGAAGCAAGAGCTGTAGGAGGG + Intergenic
972331067 4:38064919-38064941 AAAAAAAAAGAAATGTAGGCTGG - Intronic
972475315 4:39444436-39444458 GAGAAGAATGAGATGAAGGTGGG - Intronic
972729651 4:41781588-41781610 AAGGGGAAGGAAATTTAGGCTGG + Intergenic
974162622 4:58159316-58159338 AAGAAGAATTAGAGGTGGGCTGG - Intergenic
974490586 4:62558618-62558640 AAGAAGTAGGAGCTGAATGCTGG + Intergenic
974831786 4:67198591-67198613 AAGAGGAAGGAAATGTAGACTGG - Intergenic
975124108 4:70762487-70762509 AAGGGGAAGAAGATGAAGGCTGG - Intronic
975228470 4:71902948-71902970 AAAAAGAAGGAAATGAAGGCAGG - Intergenic
975437630 4:74371817-74371839 AAAAAGGAGGAGACATAGGCAGG - Intronic
976118104 4:81749987-81750009 TGGAAGAAGGAGATGTAGTTCGG - Intronic
976324376 4:83754169-83754191 AAGTGGAAGAAGGTGTAGGCTGG + Intergenic
976858079 4:89628474-89628496 ATGAAGAGGGAGAGGTAGGAAGG - Intergenic
977126334 4:93173429-93173451 AAGAAGAAAGAGAGGGAGGGAGG + Intronic
977595001 4:98868923-98868945 AAGAAGAAGAAGAAGTTGGGTGG + Intergenic
978184173 4:105837382-105837404 AAGAAAAAGGTGAGGTAAGCAGG - Intronic
978404542 4:108365107-108365129 AAGAAGAAACAGAAGAAGGCAGG + Intergenic
978429182 4:108616045-108616067 AAGAATGAGGATATATAGGCTGG + Intergenic
979702701 4:123686344-123686366 ATGAAGATGGAGAGGTAGGTAGG + Intergenic
980071957 4:128252956-128252978 AAGGGGAAGGAGATATAGGGTGG + Intergenic
980730545 4:136818442-136818464 AAGAAGGAAGAAATGTAGGAAGG - Intergenic
980833034 4:138154741-138154763 AAGAAGAAGAAGAAGAAGGATGG - Intergenic
980879732 4:138697625-138697647 AAGAAGAGAGAGATGTAGAAAGG - Intergenic
980971558 4:139572187-139572209 AAGAAGAAGAAGATGGAAGATGG - Intronic
981001063 4:139829467-139829489 AAGGGGAAGGAGATGAAGCCAGG + Intronic
981025053 4:140069476-140069498 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
981025068 4:140069537-140069559 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
981138796 4:141242886-141242908 AAGAATAAAGAGAAGTTGGCTGG - Intergenic
981268830 4:142819966-142819988 AGGGAGGAGGTGATGTAGGCTGG - Intronic
981440379 4:144775679-144775701 ATCAAGTTGGAGATGTAGGCAGG + Intergenic
981495674 4:145389397-145389419 AGGAAAAAGGAGTTGTGGGCGGG - Intergenic
981589629 4:146345438-146345460 AAAAAGATGGAAATGTAGGCAGG - Intronic
981756520 4:148146077-148146099 AAGAAGAAGGGGAAGTGGGCTGG + Intronic
981766000 4:148250922-148250944 AAGAAAAAGGTGATGGAGACTGG - Intronic
982057081 4:151562273-151562295 ATGAAGAAGGAGGGGTAGGAAGG + Intronic
982615134 4:157632350-157632372 TAGAAAAAGGAAATTTAGGCCGG + Intergenic
983029811 4:162785595-162785617 AAGAAGAAGAAGAAGTAGTCAGG + Intergenic
983252550 4:165361258-165361280 AAGGAGAGGGAGAAGTAGCCAGG + Intronic
983339289 4:166437382-166437404 AAGAAGCAGGTGATGTAACCAGG + Intergenic
983555308 4:169054269-169054291 AAAAATATGGAGATGTAGCCGGG - Intergenic
983640810 4:169942496-169942518 AAGAAGAACGTGAGGTAGGCCGG - Intergenic
984605064 4:181775734-181775756 AACATGGAGGAAATGTAGGCTGG - Intergenic
984632567 4:182076187-182076209 AAGAAGAAGGAGAAAGAGGCTGG - Intergenic
985177336 4:187215569-187215591 AATAAGAAAGGGATGGAGGCCGG - Intergenic
985269114 4:188177423-188177445 AAAAAAAAGGAGATGGGGGCAGG + Intergenic
985313815 4:188632558-188632580 AAGAAGAAGGGGAGGGTGGCCGG + Intergenic
985429774 4:189868018-189868040 GAGAAGAAGCAGATGCAGGCAGG - Intergenic
985690137 5:1304322-1304344 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
