ID: 1092765862

View in Genome Browser
Species Human (GRCh38)
Location 12:11852179-11852201
Sequence GGGTGGGACAAGACCATGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 196}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092765856_1092765862 7 Left 1092765856 12:11852149-11852171 CCTGCATTTTCAGCTTGGATCTA 0: 1
1: 0
2: 1
3: 13
4: 130
Right 1092765862 12:11852179-11852201 GGGTGGGACAAGACCATGACAGG 0: 1
1: 0
2: 0
3: 8
4: 196
1092765854_1092765862 11 Left 1092765854 12:11852145-11852167 CCCACCTGCATTTTCAGCTTGGA 0: 1
1: 0
2: 0
3: 11
4: 233
Right 1092765862 12:11852179-11852201 GGGTGGGACAAGACCATGACAGG 0: 1
1: 0
2: 0
3: 8
4: 196
1092765851_1092765862 30 Left 1092765851 12:11852126-11852148 CCCAAAGGGTTTTGAGGCACCCA 0: 1
1: 0
2: 0
3: 5
4: 105
Right 1092765862 12:11852179-11852201 GGGTGGGACAAGACCATGACAGG 0: 1
1: 0
2: 0
3: 8
4: 196
1092765852_1092765862 29 Left 1092765852 12:11852127-11852149 CCAAAGGGTTTTGAGGCACCCAC 0: 1
1: 0
2: 0
3: 10
4: 91
Right 1092765862 12:11852179-11852201 GGGTGGGACAAGACCATGACAGG 0: 1
1: 0
2: 0
3: 8
4: 196
1092765855_1092765862 10 Left 1092765855 12:11852146-11852168 CCACCTGCATTTTCAGCTTGGAT 0: 1
1: 0
2: 0
3: 15
4: 225
Right 1092765862 12:11852179-11852201 GGGTGGGACAAGACCATGACAGG 0: 1
1: 0
2: 0
3: 8
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092765862 Original CRISPR GGGTGGGACAAGACCATGAC AGG Intronic
900705157 1:4075957-4075979 GGGTGGGGCAAGACCAGGAGAGG - Intergenic
901159199 1:7162191-7162213 GGCTGGGGCAAGACCATGTATGG + Intronic
903907365 1:26696347-26696369 GGGGGGGAGAAGACGAAGACAGG + Exonic
905515301 1:38558200-38558222 GAGTGGGATCAGACAATGACTGG - Intergenic
906631525 1:47373039-47373061 GGATGGAACAAGACCATGGATGG + Exonic
907291342 1:53414902-53414924 AGGAGGGACCACACCATGACAGG + Intergenic
907447640 1:54519212-54519234 GTGTGGGGCAAGACCAGGAAAGG + Intergenic
913958721 1:143323552-143323574 GGATGGGACCAGAGCAGGACAGG + Intergenic
914053038 1:144148932-144148954 GGATGGGACCAGAGCAGGACAGG + Intergenic
914126159 1:144817609-144817631 GGATGGGACCAGAGCAGGACAGG - Intergenic
919343539 1:196345344-196345366 GTCTGGGAGAAGACCATTACAGG + Intronic
921007208 1:211106228-211106250 TGGTGGGCCAAGACCTTGCCAGG + Intronic
922751957 1:228074169-228074191 GGGTGGGACTATGCCAGGACGGG - Exonic
923329424 1:232909025-232909047 GGGAGGGAGAAGCCAATGACAGG - Intergenic
1064231170 10:13529797-13529819 TGGTAGGACAGGAACATGACGGG + Intergenic
1064836527 10:19537781-19537803 AGGAGGGACAAGATCATGAAGGG - Intronic
1066758950 10:38737036-38737058 GGATGGGACCAGAGCAGGACAGG - Intergenic
1068226292 10:54110738-54110760 GGGTGAGACAAGTGTATGACTGG + Intronic
