ID: 1092766537

View in Genome Browser
Species Human (GRCh38)
Location 12:11858073-11858095
Sequence ACTCTTGCTGCCACTCTCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 224}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092766537_1092766538 19 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 1092766537 12:11858073-11858095 CCTCTGAGAGTGGCAGCAAGAGT 0: 1
1: 0
2: 2
3: 22
4: 224
Right 1092766538 12:11858115-11858137 ATCATAAAAAGCTCAGTTTAAGG 0: 1
1: 0
2: 2
3: 21
4: 267

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092766537 Original CRISPR ACTCTTGCTGCCACTCTCAG AGG (reversed) Intronic
900140589 1:1137923-1137945 ACTCCTGCTGGCAGGCTCAGGGG - Intergenic
900877774 1:5357830-5357852 CCTCTCCCTGCAACTCTCAGAGG + Intergenic
901196128 1:7440749-7440771 CCTCTTGCTCCCACTCTCCGTGG + Intronic
901924641 1:12558287-12558309 ACTCTTGCTGGCACTCTTCCCGG + Intergenic
903125389 1:21244205-21244227 CCTCTTCCAGCCACTCTCTGGGG + Intronic
903573055 1:24320532-24320554 CCTTTTCCTGCCACCCTCAGAGG + Intronic
905887461 1:41499094-41499116 ACACACGCTTCCACTCTCAGGGG - Intergenic
906003571 1:42448367-42448389 TCTCTTGGTGCCACTGTCAAGGG + Intronic
907266309 1:53263656-53263678 AATCTTGCTGGCTCTCTCACAGG + Intronic
907403954 1:54242210-54242232 TCTCTTTCTCCCTCTCTCAGGGG - Exonic
907627026 1:56040398-56040420 ACCCATGCTGCAACTCTCACAGG + Intergenic
908170810 1:61502827-61502849 ATTATTGCTGCCACTTTCTGAGG + Intergenic
909068202 1:70961738-70961760 ATTCTTGCTGGCACTTGCAGAGG + Intronic
912196767 1:107406772-107406794 ACTCTTGCAGCAACCCTAAGAGG + Intronic
912645619 1:111389175-111389197 ACTCAGGCTGCCACTCCCATAGG + Intergenic
913580001 1:120216860-120216882 AATATTGCTGCCACGTTCAGTGG - Intergenic
913628173 1:120681532-120681554 AATATTGCTGCCACGTTCAGTGG + Intergenic
914246024 1:145886186-145886208 CCTCTGGCTGCCGCTCTCCGAGG - Intergenic
914561931 1:148828292-148828314 AATATTGCTGCCACGTTCAGTGG - Intronic
914610899 1:149301921-149301943 AATATTGCTGCCACGTTCAGTGG + Intergenic
914716494 1:150258689-150258711 ACTCTTACTGCCACTTTCAGAGG - Intronic
914990752 1:152497744-152497766 ACAGATGCTGCAACTCTCAGTGG - Intergenic
915223234 1:154391713-154391735 CCTGCTGCTGCCACTGTCAGAGG - Intergenic
922225912 1:223645819-223645841 ACTCTTTGTGCCTCCCTCAGGGG - Intronic
922580693 1:226695699-226695721 ACTCTTGCTGCGGCTGCCAGAGG - Intronic
922796881 1:228344610-228344632 GCTCTTGCCGCAGCTCTCAGGGG + Intronic
924465071 1:244292040-244292062 TCAGTTGCTGCCACCCTCAGAGG - Intergenic
1066064158 10:31750269-31750291 GCACTGGCTCCCACTCTCAGAGG + Intergenic