986495461 5:8337495-8337517 GAAAAGAAGGAGATGGAAGCAGG - Intergenic
986534971 5:8777330-8777352 AAGAACAAGAACATTTAGGCAGG + Intergenic
986566759 5:9123416-9123438 AAGAAGAAGGAAAAGGAGGAGGG + Intronic
986606390 5:9527367-9527389 AAAAAGAAAGAGAAGTATGCTGG - Intronic
986731944 5:10641205-10641227 AAGAAGAAGAAGAAGAAGACTGG - Intronic
987206802 5:15635677-15635699 ATGAAGATGGAGAAGTAGGCAGG + Intronic
987876028 5:23682022-23682044 CAGAAGAAGAATATGGAGGCAGG - Intergenic
988632077 5:32942324-32942346 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
988852447 5:35193067-35193089 AAGAAGAAGGATATGTCCACAGG - Intronic
988857499 5:35243197-35243219 AAAAAGAAGGCAAAGTAGGCTGG + Intergenic
989071550 5:37517016-37517038 AAGAACAAGAATATATAGGCCGG - Intronic
989278008 5:39610974-39610996 AAGAAGAAGGAAAGGAAGGAAGG - Intergenic
990029543 5:51240342-51240364 AAGAAGAAAGATATACAGGCAGG + Intergenic
990123430 5:52484364-52484386 AAGAAGAAGGAGAATGAGGAGGG + Intergenic
990362473 5:55034716-55034738 AAGAAAGAGAAGATGAAGGCCGG + Intergenic
990635577 5:57722500-57722522 AGGAGGCTGGAGATGTAGGCAGG + Intergenic
990731331 5:58812176-58812198 AAAAAGAAAGAGATGGGGGCTGG + Intronic
990743116 5:58932603-58932625 CAGAAGAAGCAGATGAAGGGTGG - Intergenic
991293045 5:65051172-65051194 AAGAAGAAAGGGATTTGGGCTGG + Intergenic
991921094 5:71657720-71657742 AAGAATAAGGAGATGTGGTCAGG - Exonic
991937017 5:71811920-71811942 AAGAAGAAAGAGATCCATGCAGG - Intergenic
992843819 5:80724262-80724284 AAAAAGAAGGAGTTGTAGCTAGG + Intronic
993127357 5:83851583-83851605 AAGAAAAACCAGATGCAGGCCGG - Intergenic
994825392 5:104707621-104707643 AAGAAGAAGGAGGAGGAGGAAGG + Intergenic
995073512 5:107953104-107953126 AAAAAAAGGCAGATGTAGGCCGG + Intronic
995086573 5:108117978-108118000 AAAAAGCAGGAGATGGAGGGAGG + Intronic
995492096 5:112704371-112704393 TAGAGGAAAGAGATGTTGGCAGG - Intergenic
996408646 5:123131018-123131040 AAGAATAAAGAAATGTAAGCAGG - Intronic
996964687 5:129293947-129293969 AAGAAGAAAAAAATGTAGACAGG + Intergenic
997289641 5:132719178-132719200 TAGATGAAGGATATGTAGGTTGG - Intronic
997338487 5:133124182-133124204 AAGAAGAAAGAAATGTGGGAGGG + Intergenic
998078906 5:139258568-139258590 ATGAGGAAGGACAGGTAGGCAGG + Intronic
998622182 5:143806958-143806980 AAGAAGCAGAAGCTGCAGGCTGG - Intergenic
998800768 5:145866564-145866586 AAGAAGAAAGCTATGGAGGCAGG - Exonic
998852430 5:146364002-146364024 CAGAAGAAGGAGATGAAGGGTGG + Intergenic
999274873 5:150323527-150323549 AAGAAGAATGAGCTGAAGGCAGG - Intronic
999286365 5:150396587-150396609 AAGAAGAAGAAGCTGGGGGCCGG + Exonic
999990551 5:157046170-157046192 AAAAAGTAGGCCATGTAGGCTGG + Intronic
1000010971 5:157232580-157232602 AAGAAGAAAGAGAGGAAGGGAGG + Intronic
1000209815 5:159098684-159098706 AAGAAGAAAGAAAAGAAGGCAGG + Intronic
1000726837 5:164782341-164782363 AACAAGAAAGAGATTGAGGCTGG - Intergenic
1001230416 5:169982420-169982442 AAGAAGAGGGAAATCAAGGCAGG - Intronic
1001719974 5:173848796-173848818 AAGAAGAAGAAGCTGGAGGCAGG - Intergenic
1001737807 5:174021114-174021136 AAGAAGAAGGAGAAGGAAGAAGG + Intergenic
1001775227 5:174323915-174323937 GAAAAGAAGGAGATATAGTCTGG - Intergenic
1001890973 5:175338239-175338261 AAGAAGAAGAAGAAGGAGACAGG - Intergenic
1001919452 5:175588783-175588805 AAGAAGAAAGAGAGGGAGGGAGG + Intergenic
1002201342 5:177530420-177530442 CAGGAGAGGGAGATGGAGGCAGG - Intronic