1068681242 10:59822863-59822885 GGGTGGGACAGGGCCATGGGTGG - Intronic
1069536868 10:69260227-69260249 GGCTCAGACAAGACCAAGACTGG + Intronic
1069813008 10:71176220-71176242 GGGTGGGACAAGAGTTTGAAGGG + Intergenic
1078633525 11:13028161-13028183 GGTTGGGGCCAGACCATGATGGG + Intergenic
1079420002 11:20277091-20277113 GGGTGGGACACCACAATGGCCGG + Intergenic
1080834751 11:35929807-35929829 GGGTTAGATAAGGCCATGACGGG + Intergenic
1083477001 11:62921350-62921372 GGGTGGGACATGCCAATCACTGG - Exonic
1084894327 11:72254441-72254463 GGGAGGGACAAGCACATGACGGG + Intergenic
1085531504 11:77194758-77194780 GGCTGGCACAAGACCAGGAAAGG - Intronic
1090375983 11:126289816-126289838 CGGTGGGAAAAGAACATGGCAGG + Exonic
1090725431 11:129521679-129521701 GGGTGGGGTAAGAGCATGAGGGG - Intergenic
1092765862 12:11852179-11852201 GGGTGGGACAAGACCATGACAGG + Intronic
1096140644 12:49239888-49239910 GCTTGGGACAGGACCAGGACGGG + Intronic
1097297778 12:57985505-57985527 GGGTGGGAGATGGCCATGGCTGG + Intergenic
1097355004 12:58591325-58591347 GGGTGAGAAAAGACCATGCTGGG + Intronic
1099543210 12:83941383-83941405 GGAGGAGAGAAGACCATGACAGG + Intergenic
1103461471 12:121108177-121108199 GGGAGGGACAACACCCTGGCTGG + Intergenic
1106398701 13:29406641-29406663 GTGTGGGACAGGACCACAACAGG + Intronic
1111182582 13:84687816-84687838 AGGTGGGACAGGCCCATGAATGG + Intergenic
1113584881 13:111458353-111458375 GGGTGGGACAAGCTCAGGACTGG - Intergenic
1113862778 13:113500675-113500697 GGGAGTGGCACGACCATGACAGG + Intronic
1114267835 14:21083054-21083076 GGGTGGGACAAGCACCGGACTGG + Intronic
1117737783 14:58785034-58785056 CGCTGGGAAAAGACAATGACTGG - Intergenic
1118725968 14:68629139-68629161 GGGAGGGACAAAACCAAGAATGG - Intronic
1119830310 14:77696473-77696495 AGGTAGGACAAGACCAGGCCCGG - Intronic
1122877070 14:104672705-104672727 GAGTGGGATAAGACGATGATAGG - Intergenic
1202929683 14_KI270725v1_random:26640-26662 GGATGGGACCAGAGCAGGACAGG - Intergenic
1123422614 15:20144592-20144614 GGATGGGACCAGAGCAGGACAGG + Intergenic
1123531841 15:21151132-21151154 GGATGGGACCAGAGCAGGACAGG + Intergenic
1123907541 15:24935476-24935498 GGATGTGACAGGACCATGAGTGG + Intronic
1132481139 16:166652-166674 GCGTGGGACAAGTTCCTGACTGG + Exonic
1133403630 16:5506405-5506427 GGCTGGGACTAGACCAAGAAAGG - Intergenic
1136220618 16:28825400-28825422 GGGTGGGAGAAGACACTCACAGG - Exonic
1136285127 16:29236334-29236356 GGGGGGGCCCAGCCCATGACAGG + Intergenic
1136723854 16:32342173-32342195 GGATGGGACCAGAGCAGGACAGG + Intergenic
1136773094 16:32858172-32858194 GGATGGGACCAGAGCAGGACAGG - Intergenic
1136842179 16:33548217-33548239 GGATGGGACCAGAGCAGGACAGG + Intergenic