1067673070 10:48343634-48343656 AATCTGGCTTCCACTCTCTGAGG - Intronic
1068093522 10:52461969-52461991 AGTCTTGCTTCAACTCTCAAAGG - Intergenic
1069740235 10:70682723-70682745 TTTCTGGCTGCCACTCCCAGAGG + Intronic
1071401081 10:85271627-85271649 ACTCTTGATGAGAATCTCAGAGG + Intergenic
1072944111 10:99794516-99794538 AATCTTTCTGACACTTTCAGAGG - Intronic
1075698309 10:124451515-124451537 AACCTTGCTGCCCCTCCCAGAGG + Intergenic
1076802455 10:132836821-132836843 CCTCTTTCTGCACCTCTCAGGGG - Exonic
1079373729 11:19873318-19873340 ACTTTTGCTGGGGCTCTCAGTGG + Intronic
1080967765 11:37233662-37233684 ACTCCTGCAGCCCCACTCAGAGG - Intergenic
1081076799 11:38685286-38685308 CCTATTTCTGCCATTCTCAGTGG - Intergenic
1081525562 11:43925300-43925322 GTTCTTTCTGCCACTCTGAGAGG + Intergenic
1083380450 11:62264044-62264066 ACTCTTGCTGCCTCTCTCATGGG + Intergenic
1085688161 11:78644460-78644482 GTTAATGCTGCCACTCTCAGGGG + Intergenic
1087827322 11:102780515-102780537 TCTTTTGCTGCCCCACTCAGAGG + Exonic
1090155354 11:124431952-124431974 ACTATTGGTTCCACTCTAAGGGG - Intergenic
1090176862 11:124657699-124657721 ATTTTTGCTGACACTCTCTGTGG - Intronic
1092232343 12:6783147-6783169 CCACTTTTTGCCACTCTCAGAGG - Intergenic
1092766537 12:11858073-11858095 ACTCTTGCTGCCACTCTCAGAGG - Intronic
1095893545 12:47258008-47258030 ACTCTTCCTGCAACTATCGGAGG - Intergenic
1096608494 12:52785081-52785103 ACTAATGCTGTGACTCTCAGTGG - Intergenic
1099677647 12:85782841-85782863 ACCCTTGCTACCACTCCCAAGGG - Intergenic
1100290090 12:93205483-93205505 ACTCTTGATGCCACTGTTAAGGG - Intergenic
1105267234 13:18831636-18831658 CCATTTGCTGCAACTCTCAGTGG - Intergenic
1105625744 13:22110931-22110953 GCTCTTGCTGCCCCTCCCACAGG - Intergenic
1106769287 13:32945982-32946004 ATTCTTGCTTGCTCTCTCAGTGG - Intergenic
1107171530 13:37347975-37347997 ACTTTTGCTGTCACTCTCATTGG + Intergenic
1108851790 13:54739072-54739094 ACTCTTCCTCCTACTCTTAGGGG - Intergenic
1113433596 13:110271219-110271241 GCTCTTGCTGCAACGTTCAGTGG - Intronic
1114431487 14:22665459-22665481 TCTCTTGCTCCCATTCTCATGGG - Intergenic
1117412089 14:55459434-55459456 GCTGTTGCTGCCCCTCTCTGAGG - Intergenic
1117460635 14:55941272-55941294 ACTCCTGCTGCCACAGTCTGCGG - Intergenic
1120940385 14:89942569-89942591 AGTCTTGCTACCTCTTTCAGAGG - Intronic
1122109333 14:99485448-99485470 ACTTTTCCTTCCATTCTCAGGGG + Intronic
1122361904 14:101172546-101172568 ACCCTTGCTCCCTCTCTCACCGG - Intergenic
1122871012 14:104639082-104639104 AGGCTTGGTGCCACTTTCAGGGG - Intergenic
1202831532 14_GL000009v2_random:39835-39857 CCATTTGCTGCAACTCTCAGTGG + Intergenic
1124139550 15:27065115-27065137 ACGTTGGCTGCCACTCTCAATGG + Intronic