1002644260 5:180645494-180645516 AGGAAGAGGGAAATGCAGGCAGG + Intronic
1003020615 6:2505766-2505788 AAGGACAAGGAGAGGTAGGTGGG - Intergenic
1003052515 6:2792763-2792785 AAAATGAAAGAGATGCAGGCTGG - Intergenic
1003273617 6:4629036-4629058 AAGAAAATGAAGATGTAGGCTGG - Intergenic
1003509929 6:6771287-6771309 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509940 6:6771330-6771352 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509951 6:6771373-6771395 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1004122106 6:12833843-12833865 GAGTAGAAGGAGAGGGAGGCTGG - Intronic
1004387211 6:15183534-15183556 AAAAAGAAGAAGAAGGAGGCTGG - Intergenic
1004450503 6:15740976-15740998 AAGAAGTGTGAGATGCAGGCGGG + Intergenic
1004462717 6:15853434-15853456 AAGAAGAAGGAGAAGCAGAAGGG - Intergenic
1004945609 6:20609354-20609376 AAGGAGAAGGAGAAGAAGGGAGG - Intronic
1005002975 6:21261302-21261324 AAGAAGAAGGAGGAGGAGGAAGG + Intergenic
1005197876 6:23310181-23310203 AAGAAGCAGAAGATATAGGAGGG + Intergenic
1005306405 6:24518218-24518240 AAAAAGAAAGAAAGGTAGGCTGG + Intronic
1005464119 6:26095191-26095213 ATGAAGAAAGTGAAGTAGGCCGG + Exonic
1005478785 6:26234851-26234873 AAGAAAAAGGCGAAGAAGGCAGG - Exonic
1005865806 6:29935136-29935158 GAGAAGAAAGAGATGGAGGGAGG - Intergenic
1005944563 6:30585947-30585969 AAGCTGAAGGAGCTGAAGGCAGG + Exonic
1005979187 6:30823371-30823393 AAGAAGAAGAAGAAATGGGCTGG - Intergenic
1006081918 6:31572786-31572808 CAGAAGGAGGAGGTGTAGGGTGG - Exonic
1006231585 6:32592192-32592214 AATAAGAAGGAGATTTGTGCAGG - Intergenic
1006751316 6:36379579-36379601 AAGAAGAAAAAGAAGAAGGCCGG + Intronic
1007042090 6:38732010-38732032 CATAAGAAAGAAATGTAGGCTGG - Intronic
1007066765 6:38998155-38998177 GAGAAGAGGGAGATTTGGGCAGG + Intronic
1007114119 6:39331158-39331180 AAGAAGAAGGAGTTGGGGGTGGG - Exonic
1007118463 6:39361260-39361282 AAGAAGAATGGGTTGGAGGCTGG + Intronic
1007132062 6:39484550-39484572 AAGAAGCTGGAAATGTAGACAGG + Intronic
1007175186 6:39891518-39891540 AAGAGGAAGGGGATGGAGGTGGG + Intronic
1007365334 6:41387725-41387747 AAGAGGAAAGAAATTTAGGCTGG - Intergenic
1007835996 6:44674192-44674214 AAGAAGGAGTAGATGGAGGCTGG + Intergenic
1007877068 6:45116210-45116232 GAGAAGAAGGAGAGGAAGGGAGG - Intronic
1008246759 6:49184684-49184706 AAGAAGAAGGAGGTGGGGGGAGG - Intergenic
1008889858 6:56475567-56475589 AACAAGAAGGATATATAGGAAGG + Intronic
1009552587 6:65118245-65118267 ATGATGTAGGAGATGTGGGCTGG + Intronic
1009722748 6:67495720-67495742 AAGGAGAAGGAGAAGTAGTATGG + Intergenic
1010290013 6:74124604-74124626 AAGAAGAAAGAGAAAAAGGCAGG - Intergenic
1010295037 6:74185640-74185662 AAGTAGAAGGAAAAGGAGGCAGG + Intergenic
1010866232 6:80979458-80979480 AGGAAGAAGTAGGTATAGGCTGG - Intergenic
1011215743 6:85003967-85003989 AAGAGGAATGACATGTAGGTGGG - Intergenic
1011621783 6:89250313-89250335 AAGAAGAGGCAGGTGAAGGCCGG + Intergenic
1011647215 6:89471375-89471397 AAAAAAGAGGAGATCTAGGCAGG + Intronic
1011742617 6:90377649-90377671 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1011843346 6:91529306-91529328 AAGAAAGAGGAGAGGGAGGCAGG + Intergenic
1012165669 6:95948056-95948078 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1012214456 6:96564783-96564805 AAGAACAAGGAAATGCAAGCTGG - Intronic
1012596003 6:101041050-101041072 AAAAAGAAGGAGAAGAAGGCAGG - Intergenic
1012713184 6:102634369-102634391 AAGAAGAAGAAGAAGAAGGAAGG + Intergenic