1136862137 16:33710756-33710778 GGATGGGACCAGAGCAGGACAGG - Intergenic
1136897521 16:34003347-34003369 GGATGGGACCAGAGCAGGACAGG + Intergenic
1137384592 16:48029952-48029974 GGCTGGGAGAAGACCAGGAGAGG + Intergenic
1139774909 16:69311144-69311166 GGGTGGGACAAGGCCGGGGCGGG - Intronic
1140044979 16:71434433-71434455 GGATGGGACAAGACAATGCGCGG + Intergenic
1141830227 16:86506166-86506188 GGGTTGGACAAGACCATGCAGGG - Intergenic
1142090190 16:88205958-88205980 GGGGGGGCCCAGCCCATGACAGG + Intergenic
1203002577 16_KI270728v1_random:175592-175614 GGATGGGACCAGAGCAGGACAGG - Intergenic
1203075519 16_KI270728v1_random:1120282-1120304 GGATGGGACCAGAGCAGGACAGG - Intergenic
1203123632 16_KI270728v1_random:1558939-1558961 GGATGGGACCAGAGCAGGACAGG - Intergenic
1203134183 16_KI270728v1_random:1711998-1712020 GGATGGGACCAGAGCAGGACAGG - Intergenic
1203147369 16_KI270728v1_random:1810327-1810349 GGATGGGACCAGAGCAGGACAGG + Intergenic
1203152344 16_KI270728v1_random:1848514-1848536 GGATGGGACCAGAGCAGGACAGG + Intergenic
1143357056 17:6338095-6338117 GGTTGGTACAACACCATGAGAGG - Intergenic
1146285606 17:31572389-31572411 TGGTGGGACATCACCCTGACCGG + Intronic
1147311441 17:39598321-39598343 GGGTGGGACAGGAGCAGGAATGG - Intergenic
1149292224 17:55228382-55228404 GGAAGGGACAAGCCCAGGACTGG - Intergenic
1152012746 17:77728482-77728504 GGGTGGGAGAAGACCTGGTCAGG + Intergenic
1152218121 17:79046231-79046253 GGGTGACACAAGACAATGCCGGG - Intronic
1154414608 18:14170471-14170493 GGGTGGCACAGGGCCAAGACCGG + Intergenic
1154415725 18:14174301-14174323 GGGTGGGACCAGAGCAGGGCAGG + Intergenic
1158573828 18:58619142-58619164 GGGAGGAAGAAGACCATGTCGGG + Intronic
1161053919 19:2180418-2180440 GGGTGGGAGAGGAGCAGGACCGG + Intronic
1161316874 19:3621324-3621346 GGCTGGGACAAGCCCATCAGTGG - Intronic
1162070204 19:8148558-8148580 GGGAGGGAGAAGACCGGGACAGG + Intronic
1163780541 19:19245000-19245022 TGGTGGGACAAGGCCAGGCCTGG - Intronic
1163797311 19:19345100-19345122 GGGTGGGACAAGATGCTCACTGG - Intronic
1165777414 19:38412942-38412964 GGGTGGGTGAAGCCCATGGCAGG + Exonic
1165941010 19:39414831-39414853 GGATGGGACTGGACCAAGACAGG + Intronic
1166594689 19:44035040-44035062 GGCTGGGAAAAGCACATGACTGG + Intergenic
1167170085 19:47825120-47825142 AGCTGGGACAACACCATGCCCGG + Intronic
1167435438 19:49476035-49476057 GAGAGGGACAAGACCAAGAGAGG - Intronic
1168128209 19:54298905-54298927 TGATGGGACAACCCCATGACAGG - Intergenic
1202692434 1_KI270712v1_random:101355-101377 GGATGGGACCAGAGCAGGACAGG + Intergenic
925130907 2:1493467-1493489 GGGTGGGACAGGACTCTGCCCGG + Intronic
925130921 2:1493539-1493561 GGGTGGGACAGGACTCTGCCCGG + Intronic
