ID: 1092770580

View in Genome Browser
Species Human (GRCh38)
Location 12:11892814-11892836
Sequence GGTTGGTGTCCTTGTCAGTA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 133}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092770580_1092770588 16 Left 1092770580 12:11892814-11892836 CCTTACTGACAAGGACACCAACC 0: 1
1: 0
2: 0
3: 10
4: 133
Right 1092770588 12:11892853-11892875 GGACTATGGTTCAAGGACACTGG 0: 1
1: 0
2: 0
3: 2
4: 100
1092770580_1092770584 -5 Left 1092770580 12:11892814-11892836 CCTTACTGACAAGGACACCAACC 0: 1
1: 0
2: 0
3: 10
4: 133
Right 1092770584 12:11892832-11892854 CAACCTAGGGTGCAAACAGATGG 0: 1
1: 0
2: 0
3: 9
4: 89
1092770580_1092770589 24 Left 1092770580 12:11892814-11892836 CCTTACTGACAAGGACACCAACC 0: 1
1: 0
2: 0
3: 10
4: 133
Right 1092770589 12:11892861-11892883 GTTCAAGGACACTGGAATTGAGG 0: 1
1: 0
2: 2
3: 17
4: 144
1092770580_1092770587 9 Left 1092770580 12:11892814-11892836 CCTTACTGACAAGGACACCAACC 0: 1
1: 0
2: 0
3: 10
4: 133
Right 1092770587 12:11892846-11892868 AACAGATGGACTATGGTTCAAGG 0: 1
1: 0
2: 1
3: 9
4: 111
1092770580_1092770586 2 Left 1092770580 12:11892814-11892836 CCTTACTGACAAGGACACCAACC 0: 1
1: 0
2: 0
3: 10
4: 133
Right 1092770586 12:11892839-11892861 GGGTGCAAACAGATGGACTATGG 0: 1
1: 0
2: 0
3: 7
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092770580 Original CRISPR GGTTGGTGTCCTTGTCAGTA AGG (reversed) Exonic
900310465 1:2030938-2030960 GGAGGCTGTCCTTGTCAGCAGGG + Intergenic
901936301 1:12629549-12629571 GGTTGGTGGCCTTGGCAGGTTGG + Intergenic
906552035 1:46673171-46673193 GGTTGCTGTCTTGGTCAGCATGG - Exonic
906583844 1:46958440-46958462 GGGTGCTGTCAATGTCAGTAGGG - Intergenic
907950956 1:59183362-59183384 GATTTGTGTACTTTTCAGTATGG + Intergenic
909975674 1:82043528-82043550 GGCTGGTGTCCTTGTAAAAAGGG - Intergenic
910465169 1:87491402-87491424 GGTTGTTGGGCTTGTCAGGAGGG + Intergenic
914330353 1:146663714-146663736 GTTTGGTTTCCTTGTCACTAAGG + Intergenic
919167437 1:193913527-193913549 GGTAGGATTGCTTGTCAGTATGG - Intergenic
921123495 1:212156989-212157011 GGATGGTGTCCTGGCCAGGATGG + Intergenic
921265983 1:213420974-213420996 GACTGGTGTCCTTATCAGAAGGG - Intergenic
1065806519 10:29398189-29398211 GGTGGGTGTCCAAGTCAATATGG + Intergenic
1065942652 10:30578939-30578961 GGTGGGTGTCCAAGTCAATATGG - Intergenic
1066357382 10:34698134-34698156 GGTTGGTGTGCTTGTGTGTGTGG - Intronic
1066443737 10:35462798-35462820 GGGTGGTGCCCCTGTCAGGAGGG + Intronic
1067852162 10:49761133-49761155 TGTTGCTGTCCTTGACTGTATGG - Intronic
1072192884 10:93090502-93090524 GGCTGGTGTCCTTGTAAGAATGG - Intergenic
1073782760 10:106857337-106857359 GCTTTGTGACCTTGGCAGTATGG - Intronic
1074874060 10:117600789-117600811 GATTGCTCTCCTTGTCAATAGGG + Intergenic
1074974647 10:118570129-118570151 CTTTGGTTTCCTTGTCTGTAAGG + Intergenic
1075841680 10:125509929-125509951 TGTTGGTGTCCATGACAGCATGG - Intergenic
1077957072 11:7031762-7031784 GGTTTGTTTCGTTTTCAGTAGGG - Intronic
1082244277 11:49904011-49904033 GGCTGGTTTCCTTGTCATTCTGG - Intergenic