1012734208 6:102918108-102918130 AAGAAGAAGGAAAGGAAGGAAGG - Intergenic
1012956484 6:105576380-105576402 AAAATGAAGGAGTTGTAGTCAGG - Intergenic
1013793590 6:113860094-113860116 AAGAAGAACAAGAAGGAGGCTGG + Exonic
1014012623 6:116493802-116493824 AAGAAGAGGAAGGTGTAGACAGG + Intergenic
1014062069 6:117083064-117083086 AAGAAGAATGAGAGCTAGGAGGG - Intergenic
1014540646 6:122671509-122671531 AAGGAGAAGGAAATGTAGTTTGG - Intronic
1014696521 6:124628154-124628176 AAGTAGAAGGAGATGTAAGAGGG - Intronic
1014869973 6:126581949-126581971 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1014948005 6:127519013-127519035 AAGAGGAAAGAGAAGAAGGCGGG + Exonic
1015645251 6:135380035-135380057 AAGAAGAAAGAGAGGGAGGGAGG - Intronic
1015990606 6:138937624-138937646 ATGCAGAAGGAGATGGAGACAGG + Intronic
1016794118 6:148099645-148099667 AAGAAGAAGAAGAAGAAGCCTGG - Intergenic
1016801476 6:148173513-148173535 AAGAAGAAGGGGAAGAAGGGGGG + Intergenic
1016978317 6:149830761-149830783 AGGAAGATGGTGATGTAGGGAGG + Intronic
1017201428 6:151758776-151758798 AAGAAGAAGGAGAGGAAGCTGGG + Intronic
1017238515 6:152141772-152141794 AAAAATAAGCAGAGGTAGGCTGG + Intronic
1017669517 6:156756648-156756670 AAGGAGAAGGAGAGGAAGGAAGG + Intergenic
1017988542 6:159466182-159466204 AAGAAGAAGAAGAAGAAGCCGGG - Intergenic
1018403742 6:163454610-163454632 AAGAAGAAATGGAGGTAGGCAGG - Intronic
1018476234 6:164144882-164144904 CAGAAGGAGGAGATGTCGGATGG - Intergenic
1018931594 6:168243641-168243663 GAGAGGAAGGAGAGGAAGGCTGG - Intergenic
1018931602 6:168243681-168243703 GAGAGGAAGGAGAGGAAGGCTGG - Intergenic
1019118823 6:169787021-169787043 AGGAAGAAGGAGAGGAAGGAAGG - Intergenic
1019465964 7:1189138-1189160 AGGAAGAAGAAGAAGAAGGCGGG + Intergenic
1019841272 7:3447998-3448020 AAGAATAAAGATATATAGGCCGG - Intronic
1021562503 7:21982434-21982456 AAGGAGAATGAGATGTAGAAGGG + Intergenic
1021622461 7:22562254-22562276 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1021751887 7:23809089-23809111 AAGAAGAAGGTGAAGTAGCTAGG - Intronic
1021796946 7:24265354-24265376 AAGAAGCAGGAGAAGCAAGCAGG + Intergenic
1021871382 7:25009807-25009829 AAGAAAATGAAGATGTAGGTGGG - Intergenic
1021971103 7:25966772-25966794 AAGAAGAAAGGGATGGAGGTAGG + Intergenic
1022001850 7:26233494-26233516 AAGAAGAAGAAGAAGAAGGCTGG + Intergenic
1022215234 7:28253204-28253226 AAGGAGAAGGAGAAGGAAGCAGG - Intergenic
1022286769 7:28961085-28961107 AAGAATCTGGAGATGCAGGCTGG + Intergenic
1022569791 7:31441116-31441138 GAGAAGAAGGGGATGTAAGTTGG + Intergenic
1023318533 7:38968010-38968032 AAGAAACAAGAGATATAGGCTGG + Intergenic
1023319849 7:38983343-38983365 AGGAAGAAAGGGATGTAGGGAGG - Intronic
1023565693 7:41521966-41521988 AAGAAGAAGAAGAAGAAGGAAGG + Intergenic
1023934192 7:44727526-44727548 AAGTAATAGGAGATGAAGGCAGG + Intergenic
1024059153 7:45685486-45685508 AACAAGATGGAGCTGGAGGCAGG + Intronic
1024144935 7:46504649-46504671 AAGAAGGAGGAGAGGAAGGGAGG + Intergenic
1024533955 7:50414719-50414741 AATCAGTAGGAGAAGTAGGCCGG + Intergenic
1024721003 7:52137363-52137385 AAGAAGAAGGAGGAGGAGGGGGG + Intergenic
1024846259 7:53646192-53646214 AAGAAGAAGGAGGAGGAGGAAGG - Intergenic
1024919304 7:54541706-54541728 AAGATGAAGGAAAAGAAGGCAGG + Intergenic
1025607550 7:63050288-63050310 AAGAAGAAGAAGAAGAAGGAAGG + Intergenic
1026027996 7:66762616-66762638 AAGAAATAGGACATGAAGGCTGG + Intronic
