ID: 1092770579

View in Genome Browser
Species Human (GRCh38)
Location 12:11892808-11892830
Sequence TGTCCTTGTCAGTAAGGCCG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 117}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092770579_1092770587 15 Left 1092770579 12:11892808-11892830 CCTCGGCCTTACTGACAAGGACA 0: 1
1: 0
2: 0
3: 14
4: 117
Right 1092770587 12:11892846-11892868 AACAGATGGACTATGGTTCAAGG 0: 1
1: 0
2: 1
3: 9
4: 111
1092770579_1092770588 22 Left 1092770579 12:11892808-11892830 CCTCGGCCTTACTGACAAGGACA 0: 1
1: 0
2: 0
3: 14
4: 117
Right 1092770588 12:11892853-11892875 GGACTATGGTTCAAGGACACTGG 0: 1
1: 0
2: 0
3: 2
4: 100
1092770579_1092770584 1 Left 1092770579 12:11892808-11892830 CCTCGGCCTTACTGACAAGGACA 0: 1
1: 0
2: 0
3: 14
4: 117
Right 1092770584 12:11892832-11892854 CAACCTAGGGTGCAAACAGATGG 0: 1
1: 0
2: 0
3: 9
4: 89
1092770579_1092770586 8 Left 1092770579 12:11892808-11892830 CCTCGGCCTTACTGACAAGGACA 0: 1
1: 0
2: 0
3: 14
4: 117
Right 1092770586 12:11892839-11892861 GGGTGCAAACAGATGGACTATGG 0: 1
1: 0
2: 0
3: 7
4: 98
1092770579_1092770589 30 Left 1092770579 12:11892808-11892830 CCTCGGCCTTACTGACAAGGACA 0: 1
1: 0
2: 0
3: 14
4: 117
Right 1092770589 12:11892861-11892883 GTTCAAGGACACTGGAATTGAGG 0: 1
1: 0
2: 2
3: 17
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092770579 Original CRISPR TGTCCTTGTCAGTAAGGCCG AGG (reversed) Exonic
901656956 1:10774832-10774854 TTCCCTTGTCTGTAAGACCGCGG - Intronic
902985082 1:20150048-20150070 TGTCCTTGTCTCCAAGGCTGGGG - Exonic
904029046 1:27522689-27522711 TGTACTTGTCTGTGAGCCCGGGG + Intergenic
910623875 1:89285474-89285496 TGTCTTAGTCACTAAGGCTGTGG - Intergenic
910868015 1:91805569-91805591 TGGCCTTGGCAGTGTGGCCGTGG - Intronic
911199777 1:95032739-95032761 TGTCCCTGTCAGGATGGCCCGGG - Intronic
914939943 1:152013878-152013900 TTTCCTTGTCAGTAAGGTAGGGG + Intergenic
917510161 1:175663113-175663135 GTTCCTTGACAGTAAGGCCCAGG - Intronic
921206847 1:212856968-212856990 TGTCCTTGTCGGTGAGACCCTGG - Intergenic
921817120 1:219576645-219576667 TCTGATTGTCAGTAAGGCCAAGG - Intergenic
922109592 1:222543976-222543998 AGTCCTTGTCAGGAAGGTCCAGG + Exonic
922573982 1:226650398-226650420 CATCCTTGTCAGTAAAGCCTCGG - Intronic
922880548 1:228977295-228977317 TGTCCTTTTCTGAAAGGCTGTGG + Intergenic
924106533 1:240654613-240654635 TGTCCATGTCAGTGGGGCCTGGG - Intergenic
1065130197 10:22612819-22612841 TGTCAATGTCAGGTAGGCCGTGG + Intronic
1065426912 10:25615640-25615662 TGTCCTTGTCTTAAAGGCAGCGG + Intergenic
1066359571 10:34717111-34717133 TGCCCTTGTCATCAAGGCCCAGG - Intronic
1069605120 10:69733918-69733940 TGGCCTTCTCAGGAAGGCTGAGG + Intergenic
1069877967 10:71574696-71574718 TGCCCTTGTCAGGAAAGCCGTGG - Intronic
