ID: 1092770578

View in Genome Browser
Species Human (GRCh38)
Location 12:11892807-11892829
Sequence GTCCTTGTCAGTAAGGCCGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 70}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092770578_1092770588 23 Left 1092770578 12:11892807-11892829 CCCTCGGCCTTACTGACAAGGAC 0: 1
1: 0
2: 1
3: 3
4: 70
Right 1092770588 12:11892853-11892875 GGACTATGGTTCAAGGACACTGG 0: 1
1: 0
2: 0
3: 2
4: 100
1092770578_1092770587 16 Left 1092770578 12:11892807-11892829 CCCTCGGCCTTACTGACAAGGAC 0: 1
1: 0
2: 1
3: 3
4: 70
Right 1092770587 12:11892846-11892868 AACAGATGGACTATGGTTCAAGG 0: 1
1: 0
2: 1
3: 9
4: 111
1092770578_1092770584 2 Left 1092770578 12:11892807-11892829 CCCTCGGCCTTACTGACAAGGAC 0: 1
1: 0
2: 1
3: 3
4: 70
Right 1092770584 12:11892832-11892854 CAACCTAGGGTGCAAACAGATGG 0: 1
1: 0
2: 0
3: 9
4: 89
1092770578_1092770586 9 Left 1092770578 12:11892807-11892829 CCCTCGGCCTTACTGACAAGGAC 0: 1
1: 0
2: 1
3: 3
4: 70
Right 1092770586 12:11892839-11892861 GGGTGCAAACAGATGGACTATGG 0: 1
1: 0
2: 0
3: 7
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092770578 Original CRISPR GTCCTTGTCAGTAAGGCCGA GGG (reversed) Exonic
915311422 1:155007625-155007647 GGCCTTATCTGTAAGGCCTAGGG + Intronic
923097499 1:230787282-230787304 CTCCTCGTCTGTAAGGCAGAAGG + Intronic
1069605121 10:69733919-69733941 GGCCTTCTCAGGAAGGCTGAGGG + Intergenic
1080744967 11:35100627-35100649 GTCCTGGTCAGCAAGGCAGCAGG + Intergenic
1081985209 11:47297176-47297198 GTCCTTATCTTTAAGGCCTATGG + Intronic
1083647658 11:64182110-64182132 GTCCTTGTCTGTAAGGTAGGGGG - Intergenic
1083956157 11:65983981-65984003 TTCCTTTGCAGTAGGGCCGAGGG + Intergenic
1084355323 11:68634600-68634622 GTACTTGCCACTAAGGGCGAAGG - Intergenic
1084813098 11:71627614-71627636 ATCCTTGTCACTCAGGCCGATGG + Intergenic
1089286060 11:117408939-117408961 GTCCATGTCACTGAGGTCGAAGG - Exonic
1090364413 11:126193548-126193570 GTCCATGTCAGACAGGCCGTGGG + Intergenic
1092770578 12:11892807-11892829 GTCCTTGTCAGTAAGGCCGAGGG - Exonic
1092900430 12:13054717-13054739 GTCATTGGCAGTGAGGCCAAGGG + Intronic
1108726752 13:53191495-53191517 GTCCTAGTTAGCAAGGCCCAAGG - Intergenic
1109722596 13:66294736-66294758 GTCTTTTTCTGTAAGGCTGATGG + Intergenic
1113407563 13:110055848-110055870 GTCTTTAACAGTAAGGCCTATGG + Intergenic
1123494455 15:20811820-20811842 GTCATTGTCAGTAACACTGATGG + Intergenic
1123550950 15:21380912-21380934 GTCATTGTCAGTAACACTGATGG + Intergenic
1126197666 15:45950177-45950199 GGCCTTGTCATGAATGCCGATGG + Intergenic
1129657155 15:77531865-77531887 CTCCCTGTCAGTAAGGACGTGGG + Intergenic
1131392824 15:92062901-92062923 GTCCCTCTCAGTAAGTCAGAAGG + Intronic
1202959293 15_KI270727v1_random:108156-108178 GTCATTGTCAGTAACACTGATGG + Intergenic
1135616782 16:23917586-23917608 GTCCTTGTCACTCAGGCCTGTGG - Intronic
1138599626 16:58046905-58046927 GTCCTTGTTTGTAAGGCCTTGGG + Intergenic
1143499790 17:7331970-7331992 GTCCTTGTCAGCAGGGCGGTAGG - Intergenic
1147562735 17:41518974-41518996 GTGTTTGTCAGGAAGGCAGAAGG - Exonic
1148715894 17:49715606-49715628 GTCCTTGCAAGTAAGGACTATGG - Intronic
1151579120 17:74968280-74968302 GACCTTGCCAGTAAGGCATATGG + Intronic
1153437983 18:5087369-5087391 GACCTTTTCTGTAAGGCGGAAGG + Intergenic