1026159082 7:67852903-67852925 AAGAACAAGGAGATAGAGGGGGG + Intergenic
1026258585 7:68734420-68734442 AAGAAGTAGGACAAGAAGGCCGG - Intergenic
1026452012 7:70537763-70537785 ATGAAGGAGGAAATGAAGGCAGG + Intronic
1026524473 7:71142350-71142372 AGGAAGAAGGAAATGGAGTCTGG - Intronic
1026559923 7:71440184-71440206 AAGAAGAAAGATATGTAAGAGGG - Intronic
1026576251 7:71573979-71574001 AAGAAGAAGGAGATCACGGATGG - Intronic
1027044649 7:74983305-74983327 AAGAAGAAAGAAATGTGGCCGGG - Intronic
1027766658 7:82352578-82352600 TAAAAGATGGAGATGCAGGCTGG + Intronic
1027882216 7:83855132-83855154 AAGAAGAAGGAGAAAGAGGCAGG + Intergenic
1027902619 7:84136915-84136937 AAGAAGAAGGGGAGGAAGGAAGG + Intronic
1028246828 7:88489565-88489587 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1028408408 7:90501194-90501216 TAGAAAAAGGAGATACAGGCAGG + Intronic
1028923237 7:96329471-96329493 AAGAAGAAGGAGCAGCAGCCAGG + Intergenic
1029321157 7:99761475-99761497 AAGAAGAAGGAGGAGAAGGAGGG - Intronic
1029366513 7:100119895-100119917 TAGAAGAAGGAGGTGTGGCCGGG - Intronic
1029469296 7:100744011-100744033 AAGAACAAAGAGATATAGGCTGG - Intronic
1029521299 7:101064361-101064383 AAAAAGAAGGAGCTGCAGGGTGG - Intergenic
1029554002 7:101255060-101255082 AAGAAGAAGGAGAAGCTGGCTGG + Intergenic
1029886461 7:103877810-103877832 AAGAAGAAGGAGGAGGAGGAAGG - Intronic
1030046682 7:105503351-105503373 AATAAGAAGCAGCTGTAGGTTGG - Intronic
1030457144 7:109790415-109790437 AAGAGAAAGATGATGTAGGCTGG + Intergenic
1030540240 7:110821614-110821636 TAGAAAAAGGAAAGGTAGGCTGG + Intronic
1030771889 7:113485373-113485395 AAAAAGATGGAGATGAAGGGAGG + Intergenic
1030840257 7:114343205-114343227 AAGATGTAGAAGATGTAGGGAGG - Intronic
1031208229 7:118790201-118790223 AAGAAGAAAGAGGTGGAGGAGGG + Intergenic
1031209044 7:118798578-118798600 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1031382823 7:121109533-121109555 AAGAAGAAGCTGATGTAGAGGGG - Intronic
1031943596 7:127815493-127815515 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1032131814 7:129235403-129235425 AAGAAGAATGAGAAGGAGGCTGG - Intronic
1032491023 7:132324612-132324634 AAGAAGAGGGAGATTTATTCTGG - Intronic
1032995603 7:137442744-137442766 AGGGAGAAGGAGTTTTAGGCTGG - Intronic
1033331467 7:140420447-140420469 AAGAAGGAGCAGAAGGAGGCAGG + Intronic
1033850571 7:145489338-145489360 AAGAAGAACAAGATTGAGGCAGG - Intergenic
1034140113 7:148807714-148807736 AACAGGAAGGAGATGTCCGCTGG + Intronic
1034191655 7:149217827-149217849 AAGAAGAGGGAAGTGAAGGCAGG + Intronic
1034374517 7:150630501-150630523 AAGAAGGAGGAGGTGGAGGAAGG + Intronic
1034537497 7:151734831-151734853 AAAAAGAATCAGATTTAGGCTGG - Intronic
1034634198 7:152554271-152554293 ATGAAGGAAGAGAGGTAGGCAGG + Intergenic
1034945486 7:155259156-155259178 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1035315402 7:157994524-157994546 AGGAACAAGGAGCTGTAAGCTGG - Intronic
1035315408 7:157994565-157994587 AGGAACAAGGAGTTGTAAGCTGG - Intronic
1035315421 7:157994646-157994668 AGGAACAAGGAGCTGTAAGCTGG - Intronic
1035315427 7:157994687-157994709 AGGAACAAGGAGCTGTAAGCTGG - Intronic
1035315433 7:157994728-157994750 AGGAACAAGGAGTTGTAAGCTGG - Intronic
1035315438 7:157994768-157994790 AGGAACAAGGAGTTGTAAGCTGG - Intronic
1035315444 7:157994808-157994830 AGGAACAAGGAGCTGTAAGCTGG - Intronic
1035315450 7:157994849-157994871 AGGAACAAGGAGCTGTAAGCTGG - Intronic