925130938 2:1493611-1493633 GGGTGGGACAGGACTCTGCCGGG + Intronic
927483423 2:23472139-23472161 GGGTGGGAAAAGAACAAGAAAGG + Intronic
927639947 2:24840005-24840027 GTGCGGGAGAAGACCAAGACTGG - Exonic
929225866 2:39511220-39511242 GGGTGTGACATGCCCATGAAAGG - Intergenic
932416358 2:71575880-71575902 GTGTGAGACAAGGCCAAGACAGG - Intronic
933953964 2:87352616-87352638 GGATGGGACCAGAGCAGGACAGG - Intergenic
934238166 2:90248859-90248881 GGATGGGACCAGAGCAGGACAGG - Intergenic
934275032 2:91567874-91567896 GGATGGGACCAGAGCAGGACAGG + Intergenic
934460580 2:94212198-94212220 GGATGGGACCAGAGCAGGACAGG - Intergenic
936041147 2:109150348-109150370 AGGTGGTACAAGACCATGCTAGG + Intronic
940219733 2:151339405-151339427 GGGAGGGACAAAACCAAGAAAGG + Intergenic
941880399 2:170475157-170475179 AGGTGGGACAAGAACATCATGGG - Intronic
943913007 2:193592438-193592460 GGGAGGGAGAGGACCGTGACTGG + Intergenic
947606202 2:231487408-231487430 GTGTGGCACAGGACCATGAGTGG + Intergenic
948856521 2:240732807-240732829 GGGAGGGACGAGACGATGAGGGG + Intronic
1169615426 20:7438179-7438201 GGGTGAGACAAGACAATTGCTGG - Intergenic
1172425224 20:34851405-34851427 GGGTGGGACAAGACCGGGAAAGG + Intronic
1173236195 20:41247844-41247866 GGGTTGGACCAGACTAAGACAGG - Intronic
1176098678 20:63355361-63355383 GGCTGGGCCAAGCCCATGTCAGG - Intronic
1176098939 20:63356286-63356308 GGGTGGGGCAGGGCCAGGACAGG + Intronic
1176591706 21:8655239-8655261 GGATGGGACCAGAGCAGGACAGG - Intergenic
1176866454 21:14057285-14057307 GTCTGGGACAGGACCATGGCAGG + Intergenic
1180274554 22:10632351-10632373 GGATGGGACCAGAGCAGGACAGG - Intergenic
1180549036 22:16527295-16527317 GGATGGGACCAGAGCAGGACAGG - Intergenic
1181354365 22:22289593-22289615 GGGTAGGAGAAGGCCATGATAGG + Intergenic
949239695 3:1855676-1855698 GGGCGGGAGAAGATCATTACAGG + Intergenic
949348238 3:3097397-3097419 GGGTGGCACTAGTCCATCACAGG + Intronic
949928681 3:9061306-9061328 GGATGGGACAAGGCCATGGAGGG - Intronic
952768549 3:36976582-36976604 GGGTGGTCCAAGAGCATGGCGGG + Intergenic
953787344 3:45921191-45921213 GTGAGGGACAAGAGCATGACTGG + Exonic
954316652 3:49805138-49805160 GGGTGTGACATGGGCATGACAGG - Intergenic
954392700 3:50275865-50275887 GGGTGGGACAGGAGCCTGGCGGG - Intronic
955265889 3:57444331-57444353 TGGTGGGACACCACCATGCCTGG + Intronic
956697457 3:71930726-71930748 GGGGAGGACAAGAACATGCCAGG - Intergenic
961457541 3:127031585-127031607 GGGATGGACAAGACCAAGTCGGG - Intronic
962113458 3:132474931-132474953 GGTTTGGTCAAGACCATGCCAGG + Exonic
962369863 3:134812258-134812280 GGGAGGCACATGACCATGAAGGG - Intronic
963454801 3:145531924-145531946 GGGTGGTACAAGATTATAACTGG + Intergenic