1125420686 15:39501239-39501261 AGTCTTCCTGCCAGTCACAGGGG + Intergenic
1126351630 15:47750479-47750501 TCTCTTGCTGCCAGTGTCGGTGG + Intronic
1128783056 15:70375556-70375578 ACTTTTGCTGACAATTTCAGGGG - Intergenic
1129166115 15:73778952-73778974 AATCTTGCTGCCTACCTCAGAGG + Intergenic
1129300046 15:74620221-74620243 ACTCTGGCTACCACTCACCGAGG - Exonic
1129460128 15:75696341-75696363 ACTCTTCCTGCCCCTCCCACGGG - Intronic
1129712706 15:77828722-77828744 TCTCTTTCTGCCACTGTCACAGG - Intergenic
1131979108 15:97978647-97978669 AGTAATGCTGCCACTCTCAGAGG - Intergenic
1132389149 15:101426153-101426175 CCTCTTGCTGAGACTCTCAGTGG - Intronic
1132508947 16:327225-327247 ACACTTGGTGTCACCCTCAGGGG + Intronic
1132951259 16:2563666-2563688 CCTCTGTCTCCCACTCTCAGTGG + Intronic
1132963091 16:2636504-2636526 CCTCTGTCTCCCACTCTCAGTGG - Intergenic
1134603829 16:15554337-15554359 ACTCTTGCAGCAACTCTATGAGG - Intronic
1135226954 16:20669053-20669075 ACCCTTGCTTTCCCTCTCAGAGG - Intronic
1138628564 16:58274185-58274207 AGGCTTGCTCCAACTCTCAGAGG + Intronic
1138685697 16:58723672-58723694 ACTATTCCTGCCACTCTCCAGGG + Intronic
1143220186 17:5255086-5255108 GCTCTTCCTGCTGCTCTCAGGGG + Intergenic
1144269805 17:13604707-13604729 AAGCTTGCTGCCACTCTCAAGGG - Intergenic
1146285646 17:31572603-31572625 GCTCCTCCAGCCACTCTCAGGGG + Intronic
1146752121 17:35391226-35391248 ACTCTTGGTGTCACTTCCAGAGG + Intergenic
1147472553 17:40676506-40676528 ACTCTTGCTTCCTCTGTCATCGG - Intergenic
1147656735 17:42095423-42095445 CCTCTGGCTGCCCTTCTCAGAGG - Intergenic
1147657078 17:42097140-42097162 ACCCTTGCAGCCACTCTATGAGG + Intergenic
1147721006 17:42539328-42539350 ACCCCTGCTGCCACTCCCAAGGG - Intronic
1148137030 17:45300104-45300126 AGTCTTGCTGCCAATCCCACAGG + Intronic
1148371065 17:47100197-47100219 ACTCGTGCTCCCACCCCCAGGGG + Intergenic
1149369092 17:55975420-55975442 CCTCTTGCTGCCAAACTCAATGG - Intergenic
1149547878 17:57517854-57517876 TCTCTTTCTGCCACTCTGATGGG - Intronic
1150318898 17:64193267-64193289 TCTGTTGCTGCTTCTCTCAGGGG + Intronic
1150703367 17:67466734-67466756 ACTCCTCCTGCGACTCCCAGAGG - Intronic
1151179508 17:72316810-72316832 AATCTGGCTGCCACACTCAGAGG + Intergenic
1151741262 17:75983812-75983834 ACTCCTGCGGCCCCCCTCAGAGG - Intronic
1152047999 17:77951220-77951242 ACTCTTGCTCCAACCATCAGTGG + Intergenic
1152231599 17:79116777-79116799 GCTCCTGCAGCCACTCTCAGAGG + Intronic
1154421177 18:14229787-14229809 CCATTTGCTGCAACTCTCAGTGG + Intergenic
1155297383 18:24397752-24397774 ACTCTGGCTGGCACTCCCCGAGG + Exonic
1156282355 18:35652350-35652372 ACTTTTCATGCCTCTCTCAGAGG + Intronic