1084355325 11:68634607-68634629 GGTTGGGGTACTTGCCACTAAGG - Intergenic
1084675309 11:70630597-70630619 GGTTGGTGCCCTTATAAGGAGGG + Intronic
1085393687 11:76195348-76195370 GGCTGGTGTCCTTATAAGAAAGG + Intronic
1086272862 11:85088874-85088896 GCTTTATGTCCTTGTCAGCATGG + Intronic
1092770580 12:11892814-11892836 GGTTGGTGTCCTTGTCAGTAAGG - Exonic
1093069123 12:14690251-14690273 GAGTGGTGTTCTGGTCAGTAAGG - Intronic
1099904554 12:88756660-88756682 GTCAGGTGTCCTTGGCAGTAGGG - Intergenic
1102492637 12:113298178-113298200 GGTGGGTGCCCTTGTCATTGAGG + Exonic
1104146623 12:126040201-126040223 GACTGGTGTCCTTGTAAGAAGGG - Intergenic
1107911917 13:45113318-45113340 GTGTGGTGTCCTTGTCTGCATGG - Intergenic
1108530164 13:51320973-51320995 GGTTGGTGTCCTCATAAGAAGGG - Intergenic
1110049913 13:70883779-70883801 GGTTGGAGTCCTTGGAAGAATGG - Intergenic
1111573613 13:90119594-90119616 GACTGGTGTCCTTGTAAGAAGGG - Intergenic
1113368787 13:109704357-109704379 GCTTGCTGTCCTTGTCACTGTGG - Intergenic
1116504929 14:45666107-45666129 TGTTGGTGTCCTTGTGATTGGGG + Intergenic
1117547453 14:56805046-56805068 GGTTACTGTCCTTGTCATTTGGG - Intronic
1119009535 14:70970486-70970508 GGTTGGTGCCCTTGTGTTTAGGG + Intronic
1119865249 14:77967808-77967830 GGTTGTGGTCCTTGTCATCAAGG - Intergenic
1120834676 14:89028913-89028935 GGTTGTTGCCCTTGTCTGCAGGG - Intergenic
1123162698 14:106294668-106294690 GGGTGATTTCCTTGTCAGGAAGG + Intergenic
1125512211 15:40298181-40298203 GGCTGGTGGCCGTGGCAGTAGGG - Intronic
1126898506 15:53286276-53286298 GGATGGTGTCCTTGTGGGTTGGG + Intergenic
1128193258 15:65725355-65725377 CTTTGGTTTCCTTGTCAGAAGGG + Intronic
1130221827 15:82025912-82025934 GGTTGATGCACTTGTCAGTTGGG + Intergenic
1133926139 16:10194103-10194125 GGTTGGTGTACTTGTTGGTTGGG - Intergenic
1133980467 16:10629618-10629640 GGATGGTGCCCTGGCCAGTAAGG - Intronic
1134913925 16:18053324-18053346 GATTGGTGTCCTTGTAAGAAGGG - Intergenic
1136111417 16:28065790-28065812 GGTTGGTGTGCATGTGAGCAGGG + Intergenic
1137501383 16:49014133-49014155 GGTGGGTCTCATTGTTAGTAGGG - Intergenic
1138058047 16:53856991-53857013 GGTTGGTTCCCTTGCCATTAAGG - Intronic
1140003203 16:71047191-71047213 GTTTGGTTTCCTTGTCACTAAGG - Intronic
1140234170 16:73143653-73143675 GTTTGGTGTCCTTGTCTGGCTGG + Intronic
1140731429 16:77860002-77860024 GGCTGGTGTCCTTATGAGAAGGG + Intronic
1142112153 16:88338700-88338722 GGCTGGTGTCCTTATCAGAAGGG + Intergenic
1142246399 16:88972116-88972138 GGTTGCTGTCCTTGTGTGTGGGG + Intronic
1142530084 17:573528-573550 GGTGGGTGGCCTTGTCAGTGTGG - Intronic
1150465914 17:65392542-65392564 GTTTGGTGTCCTTGTGGGTGGGG - Intergenic
1155312208 18:24534879-24534901 GCTTGGTGTCTTTGTAAGAAGGG + Intergenic
1155386440 18:25282841-25282863 CTTTGCTGTCCTTGTCAGTCTGG - Intronic
1156655216 18:39276880-39276902 GGTTGCTTTACTTGTCAGAAAGG - Intergenic
1157009809 18:43633494-43633516 GGGTGTTGTCCTTGTCTGCATGG - Intergenic
1158360134 18:56663116-56663138 GGCTGGTGTCCTTGTAAGAAGGG - Intronic
1160292574 18:77607825-77607847 GGTTGGTGTCCTCGACGTTAGGG - Intergenic