1083647659 11:64182111-64182133 TGTCCTTGTCTGTAAGGTAGGGG - Intergenic
1088164701 11:106919907-106919929 TGTCCTTGTGAGTAAAGCAGTGG - Intronic
1090364412 11:126193547-126193569 AGTCCATGTCAGACAGGCCGTGG + Intergenic
1092770579 12:11892808-11892830 TGTCCTTGTCAGTAAGGCCGAGG - Exonic
1093907966 12:24714327-24714349 TGTCCCTTTCTTTAAGGCCGTGG + Intergenic
1095957213 12:47813662-47813684 TCTCCTCGTCAGGAAGGCCCTGG - Intronic
1103627952 12:122234921-122234943 TCTCCTTGTCCTTCAGGCCGTGG + Intronic
1105206884 13:18232940-18232962 TGTCCTCGTTAGTGATGCCGTGG - Intergenic
1105207690 13:18236629-18236651 TGTCCTCGTCAGCGATGCCGTGG - Exonic
1112753557 13:102606043-102606065 TGTCCTTGGTAGAAAGGCCTGGG + Intronic
1118224642 14:63887549-63887571 TGGCAATGTCAGTAAGGCCAGGG - Intronic
1118881316 14:69828514-69828536 TATCCTTGGCAGCAAGGCCCAGG - Intergenic
1121300520 14:92866996-92867018 TGTCATCGTCAGGAAGGCAGTGG - Intergenic
1202837745 14_GL000009v2_random:90951-90973 AGGCCTTGTCAGTAAGGTCCTGG + Intergenic
1129657154 15:77531864-77531886 TCTCCCTGTCAGTAAGGACGTGG + Intergenic
1133017215 16:2949607-2949629 GGTCCTTGTTAGTAAGGAGGAGG - Exonic
1138599625 16:58046904-58046926 TGTCCTTGTTTGTAAGGCCTTGG + Intergenic
1141937968 16:87254635-87254657 TGTCCTGGACCGTAAGGCCACGG + Intronic
1149470180 17:56910017-56910039 TGTCCTTGTCTGTAAAGGCTGGG - Intronic
1150320788 17:64212834-64212856 GGTCCTTGACAGTGAGGACGAGG - Exonic
1150619957 17:66800606-66800628 TTTCCTTGGCAGTAAAGCCATGG + Intronic
1152484864 17:80583896-80583918 TGTCCATGTCACTGAGGCAGTGG + Intronic
1152809154 17:82373031-82373053 TGTCCTTTTCAGGAAGTCCCCGG + Intergenic
1154434715 18:14334818-14334840 AGGCCTTGTCAGTAAGGACCTGG + Intergenic
1155185076 18:23380382-23380404 TCTCCTTGTCAGGCAGGCAGAGG - Intronic
1157709436 18:49839884-49839906 TGTCCTTTTCATTCAGGCCTAGG + Intronic
1162034755 19:7932852-7932874 TGACCTTGTCCGTAAGGGCCCGG + Exonic
1163291323 19:16381227-16381249 TTTCCTTGTGTGTAAGGCAGAGG - Intronic
1202634902 1_KI270706v1_random:36387-36409 AGGCCTTGTCAGTAAGGTCCTGG - Intergenic
1202650245 1_KI270706v1_random:173328-173350 GGTCCTTGTCAGTGGGGCCCTGG + Intergenic
1202650317 1_KI270706v1_random:173718-173740 AGGCCTTGTCAGTAAGGTCCTGG + Intergenic
1202650564 1_KI270707v1_random:273-295 GGTCCTTGTCAGTGGGGCCCTGG + Intergenic
1202650636 1_KI270707v1_random:663-685 AGGCCTTGTCAGTAAGGTCCTGG + Intergenic
926741742 2:16116855-16116877 TGTCCTTCTCAGCAAGTCCAAGG + Intergenic
930879961 2:56259445-56259467 TGTCCTACTCAGTATGGCCAGGG - Intronic
931756992 2:65383309-65383331 TTCCCTTGTCTGTGAGGCCGGGG + Intronic
934491354 2:94763668-94763690 AGGCCTTGTCAGTAAGAACGTGG - Intergenic