1156318377 18:35993775-35993797 ACTCTCCCTGCAACTCCCAGTGG + Intronic
1157743949 18:50118332-50118354 CCTCTTTCTGCAACTCTCATTGG - Intronic
1158667986 18:59449954-59449976 ACTCCTGCTGCCACACAGAGGGG - Intronic
1159006850 18:63020864-63020886 TCTCTTCCTGTCACTCTCAAAGG - Intergenic
1159218477 18:65428427-65428449 ACTCTGGCTGCCACTCTGGAGGG + Intergenic
1161644693 19:5445821-5445843 ACTGTTACTGCCACTCCCAGAGG - Intergenic
1162231008 19:9266258-9266280 TCTCTTCCTGGGACTCTCAGAGG - Intergenic
1163322877 19:16584978-16585000 GCCCTTGCTGCCCCACTCAGGGG - Intronic
1163515464 19:17760490-17760512 ACTTTTTCTGCCACTCTCAATGG - Intronic
1167018629 19:46858427-46858449 ACTGTTGCGGCCAGGCTCAGTGG + Intergenic
1202641169 1_KI270706v1_random:87910-87932 CCATTTGCTGCAACTCTCAGTGG - Intergenic
925720793 2:6824782-6824804 ACTCTTTCCGCCATTCTCTGTGG - Intergenic
926143958 2:10385484-10385506 ACACTTGCTGCTTCTCTCGGAGG + Intronic
927390295 2:22587518-22587540 GCCCTTGCTGCAGCTCTCAGGGG - Intergenic
929818847 2:45257607-45257629 ACTCTTGCTGCAGCTGACAGAGG - Intergenic
931202583 2:60113295-60113317 ACTCATGCTGCCAAGGTCAGAGG + Intergenic
931516197 2:63051856-63051878 ACCCGGGGTGCCACTCTCAGGGG - Intronic
931922875 2:67039689-67039711 ACTTTTACTGATACTCTCAGAGG - Intergenic
934122189 2:88850814-88850836 ACTATTGCTGCCATTGTGAGGGG + Intergenic
934496970 2:94811324-94811346 CCATTTGCTGCAACTCTCAGTGG - Intergenic
936003220 2:108856229-108856251 AATCTTGCTGCCATTCTTAATGG + Intronic
942591966 2:177555840-177555862 ACTCCAGCTGCCACGCTCACAGG - Intergenic
943672236 2:190675383-190675405 AGTCTTTCTGACCCTCTCAGAGG + Intronic
944028346 2:195199991-195200013 AATATTGCTGTCACTTTCAGTGG + Intergenic
946374468 2:219299763-219299785 ACTCCTGCAGCCAGGCTCAGGGG + Exonic
946458927 2:219851905-219851927 CCTGGTGCTGTCACTCTCAGTGG + Intergenic
947794281 2:232884510-232884532 ACACTAGCTGCCACACTCACAGG - Intronic
947810775 2:233002814-233002836 GCTGTTGCTGCCACTCACAGTGG - Intronic
948427731 2:237898446-237898468 ACGCGTGCTGCCAGTCCCAGGGG + Intronic
1168865706 20:1084615-1084637 ACTGATGATGCCTCTCTCAGAGG - Intergenic
1169814176 20:9639767-9639789 AATCTTGCTCCAACTCTCAGTGG + Intronic
1169872512 20:10262960-10262982 GTACTTGCTGCCACTCCCAGTGG + Intronic
1171888275 20:30678121-30678143 CCATTTGCTGCAACTCTCAGTGG - Intergenic
1172095020 20:32456364-32456386 ATTGCCGCTGCCACTCTCAGAGG + Exonic
1172960252 20:38794135-38794157 ATTCTTGCTGCCAGGCACAGTGG + Intergenic
1175713720 20:61241431-61241453 ATTCTTGCTCCCACTCTCTGAGG - Intergenic
1175778854 20:61669463-61669485 ACTCCTGCTGAAACCCTCAGAGG - Intronic