967450361 3:189616277-189616299 AAGTGGGACAATTCCATGACTGG - Intergenic
968425993 4:523673-523695 GTGTGGAACAAGGGCATGACGGG + Exonic
968812772 4:2807614-2807636 GGATGGGGCAAGTGCATGACAGG + Intronic
969474367 4:7412818-7412840 GGGTGGGGCAAGACCCAGCCTGG - Intronic
970465759 4:16321455-16321477 GGGAGAGACAAGGCCAGGACCGG - Intergenic
970488372 4:16546880-16546902 GAGTGGGGCAAGACCAACACTGG - Intronic
983611468 4:169649982-169650004 GGCTGGGACGTGACCATTACTGG + Intronic
986207979 5:5644146-5644168 GCATGGGACAAGCACATGACAGG + Intergenic
986728563 5:10618216-10618238 GGGCTGGACAAGGCAATGACAGG - Intronic
989031251 5:37120467-37120489 GGGTGGGACAGGAGGATCACTGG + Intronic
994852398 5:105072440-105072462 GGGAGGGATAAGAGGATGACAGG - Intergenic
996443048 5:123512728-123512750 GGGTGGGCGAGGACCATGGCGGG + Intronic
997463743 5:134072759-134072781 GGGTTGGAGGAGACCATCACTGG - Intergenic
1002919187 6:1554297-1554319 GGGTCGGAAACCACCATGACAGG - Intergenic
1005162157 6:22876446-22876468 GGGTGGGGCAAGACCCTTTCTGG - Intergenic
1005714493 6:28534081-28534103 CGGTGGGACCAGCGCATGACAGG - Exonic
1007257471 6:40538970-40538992 GGGTGTGAAAAGACCAGAACAGG - Intronic
1007952380 6:45883975-45883997 GGTTGGGACCAGACCATGAAGGG + Intergenic
1009031171 6:58059915-58059937 GGGCTGGAAAAGACAATGACAGG + Intergenic
1011535234 6:88369640-88369662 GGGTGAGACAAGGCCATGGCAGG + Intergenic
1012013388 6:93822613-93822635 GGGAGGGACAAGATCATGTAAGG - Intergenic
1017571254 6:155747600-155747622 GGGTGAGAAAAGAGAATGACTGG - Intergenic
1017898689 6:158702691-158702713 GGTGGGGACAAGACCAAAACGGG - Intronic
1018751261 6:166808155-166808177 GGCTGGGACAGGTCCATCACAGG + Intronic
1018981148 6:168602758-168602780 TGGTGGGGCAAGACCAGGGCTGG + Intronic
1021436784 7:20627144-20627166 GAGTGGGTGAAGACCATGTCTGG - Intronic
1022379625 7:29847676-29847698 GTGTGGGACAAGACCCTCTCTGG + Intronic
1023733164 7:43211016-43211038 AGGAGGGACAATACAATGACCGG - Intronic
1028452951 7:91005978-91006000 GGGTGGGACCAGGACAAGACTGG - Intronic
1035633396 8:1126041-1126063 ATGTGGGAGAAGACCATGGCAGG - Intergenic
1036263149 8:7256075-7256097 GTGTGGGAGAAGACCAAGATGGG + Intergenic
1036264452 8:7263697-7263719 GTGTGGGAGAAGACCAAGATGGG + Intergenic
1036265751 8:7271319-7271341 GTGTGGGAGAAGACCAAGATGGG + Intergenic
1036267053 8:7278941-7278963 GTGTGGGAGAAGACCAAGATGGG + Intergenic
1036268355 8:7286563-7286585 GTGTGGGAGAAGACCAAGATGGG + Intergenic
1036269660 8:7294185-7294207 GTGTGGGAGAAGACCAAGATGGG + Intergenic
1036298230 8:7552869-7552891 GTGTGGGAGAAGACCAAGATGGG - Intergenic
1036299535 8:7560519-7560541 GTGTGGGAGAAGACCAAGATGGG - Intergenic