1035315456 7:157994890-157994912 AGGAACAAGGAGTTGTAAGCTGG - Intronic
1035315461 7:157994930-157994952 AGGAACAAGGAGTTGTAAGCTGG - Intronic
1035315474 7:157995011-157995033 AGGAACAAGGAGCTGTAAGCTGG - Intronic
1035315486 7:157995095-157995117 AGGAACAAGGAGTTGTAAGCTGG - Intronic
1035315491 7:157995135-157995157 AGGAACAAGGAGTTGTAAGCTGG - Intronic
1035315497 7:157995175-157995197 TAGAACAAGGAGTTGTAAGCTGG - Intronic
1035315504 7:157995255-157995277 AGGAACAAGGAGTTGTAAGCTGG - Intronic
1035315516 7:157995336-157995358 AGGAACAAGGAGCTGTAAGCTGG - Intronic
1037158104 8:15731126-15731148 CAGAAGAAGGAGATTTAGAGTGG + Intronic
1037277719 8:17199663-17199685 AAGAAGAAGAAGAAGGAGGGAGG - Intronic
1037292033 8:17361204-17361226 AAGAAGAAAGAGAGCAAGGCTGG - Exonic
1037660535 8:20922552-20922574 AAGAAGGAGGGGAGGTCGGCAGG - Intergenic
1038281254 8:26167199-26167221 AATAAGAAGGAGATGTAAAAAGG + Intergenic
1038550342 8:28462251-28462273 AAGAAGAAGAAAATGAATGCAGG - Intronic
1038827385 8:31019627-31019649 AAGAAAAAAGAGATATTGGCTGG - Intronic
1038978082 8:32723822-32723844 AAGAAGAAGGGCATGAAGGAAGG + Intronic
1039176273 8:34810370-34810392 CAGCAGAAAGAGATGGAGGCTGG + Intergenic
1039503509 8:38034788-38034810 GGGAAGAAGGGGATGTAGGCTGG + Intronic
1039827273 8:41185192-41185214 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1041539788 8:58970626-58970648 CAGTAGAAAGAGATGTGGGCTGG - Intronic
1041753884 8:61291705-61291727 AAGAAGGAAGAGAGGAAGGCAGG - Intronic
1041830066 8:62143865-62143887 CAGAAGATGGAGATGCAGGCAGG + Intergenic
1041853170 8:62417099-62417121 AGGAGGATGGAGATGTAGGTGGG - Intronic
1041861420 8:62517615-62517637 AAGAAGAATGGGATGTGGGAGGG + Intronic
1042130474 8:65582718-65582740 GAGGAGAAGGAGAAGGAGGCAGG + Intergenic
1042363898 8:67914542-67914564 AAAAAGAAGGGGAGGAAGGCTGG - Intergenic
1042777455 8:72449224-72449246 AAGAATAAGGAGATGAGAGCAGG - Intergenic
1042942189 8:74118755-74118777 AAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1043088218 8:75864606-75864628 AAGAGTAAATAGATGTAGGCTGG + Intergenic
1043407285 8:79950957-79950979 AGGAAGAAGGAAATGGAGGTGGG - Intronic
1043493466 8:80774364-80774386 TAGAAAAAGAAGATTTAGGCTGG - Intronic
1043812951 8:84765294-84765316 AAGAACAAGGAGAGGTAGTGGGG + Intronic
1044831147 8:96250675-96250697 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1045126937 8:99102344-99102366 ATGAAGAAGAAAATGTAGACAGG - Intronic
1045987468 8:108265270-108265292 AAAAAAAAAAAGATGTAGGCTGG - Intronic
1046015600 8:108601126-108601148 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1046095966 8:109560887-109560909 AAGAAGAAGAAGATGCAGCCTGG + Exonic
1046252472 8:111650722-111650744 AGAAAGAAAGAGATGTAGGCCGG - Intergenic
1046494774 8:114999005-114999027 AGGAAGAAGGAGAGGAAGGGAGG - Intergenic
1046860181 8:119082589-119082611 TTGAAGACGGAGATGGAGGCAGG + Intronic
1046971085 8:120224009-120224031 AAAAAAAAGGAGATGAGGGCAGG - Intronic
1047073647 8:121375986-121376008 AAGAAGAAGGAGGAGTATGAGGG - Intergenic
1047200037 8:122757364-122757386 AAGGAGAAGGAGATGTGGTAAGG - Intergenic
1047492731 8:125387816-125387838 AAAAAAAAGGAAATGTAGGCTGG + Intergenic
1047727825 8:127699568-127699590 AAAAAGAACGAGATGCAGACAGG + Intergenic
1048083691 8:131155692-131155714 AAGAAGAAAAAGATGAAGTCCGG + Intergenic
1048141414 8:131798266-131798288 AGGCAGAAGGAGATGGATGCTGG + Intergenic