936878044 2:117215903-117215925 TGTGCTTGTCAGTCAGGTGGAGG - Intergenic
938279259 2:130052815-130052837 AGGCCTTGTCAGTAAGGACCTGG - Intergenic
938279265 2:130052844-130052866 AGGCCTTGTCAGTAAGGACCTGG - Intergenic
938279271 2:130052873-130052895 AGGCCTTGTCAGTAAGGACCTGG - Intergenic
938279288 2:130052960-130052982 GGGCCTTGTCAGTAAGGACCTGG - Intergenic
938279307 2:130053061-130053083 GGGCCTTGTCAGTAAGGACCTGG - Intergenic
938279320 2:130053133-130053155 AGGCCTTGTCAGTAAGGTCCTGG - Intergenic
938279329 2:130053176-130053198 AGGCCTTGTCAGTAAGGACCTGG - Intergenic
938330208 2:130443475-130443497 AGGCCTTGTCAGTAAGGTCCTGG - Intergenic
938330259 2:130443778-130443800 AGGCCTTGTCAGTAAGGACCTGG - Intergenic
938330275 2:130443876-130443898 GGGCCTTGTCAGTAAGGACCTGG - Intergenic
938359670 2:130677627-130677649 GGGCCTTGTCAGTAAGGACCTGG + Intergenic
938359686 2:130677725-130677747 AGGCCTTGTCAGTAAGGACCTGG + Intergenic
938359737 2:130678028-130678050 AGGCCTTGTCAGTAAGGTCCTGG + Intergenic
938436064 2:131284259-131284281 AGGCCTTGTCAGTAAGGACCTGG + Intronic
938436073 2:131284302-131284324 AGGCCTTGTCAGTAAGGTCCTGG + Intronic
938436086 2:131284374-131284396 GGGCCTTGTCAGTAAGGACCTGG + Intronic
938436105 2:131284475-131284497 GGGCCTTGTCAGTAAGGACCTGG + Intronic
939494957 2:142916908-142916930 TGGCCTTTTCACAAAGGCCGTGG - Intronic
1171881060 20:30617572-30617594 AGGCCTTGTCAGTAAGGTCCTGG - Intergenic
1171883072 20:30632129-30632151 AGGCCTTGTCAGTAAGGACCTGG - Intergenic
1176601497 21:8798847-8798869 AGGCCTTGTCAGTAAGGTCCTGG - Intergenic
1176626475 21:9095882-9095904 AGGCCTTGTCAGTAAGGTCCTGG + Intergenic
1176647117 21:9362156-9362178 AGTCCTTGTCAGTAAGGTCCTGG - Intergenic
1176842317 21:13850888-13850910 AGGCCTTGTCAGTAAGGACCTGG - Intergenic
1180343783 22:11690384-11690406 AGTCCTTGTCAGTAAGGTCCTGG - Intergenic
1180365808 22:11936841-11936863 AGGCCTTGTCAGTAAGGTCCTGG + Intergenic
1180416992 22:12776747-12776769 AGGCCTTGTCAGTAAGGTCCTGG + Intergenic
1180714845 22:17864836-17864858 TGGCCTTGTCACAGAGGCCGAGG + Intronic
950098847 3:10345277-10345299 TGTCCCTGTCAGAACAGCCGGGG - Intronic
952954794 3:38550297-38550319 TGTCCTGGCCAGCCAGGCCGAGG + Exonic
958074432 3:88657800-88657822 TCTCCTTATGAGTAAGGCAGAGG - Intergenic
967244834 3:187476086-187476108 TGTCATTTTCAGAAAGGCCCAGG + Intergenic
968350294 3:198047400-198047422 AGGCCTTGTCAGTAAGGTCCTGG - Intergenic
1202739764 3_GL000221v1_random:42836-42858 AGGCCTTGTCAGTAAGGTCCTGG + Intergenic
973364816 4:49200639-49200661 AGGCCTTGTCAGTAAGGTCCTGG - Intergenic
973395774 4:49591811-49591833 AGGCCTTGTCAGTAAGGTCCTGG + Intergenic
980628490 4:135406254-135406276 TCTGCTTGTCAGTCAGGCCAAGG - Intergenic