1154360748 18:13658324-13658346 GGCGTTGTCAGTAAGGCACAAGG - Intergenic
1155185075 18:23380381-23380403 CTCCTTGTCAGGCAGGCAGAGGG - Intronic
1157709437 18:49839885-49839907 GTCCTTTTCATTCAGGCCTAGGG + Intronic
1165077634 19:33289657-33289679 GTGCTGGTCAGCAAGGCCCATGG - Intergenic
1168325196 19:55535281-55535303 GTGCTTGGCAGAAAGGCCCAGGG + Intronic
926050218 2:9739882-9739904 GACCTTCTCAGTGATGCCGATGG - Intergenic
931312945 2:61099898-61099920 TTCCCTGTCACTAAGGCCAAAGG - Intronic
935537459 2:104310749-104310771 GGCCTTGTCCGTGAGGCAGAAGG + Intergenic
943061375 2:183044921-183044943 GTGCTTGCCACTAAGGGCGAAGG - Intergenic
947519869 2:230837314-230837336 ATCCTTGTCAGGAAGGCTGTAGG - Intergenic
1170779980 20:19416505-19416527 GTCCTTGTCTGTGAGGGAGAAGG - Intronic
1176444167 21:6803966-6803988 GTCATTGTCAGTAACACTGATGG - Intergenic
1180714846 22:17864837-17864859 GGCCTTGTCACAGAGGCCGAGGG + Intronic
1181345258 22:22215319-22215341 GGCCTGTTCAGTGAGGCCGAGGG - Intergenic
1184570592 22:45321831-45321853 GTGGATTTCAGTAAGGCCGAGGG + Intronic
958074431 3:88657799-88657821 CTCCTTATGAGTAAGGCAGAGGG - Intergenic
967923466 3:194629673-194629695 GGCCCTGTCAGTGACGCCGATGG - Intronic
968762288 4:2448977-2448999 GTCGTGGTCAGTGAGGCTGAGGG + Intronic
968821969 4:2861047-2861069 GTCCTTATCAGTTAGGCTGCAGG - Intronic
969794966 4:9520475-9520497 ATCCTCGTCACTCAGGCCGATGG + Intergenic
978159212 4:105526534-105526556 GTCCTTGTTAGCATGGCCCAGGG + Intergenic
980628489 4:135406253-135406275 CTGCTTGTCAGTCAGGCCAAGGG - Intergenic
983717698 4:170805399-170805421 GTGCTTGGCAATAAGGCAGAGGG + Intergenic
992176418 5:74153773-74153795 GTCCTGGTGGATAAGGCCGAAGG + Intergenic
995793355 5:115917106-115917128 GTCTTTCTCAGTAAGTCCCATGG + Intergenic
1000117419 5:158166575-158166597 GTCTGTTTCAGTAGGGCCGAGGG + Intergenic
1002061997 5:176630568-176630590 CCCCCTGTCAGTCAGGCCGAAGG - Intergenic
1010209976 6:73354687-73354709 GTCCTGCTCCTTAAGGCCGAGGG - Intergenic
1013398493 6:109768183-109768205 GTCCTGGCCAGTAAGGCCCCTGG + Intronic
1018439429 6:163795873-163795895 GACCTTGTCACTAAAGCCAATGG - Intergenic
1020525206 7:9250882-9250904 GTCCATGTCACTGAGGCCTAGGG + Intergenic
1032451909 7:132038837-132038859 TGCCTGGTCAGTAAGGCAGAAGG - Intergenic
1036728228 8:11239377-11239399 GGCCTTGTCAGTAAGACTGGTGG - Intergenic
1037520146 8:19673136-19673158 GTCCTTCTCAGAAAGGACAATGG - Intronic
1040104837 8:43535723-43535745 GGCCTTGTCAGTAAGGTCCTGGG + Intergenic
1041571363 8:59340620-59340642 GAGCTTGTCAGCAAGGCCCAGGG - Intergenic
1049123913 8:140768252-140768274 GTCTTGGTCAGTAAGGCCCATGG - Intronic
1050742905 9:8842880-8842902 GTCTTTGTTAGGATGGCCGACGG - Intronic
1051342061 9:16120922-16120944 GCCCTGGCCAGTAAGGCCGAGGG + Intergenic
1054741428 9:68809915-68809937 GTCCTTGTCATTATGGCCCCGGG + Intronic
1055069959 9:72156014-72156036 GTTATTGTCAGTAATGCAGATGG + Intronic
1058003921 9:99895579-99895601 GTCCTTCTCTTTAAGGCAGAGGG - Intergenic
1203525032 Un_GL000213v1:80561-80583 GTCATTGTCAGTAACACTGATGG + Intergenic
1188368521 X:29340112-29340134 GTTCTTGTCAGTAAGGCAGAAGG - Intronic
1190496038 X:51029361-51029383 GTCCTTGGCAGTAAGTCAGGAGG - Intergenic
1193867396 X:86751924-86751946 GTCCTTTTCAGTAACGTGGATGG + Intronic