1048350958 8:133615937-133615959 AAGAAGAAAGAGAGGAAGGGAGG - Intergenic
1048403759 8:134097269-134097291 AAGAAAAAGGAGAAATAGGGAGG + Intergenic
1048430863 8:134369282-134369304 AAGAAGAAGAAGAAGAAGGGAGG - Intergenic
1048590795 8:135818810-135818832 AGGAAGAAGGAGCAGTAGGTGGG - Intergenic
1049034171 8:140061632-140061654 AAGGAAAAGGAGGTGTAGACAGG + Intronic
1049173474 8:141176714-141176736 ATGGTGAAGGAGATGTGGGCTGG + Exonic
1049536601 8:143185531-143185553 AACCAGAGGGAGATGTTGGCTGG - Intergenic
1050118251 9:2282440-2282462 CAGAAAAAGGATATCTAGGCAGG + Intergenic
1050465367 9:5917409-5917431 ATGAAGCTGGAGAGGTAGGCAGG + Intronic
1050489283 9:6170670-6170692 AAGAAGAAGGAAAAATAGGTAGG - Intergenic
1051187901 9:14479974-14479996 AGGAAGAAGGAGAAGGAGGCAGG + Intergenic
1051546737 9:18283932-18283954 AAGAAGAAGAAGAAGAAGGCTGG + Intergenic
1052994524 9:34544124-34544146 CAGAAGAGGGAGAGGAAGGCAGG + Intergenic
1053037827 9:34840535-34840557 AAGAAGAAGAAGAAGAAGGAAGG - Intergenic
1054329836 9:63740671-63740693 AAGATGAAGAAGGAGTAGGCAGG + Intergenic
1054408538 9:64785488-64785510 AAGAAGGAGGAGATGAGGGAAGG - Intergenic
1054488592 9:65752198-65752220 AAGAAGGAGGAGATGAGGGAAGG + Intergenic
1054955854 9:70909242-70909264 AAGAAAAAGGATTTGTAAGCTGG + Intronic
1055200072 9:73648544-73648566 ATGGAGAAGGAGGTGGAGGCAGG + Intergenic
1055254980 9:74358668-74358690 AAGAAGAAGGACATAGGGGCAGG - Intergenic
1055618061 9:78093826-78093848 AAGAAGAAAGAGAGGGAGGGAGG + Intergenic
1056328037 9:85497246-85497268 AAGAGGAAGGAGAAGGAGGAAGG + Intergenic
1056558700 9:87711021-87711043 AAGAATAAAAAGATGGAGGCGGG + Intergenic
1056620963 9:88214255-88214277 AAAAAAAAGGAGATCTTGGCCGG - Intergenic
1056860230 9:90174478-90174500 AGGAAGTAGGAGGTGGAGGCCGG - Intergenic
1057001603 9:91514771-91514793 TAAAAGAATAAGATGTAGGCTGG - Intergenic
1058896200 9:109402573-109402595 AAAAAGAAGAAAATGTAGGCTGG - Intronic
1059037184 9:110767250-110767272 AAAAAGAAAGTGATGTAGGGAGG - Intronic
1059302725 9:113328055-113328077 CAGAAGAAGGAGAAGCAAGCTGG + Intronic
1059646245 9:116270881-116270903 AATAAGAAGGATATCAAGGCAGG + Intronic
1059761680 9:117343891-117343913 AAGAAGAAAGAGATCAAGGAAGG + Intronic
1059799485 9:117735881-117735903 AAAAAGAAGAAGAAGAAGGCTGG + Intergenic
1059811019 9:117855703-117855725 TAGAAGAAAGAGATGGAAGCTGG + Intergenic
1060625852 9:125110651-125110673 AAGGTGAAGGAGAAGCAGGCAGG - Intronic
1060769810 9:126324555-126324577 AAGAAGAAGAAGAAGAAGGAAGG + Intergenic
1061229993 9:129310045-129310067 AAGGAGAGGGAGATGAGGGCTGG - Intergenic
1061236118 9:129343574-129343596 AGGAGGATGGAGATGTGGGCAGG + Intergenic
1061347268 9:130036747-130036769 AAGAAAAAGGAGCAGTAGGCCGG + Intronic
1061385632 9:130287806-130287828 AAGAGGAAGGAGAGAGAGGCAGG + Intronic
1061769445 9:132906717-132906739 AAGAAGAAGGTAATGTATGTGGG - Exonic
1062092580 9:134686221-134686243 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1062638406 9:137503569-137503591 AAGGAGAAGGAGAAGGAGGAGGG + Intronic
1185510425 X:660049-660071 AAGAAGAAGAAGAAGAAGGCTGG - Intergenic
1185538357 X:882046-882068 AAAAAAAAGGAGAGGAAGGCTGG - Intergenic
1185814493 X:3142397-3142419 AAGAAGAAGGAGGAGGAGGTGGG + Intergenic
1185925666 X:4142868-4142890 AAGAAGAATGAGATGCAGTGGGG - Intergenic
1186189401 X:7054119-7054141 AATAAGAAGGTGACGTAGGCTGG + Intronic
1186264560 X:7818535-7818557 AAGAAGGAGGAGAAGGAGGGCGG + Intergenic