982487688 4:155987703-155987725 TGTCCTTTTCAAAAAGGACGAGG - Intergenic
983061900 4:163169941-163169963 TGTCATTGTCAGTGAGGCAGTGG - Intergenic
983717697 4:170805398-170805420 TGTGCTTGGCAATAAGGCAGAGG + Intergenic
984999555 4:185470835-185470857 TGTCCGTGTCATCACGGCCGTGG + Intronic
1202762210 4_GL000008v2_random:122295-122317 AGGCCTTGTCAGTAAGGTCCTGG - Intergenic
989644124 5:43610827-43610849 TGTCCTTGTGAGTAAATCCATGG + Intronic
992511008 5:77434960-77434982 TGTCCTTGAATGTAAGGCTGAGG - Intronic
998860843 5:146442500-146442522 TGACCTTGTCAGTAAAGCACGGG + Intergenic
999689524 5:154134758-154134780 TGTCCTTGGCAGTGAGGCAAAGG + Intronic
1002917312 6:1539801-1539823 TCTCCTTGTCAGCAAGACTGAGG - Intergenic
1003133095 6:3412559-3412581 AGTCCTTGTCCGTAATGCAGAGG + Intronic
1007968499 6:46026728-46026750 TCTCCTTGTGAGCAAGGCCTGGG - Intronic
1013148828 6:107424565-107424587 TGTCCTTGTAAGTAAGACAAAGG - Intronic
1015765418 6:136710983-136711005 TCTCCTTCTCAGCAAGGCCTAGG - Intronic
1015889958 6:137960584-137960606 TTTCCTTGTCAGTCAGGAAGGGG + Intergenic
1019224485 6:170498837-170498859 TGTCCTGGTCACTCAGGCCCTGG - Intergenic
1026514774 7:71059371-71059393 TGTCCTTTTCTGTAAGACAGAGG + Intergenic
1027520404 7:79199768-79199790 TGTCCTTGGCAGTGCAGCCGGGG + Intronic
1040104828 8:43535678-43535700 AGGCCTTGTCAGTAAGGACCTGG + Intergenic
1040104836 8:43535722-43535744 AGGCCTTGTCAGTAAGGTCCTGG + Intergenic
1041571364 8:59340621-59340643 TGAGCTTGTCAGCAAGGCCCAGG - Intergenic
1048349054 8:133600920-133600942 TGGCCTTGTCAGGGAGGCTGAGG - Intergenic
1051342060 9:16120921-16120943 AGCCCTGGCCAGTAAGGCCGAGG + Intergenic
1052702859 9:31959587-31959609 TGTCCTTCTCAGTAAGGAGGAGG - Intergenic
1053666647 9:40322202-40322224 AGGCCTTGTCAGTGAGGCCCTGG + Intronic
1053916233 9:42947249-42947271 AGGCCTTGTCAGTAAGGCCCTGG + Intergenic
1054741427 9:68809914-68809936 TGTCCTTGTCATTATGGCCCCGG + Intronic
1055985684 9:82055479-82055501 AGGCCTTGTCAGTAAGGACCTGG + Intergenic
1056585653 9:87925643-87925665 AGGCCTTGTCAGTAAGGACCTGG - Intergenic
1057675438 9:97133208-97133230 AGGCCTTGTCAGTAAGGACCTGG - Intergenic
1057675443 9:97133237-97133259 AGGCCTTGTCAGTAAGGACCTGG - Intergenic
1057675454 9:97133295-97133317 AGGCCTTGTCAGTAAGGACCTGG - Intergenic
1058003922 9:99895580-99895602 TGTCCTTCTCTTTAAGGCAGAGG - Intergenic
1062595556 9:137297502-137297524 TGTCCTTGTTAGGAAGCCCGGGG - Intergenic
1203708409 Un_KI270742v1:72793-72815 AGTCCTTGTCAGTAAGGTCCTGG + Intergenic
1203542975 Un_KI270743v1:107176-107198 AGGCCTTGTCAGTAAGGTCCTGG - Intergenic
1198511030 X:137351999-137352021 TGTCTTTGTCACTGAGGCCTGGG - Intergenic
1201163016 Y:11181311-11181333 AGGCCTTGTCAGTAAGGTCCTGG + Intergenic