1176610720 21:8884666-8884688 CCATTTGCTGCAACTCTCAGTGG + Intergenic
1176852298 21:13930173-13930195 CCATTTGCTGCAACTCTCAGTGG - Intergenic
1177593885 21:23210577-23210599 AATCCAGCTTCCACTCTCAGGGG - Intergenic
1178202819 21:30427051-30427073 ACTCTCCCAGCCTCTCTCAGGGG + Intergenic
1178423143 21:32458000-32458022 ACTGATGCTACAACTCTCAGGGG + Intronic
1178639140 21:34332111-34332133 ACTCTGGAGGGCACTCTCAGAGG - Intergenic
1180360793 22:11893964-11893986 CCATTTGCTGCAACTCTCAGTGG + Intergenic
1181909122 22:26224224-26224246 ACTCATGCTGGCTCTCTCAGAGG + Intronic
1183592653 22:38789383-38789405 GCTCATGCTACCACACTCAGTGG + Intronic
949117443 3:344631-344653 AGACTCACTGCCACTCTCAGTGG - Exonic
950012740 3:9734526-9734548 CTTGTTGCTGCCATTCTCAGGGG - Exonic
950591394 3:13938081-13938103 TCTCTTGGTGACACTCTCAGAGG - Intronic
952624353 3:35386214-35386236 CCTCTCTCTGCCACTCTCAAAGG + Intergenic
952635301 3:35522153-35522175 ACTGTTGGTGCCCCTCCCAGAGG - Intergenic
953199763 3:40768337-40768359 ACTCCTGCTGTGCCTCTCAGGGG - Intergenic
953549714 3:43892278-43892300 ACTCTTGCTGCAACGCTGAGTGG + Intergenic
953926388 3:46984796-46984818 CCTCTTACTGTCACTCACAGAGG + Intronic
953928184 3:46992926-46992948 ATTCTTGCACCCACCCTCAGCGG + Intronic
955170059 3:56555100-56555122 GCTCTTGTTCCCAATCTCAGTGG + Intergenic
955963298 3:64363106-64363128 CCTCTTGCTCCCAGTCTCTGTGG + Intronic
960358306 3:116679727-116679749 ACTCAAGCTGCCACTCCGAGGGG + Intronic
961066714 3:123882761-123882783 CCTTTTTCTCCCACTCTCAGTGG - Intronic
961487209 3:127225034-127225056 AATCTTGCAGCCACACTCACAGG + Intergenic
964666584 3:159181348-159181370 ACTTTTGCTGGCATTCTCACTGG + Intronic
967021612 3:185527790-185527812 AGTCTGGATGCCATTCTCAGGGG - Intronic
967342278 3:188412458-188412480 ATTCTTACTGTCACTCTCTGAGG + Intronic
967915370 3:194574410-194574432 AGTCTGGCTTCCACTCCCAGAGG - Intergenic
1202737402 3_GL000221v1_random:19452-19474 CCATTTGCTGCAACTCTCAGTGG + Intergenic
970317350 4:14842045-14842067 ACTCAGGCTGCCACTCCCAGGGG - Intergenic
972155816 4:36160214-36160236 ACTCTTGTTGCCACAATCTGAGG - Intronic
973384680 4:49498436-49498458 CCATTTGCTGCAACTCTCAGTGG - Intergenic
973559838 4:52124059-52124081 ACTCTTGCTGAAATTCTCAGAGG - Intergenic
973590960 4:52441139-52441161 ACACTGGCTTCCACTATCAGAGG - Intergenic
977922936 4:102665728-102665750 ACTCACTCTGCCATTCTCAGAGG - Intronic
978907542 4:114025560-114025582 ACTATTGATCCAACTCTCAGAGG - Intergenic
979881432 4:125964122-125964144 GCTCTTGCAGCTACTCTCATGGG - Intergenic
982933958 4:161447084-161447106 GCTCTTGCTTCTTCTCTCAGAGG - Intronic