1036300840 8:7568168-7568190 GTGTGGGAGAAGACCAAGATGGG - Intergenic
1036302146 8:7575813-7575835 GTGTGGGAGAAGACCAAGATGGG - Intergenic
1036303441 8:7583460-7583482 GTGTGGGAGAAGACCAAGATGGG - Intergenic
1036315194 8:7714614-7714636 GTGTGGGAGAAGACCAAGATGGG + Intergenic
1036316496 8:7722262-7722284 GTGTGGGAGAAGACCAAGATGGG + Intergenic
1036317803 8:7729910-7729932 GTGTGGGAGAAGACCAAGATGGG + Intergenic
1036319112 8:7737558-7737580 GTGTGGGAGAAGACCAAGATGGG + Intergenic
1036320419 8:7745205-7745227 GTGTGGGAGAAGACCAAGATGGG + Intergenic
1036321729 8:7752853-7752875 GTGTGGGAGAAGACCAAGATGGG + Intergenic
1036323038 8:7760501-7760523 GTGTGGGAGAAGACCAAGATGGG + Intergenic
1036324340 8:7768148-7768170 GTGTGGGAGAAGACCAAGATGGG + Intergenic
1036351694 8:8016158-8016180 GTGTGGGAGAAGACCAAGATGGG - Intergenic
1036353002 8:8023805-8023827 GTGTGGGAGAAGACCAAGATGGG - Intergenic
1036354294 8:8031452-8031474 GTGTGGGAGAAGACCAAGATGGG - Intergenic
1036846939 8:12176579-12176601 GTGTGGGAGAAGACCAAGATGGG - Intergenic
1036868305 8:12418898-12418920 GTGTGGGAGAAGACCAAGATGGG - Intergenic
1037590035 8:20304263-20304285 GGATGCGACAAGAGCAAGACAGG - Intergenic
1038021493 8:23555001-23555023 GGGTGGGGCTAGACCATGCAAGG - Intronic
1048301478 8:133254549-133254571 AGGTGGGACACCACCATGTCCGG + Exonic
1049046870 8:140159314-140159336 GTGTGGGATAAATCCATGACTGG - Intronic
1049576613 8:143392671-143392693 GGGAGGGACAATACCAGGGCTGG + Intergenic
1053691079 9:40587895-40587917 GGATGGGACCAGAGCAGGACAGG - Intergenic
1054273726 9:63049596-63049618 GGATGGGACCAGAGCAGGACAGG + Intergenic
1054302338 9:63388866-63388888 GGATGGGACCAGAGCAGGACAGG - Intergenic
1054401114 9:64715372-64715394 GGATGGGACCAGAGCAGGACAGG - Intergenic
1054434719 9:65199686-65199708 GGATGGGACCAGAGCAGGACAGG - Intergenic
1054495670 9:65821995-65822017 GGATGGGACCAGAGCAGGACAGG + Intergenic
1057212248 9:93206558-93206580 GGATGGGACAACACCATGGAGGG + Intronic
1057667373 9:97056375-97056397 GGGAGAGATAAGACCATGAAGGG + Intergenic
1061894335 9:133639365-133639387 GGGTGGGACATGAACAGGAAAGG - Intronic
1061997075 9:134191698-134191720 GGGTGGGAAAATACCATGCTGGG + Intergenic
1203621733 Un_KI270749v1:134003-134025 GGATGGGACCAGAGCAGGACAGG - Intergenic
1187110008 X:16288295-16288317 TGATGGGACAATACCATGTCAGG - Intergenic
1192162578 X:68799550-68799572 GGGTGGGTCCAGCCCATGAGAGG - Intergenic
1192360052 X:70433782-70433804 GGATGGGACACGACCTTGAGGGG + Intergenic
1199746063 X:150772510-150772532 GGTTGGGACCAAACCATGAAGGG + Intronic
1201189773 Y:11436561-11436583 GGATGGGACCAGAGCAGGACAGG - Intergenic
1202583859 Y:26405377-26405399 GGATGGGACCAGAGCAGGACGGG + Intergenic