1186677594 X:11835380-11835402 AGAAAGAAGGAGATGGAGGAGGG - Intergenic
1187025797 X:15434169-15434191 AAGAAGAAGGAGGAGAAGGAAGG + Intronic
1187025802 X:15434217-15434239 AAGAAGAAGGAGATAGAAGAAGG + Intronic
1187342539 X:18434050-18434072 AAGAAGAAAATGATGCAGGCAGG - Intronic
1187713132 X:22074166-22074188 AAGAAGAATAAAATGTAGCCTGG - Intronic
1188617698 X:32179006-32179028 AGGGAGAGAGAGATGTAGGCAGG - Intronic
1189341026 X:40204692-40204714 AAAAAGAAGGAAATTGAGGCTGG - Intergenic
1189518890 X:41744638-41744660 AATAAGAAGGAAATATGGGCCGG - Intronic
1189650840 X:43187938-43187960 AAGAAGAAGTAGAAGGGGGCAGG + Intergenic
1189684395 X:43548808-43548830 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1189713601 X:43841376-43841398 AACAAGAAGGAAAATTAGGCAGG + Intronic
1189805108 X:44727709-44727731 AAGAAGAAGAAGAAGAAGGCCGG + Intergenic
1190047480 X:47124281-47124303 AAGAAGAAAGAGAAAGAGGCCGG + Intergenic
1190047538 X:47124738-47124760 AAGAAGAAAGAGAGGGAGGGAGG + Intergenic
1190156664 X:47999081-47999103 AAAAAGAAGGAAATTCAGGCCGG + Intronic
1190363819 X:49673223-49673245 AAGAAGAAGAAGATCTGGCCAGG - Intergenic
1190579188 X:51874019-51874041 AAGGAAAAGGAGATGTTGGTAGG + Intronic
1192130219 X:68542879-68542901 AAAAAGAAGAAGAAGAAGGCTGG - Intergenic
1192191038 X:68991266-68991288 AAGAACAAAGAGATGGAGGAAGG - Intergenic
1192605530 X:72512886-72512908 AAGAGGACTGAGAAGTAGGCAGG - Intronic
1193102974 X:77636788-77636810 AAGAAGAAGGAGAAGGAAGAAGG + Intronic
1193369119 X:80672310-80672332 AAGAATAAGGGTATATAGGCCGG + Exonic
1194060025 X:89184739-89184761 AAGAAGAAGGACAAGTACACTGG + Intergenic
1194942447 X:100027278-100027300 AAGAAGAAAGAGAGGAAGGAAGG + Intergenic
1196292174 X:113955679-113955701 AAGAAAAATGATTTGTAGGCCGG + Intergenic
1196495344 X:116318022-116318044 AAGAACAAGGAGCAGTAGCCAGG + Intergenic
1196769799 X:119282107-119282129 AAGAAAATGGAGAGGGAGGCCGG - Intergenic
1196789261 X:119449431-119449453 AAGAAGAATGAATTGGAGGCTGG + Intronic
1198246037 X:134832697-134832719 AAAAAGAATGAGATCCAGGCTGG - Intronic
1198511730 X:137358823-137358845 ATGAAGATGGAGAAGTAGCCAGG - Intergenic
1198679216 X:139163555-139163577 AAGAAGAAGAAGTTGTACACTGG + Intronic
1199127990 X:144147215-144147237 AGGGAGAAGGAGATATAGGGTGG + Intergenic
1199134530 X:144234810-144234832 AAAAAAAAGGAAATGTAGGCTGG + Intergenic
1199312769 X:146340924-146340946 AAGAAGAAGGAAAGGAAGGAAGG - Intergenic
1199357476 X:146878588-146878610 AGAAATAAGGAGATGTAGCCAGG + Intergenic
1199575825 X:149312782-149312804 CAGCAGAAGCAGATGTATGCAGG - Intergenic
1199693348 X:150326018-150326040 AGGAAGAAGGAAGTGTAGGAAGG - Intergenic
1199702901 X:150398187-150398209 ATGAAGTGGTAGATGTAGGCTGG - Intronic
1199702918 X:150398387-150398409 AAGAAGAAGAAGAAGAAGACAGG + Intronic
1200150892 X:153950940-153950962 AAGAAGCAGGAGCTGCAGCCAGG - Exonic
1200243837 X:154512276-154512298 AAGAAGAAGAAGAAGAAGCCGGG + Intronic
1200251658 X:154557318-154557340 AGGATGACGGAGATGGAGGCTGG - Intronic
1200253865 X:154569002-154569024 AGGATGACGGAGATGGAGGCTGG - Intergenic
1200263904 X:154635406-154635428 AGGATGACGGAGATGGAGGCTGG + Intergenic
1200266109 X:154647098-154647120 AGGATGACGGAGATGGAGGCTGG + Intergenic
1200415621 Y:2906915-2906937 AAAAATAAGGAGAAGGAGGCTGG - Intronic
1201461675 Y:14232565-14232587 AAGAAGAAGCAGAAGAAGGAAGG - Intergenic
1201741072 Y:17325299-17325321 AAGAAGAAAGAGAGGGAGGGAGG + Intergenic