1202768531 4_GL000008v2_random:173770-173792 CCATTTGCTGCAACTCTCAGTGG - Intergenic
987343157 5:16956170-16956192 TCTCCTGCGGCCTCTCTCAGGGG - Intergenic
989286672 5:39707755-39707777 ACTTAAGCTGCCTCTCTCAGTGG + Intergenic
989953393 5:50328407-50328429 ACTCTTCCTTCATCTCTCAGAGG + Intergenic
990338850 5:54802393-54802415 ACTCTTGCTGCCCCTCTGGATGG + Intergenic
991894220 5:71375573-71375595 TCTCTAGCTGCCTATCTCAGAGG - Intergenic
994362016 5:98862269-98862291 ATTCCTGCTGCCACTCTCTCTGG - Intronic
995414150 5:111890330-111890352 GCCCTTGCAGCTACTCTCAGAGG + Intronic
995886962 5:116905985-116906007 ACTCTTCCTTTCACTCTAAGTGG - Intergenic
996868354 5:128156144-128156166 ACTGTTCCTGCCACTTCCAGAGG + Intronic
998421786 5:141994214-141994236 ACTTTGGCTGCCACTCTGAGAGG + Intronic
998618604 5:143769824-143769846 ACTTTAGCTGGCATTCTCAGGGG + Intergenic
999310180 5:150546768-150546790 TCTCCTCCTGCCACTCTCTGAGG + Intronic
1001525642 5:172426701-172426723 ACTTTTGATGGCAGTCTCAGGGG + Intronic
1003097927 6:3156905-3156927 AGTCTTGCTGCCAGTCCCCGAGG - Intronic
1003184894 6:3822062-3822084 ACTCTCTGTGCCACTCTCATAGG - Intergenic
1004257959 6:14082401-14082423 ATTCCTGCTGCCACTGTCAAAGG - Intergenic
1004893637 6:20125525-20125547 AGTCTTTCTGCCACTCTCCAAGG - Intronic
1006212941 6:32412745-32412767 TCCTTTGCTGCCACTCTGAGAGG - Intergenic
1006378039 6:33682679-33682701 ACTCCTCCTGCCGCTCACAGTGG + Intronic
1006402890 6:33828071-33828093 ACTTTGGCTTCCACTCTGAGTGG - Intergenic
1006697444 6:35943230-35943252 ACTTTTGCTGTCATTCTCAGAGG - Intergenic
1006902650 6:37513033-37513055 TCTCATGCAGCTACTCTCAGAGG + Intergenic
1007411754 6:41667335-41667357 AATCTTGCTACCACTTCCAGGGG - Intergenic
1009647880 6:66430659-66430681 AATCTTGGTCCCACTCTCAGAGG - Intergenic
1009971258 6:70627879-70627901 CCTCTCGCTGGCGCTCTCAGCGG + Intergenic
1011372369 6:86650884-86650906 ACTCTTACTTCCTCTCCCAGAGG + Intergenic
1012816222 6:104025941-104025963 AAACTTGCTACCACTCCCAGGGG + Intergenic
1013473485 6:110486812-110486834 AGTCTTGCAGCCATTCTCATAGG + Intergenic
1017602812 6:156102012-156102034 TCTCTTGCTGGGACTCCCAGGGG + Intergenic
1021176130 7:17451591-17451613 ACTCTTGATACCATTCTGAGAGG - Intergenic
1021561265 7:21971113-21971135 GCTGTGGCTGCTACTCTCAGTGG - Intergenic
1023016276 7:35971326-35971348 ACTCTTCCTGGCAGTCGCAGAGG + Intergenic
1027267323 7:76501550-76501572 GGTCTGGCTGCCACACTCAGGGG - Intronic
1027319136 7:77001415-77001437 GGTCTGGCTGCCACACTCAGGGG - Intergenic
1028955911 7:96690095-96690117 ACTCTTGCTGCCAATCTTGAGGG + Intronic
1031153162 7:118077722-118077744 AGACTTGCTGCCACTCAAAGAGG - Intergenic
1031358622 7:120820052-120820074 ACACTTGCTGCCACCATCAGGGG - Intronic
1032546601 7:132748999-132749021 ACTCTGGCTGCCACCTGCAGAGG - Intergenic
1033398530 7:140999463-140999485 ACTATTGCTGGCTCTCTCATAGG - Intergenic
1037666052 8:20971207-20971229 ACACTTGCTGCCAGTCCCACAGG + Intergenic
1037753328 8:21696503-21696525 GCTGTGGGTGCCACTCTCAGGGG + Intronic
1038425155 8:27460047-27460069 TCTCTCCCTGACACTCTCAGGGG - Exonic
1038645450 8:29357979-29358001 ACTCTTGGTGTCTCCCTCAGTGG - Intergenic
1039276775 8:35941294-35941316 AATCTACCTCCCACTCTCAGAGG - Intergenic
1042330038 8:67569036-67569058 ACTCTTCCTGCCAGGCACAGTGG - Intronic
1043145455 8:76648232-76648254 GCCCTTGCAGCCACTCTCATGGG - Intergenic
1044555044 8:93553844-93553866 ACTGTTGCTGCAACTGTCTGTGG + Intergenic
1046124546 8:109888025-109888047 ACTACTGCTGCCATTATCAGAGG - Intergenic
1046355295 8:113076304-113076326 TCTTTTGCTGCCACTGTCAAGGG + Intronic
1048001030 8:130379847-130379869 CCTCTAGCTGCCACACCCAGAGG - Intronic
1048547250 8:135398617-135398639 CTTCTTTCTCCCACTCTCAGCGG + Intergenic
1049156182 8:141068052-141068074 ACACTTGCAGCCACCCTCTGAGG + Intergenic
1049671444 8:143871843-143871865 TGCCTTCCTGCCACTCTCAGGGG - Exonic
1051184750 9:14448464-14448486 AATATTACTGCCACTCTCATGGG - Intergenic
1052875011 9:33552640-33552662 CCATTTGCTGCCACTTTCAGTGG + Intronic
1053501008 9:38591686-38591708 CCATTTGCTGCCACTTTCAGTGG - Intergenic
1054361166 9:64121831-64121853 CCATTTGCTGCAACTCTCAGTGG + Intergenic
1059473577 9:114525750-114525772 GCTCTTACTGCCAGTCTCAGAGG - Intergenic
1060735116 9:126061789-126061811 CCAGTGGCTGCCACTCTCAGAGG - Intergenic
1062017393 9:134297673-134297695 CTTCTTGCTGCCCCTCTGAGGGG - Intergenic
1203693427 Un_GL000214v1:67626-67648 CCATTTGCTGCAACTCTCAGTGG - Intergenic
1203706126 Un_KI270742v1:49902-49924 CCATTTGCTGCAACTCTCAGTGG + Intergenic
1203557877 Un_KI270744v1:15993-16015 CCATTTGCTGCAACTCTCAGTGG - Intergenic
1203642846 Un_KI270751v1:36437-36459 CCATTTGCTGCAACTCTCAGTGG + Intergenic
1186938296 X:14475108-14475130 CCTCTTTCTACCACTCACAGAGG + Intergenic
1187741181 X:22357406-22357428 ATTCTTGTTCCCACTCTCAAAGG + Intergenic
1189454382 X:41171913-41171935 ACTCTTGCTCCATCTCTAAGGGG - Exonic
1192363380 X:70452810-70452832 TTTCTTGCTCCCAGTCTCAGGGG - Intronic
1195066818 X:101244854-101244876 ACTCTTTGTCCCACCCTCAGAGG + Intronic
1197695198 X:129541848-129541870 ACTATTGGTGCCACTCTAACTGG + Intronic
1199635316 X:149807462-149807484 TCTCTTGCTGTCTCTCCCAGTGG + Intergenic
1201327507 Y:12779601-12779623 ACTCTTGCTCCATCTCTAAGAGG - Exonic