1160327861 18:77967320-77967342 GGCTGGTGTCCTTATGAGAAGGG + Intergenic
1162034753 19:7932846-7932868 AGTCGGTGACCTTGTCCGTAAGG + Exonic
1166729823 19:45052728-45052750 GCTTTGTGTCCTGGGCAGTATGG + Intronic
930032941 2:47069434-47069456 GGTTGGGCTCCTTGTGAGTCTGG + Intronic
931993118 2:67810361-67810383 GGTTGGTTTCCTTCTCATTTGGG - Intergenic
935133987 2:100283043-100283065 GGTTGGCTTCCTCGTCTGTAAGG - Exonic
935184864 2:100722892-100722914 GGATGGTGTCTTTGTTACTAGGG - Intergenic
936092360 2:109509707-109509729 GACTGGTGTCCTTGTGAGAAGGG - Intergenic
936579866 2:113689422-113689444 GACTGGTGTCCTTGTAAGAAGGG - Intergenic
937688347 2:124723772-124723794 GGCTCGTGTCCTTGTAAGAATGG - Intronic
938617448 2:133013845-133013867 GGGTGGTATCATTGTCAGTCAGG - Intronic
939112136 2:138020869-138020891 TGTTGCTGTCCTTGTCTGCATGG - Intergenic
941308047 2:163894805-163894827 GGTTGGGGTCATTGTCTGTGTGG + Intergenic
942040617 2:172058471-172058493 GGTTGGTGATATTGTCATTAGGG + Intronic
943593298 2:189825168-189825190 TGTTGATGTTCTTGCCAGTATGG + Intronic
943889124 2:193263576-193263598 GGTTTTTGTCATTGACAGTAAGG - Intergenic
947601080 2:231450746-231450768 GGTTGGTGACCTGATCAGTGGGG + Intergenic
1172206684 20:33167462-33167484 GGTTCCTGTCCTTGCAAGTATGG + Intronic
1175007518 20:55701129-55701151 GCTTGGGGTCCTTCTAAGTATGG + Intergenic
1180181338 21:46119901-46119923 GGTTGGGGCCCTCGTCAGCAGGG - Intronic
1180571932 22:16732197-16732219 GGTTTGTGGCCTTGCCAGTTGGG + Intergenic
954665279 3:52248237-52248259 GGTAGGTGCCCTTGGCAGCATGG + Exonic
958884276 3:99708575-99708597 GTTTGGTGTGCTTGCCAGTATGG - Intronic
960595611 3:119405397-119405419 GGGTGTTGTCCTTGTCTGCATGG + Intronic
960675886 3:120194442-120194464 GTTTGGTGTTCTTGTGTGTATGG - Intronic
961583406 3:127902194-127902216 GGCTAGTGTCCTTGTAAGGAGGG - Intergenic
962605423 3:137028928-137028950 GGTTTGTGTCCCTGCCACTAAGG - Intergenic
964309821 3:155380571-155380593 GGCTGGTGTCCTTGTAAGAAGGG + Intronic
965410749 3:168327472-168327494 GTTTTGTTTCCTTGTGAGTATGG + Intergenic
967550967 3:190795812-190795834 AGTTGGTGTCCTTGTGGGGAGGG - Intergenic
969331632 4:6476647-6476669 GGGTGGTGTCTTAGTCAGTTTGG - Intronic
969862428 4:10048162-10048184 GGTTGGTGGCCTGCCCAGTAAGG - Intronic
970707175 4:18818325-18818347 GATTGGTGTGCTTATCAGAAGGG - Intergenic
972909413 4:43796643-43796665 AATTGGTGTCCTTGTCGGTGGGG - Intergenic
973756809 4:54082889-54082911 GGTTGGTGTCATGGTTAGGATGG - Intronic
974120754 4:57635248-57635270 GGTTCTTGTTCTTGACAGTAGGG + Intergenic
979644614 4:123053619-123053641 GGTTGGTGTTCTTGTCACATTGG + Intronic
979797873 4:124869864-124869886 GGCTGGTGCCCTTATAAGTAGGG + Intergenic
984067248 4:175063117-175063139 GGTTTGTGTCCTTTTCACTGTGG - Intergenic
985927706 5:3030635-3030657 GGTTCGTGTCCTTCTAAGAAGGG + Intergenic
986149476 5:5114283-5114305 GATTGGTGTCCTTGAAAGTGAGG - Intergenic
988503824 5:31804860-31804882 GCTTGTTTTCCTTGTCAGTTTGG - Intronic
989142484 5:38215309-38215331 GATTTGTGTCCTTGTAAGAAGGG - Intergenic
990371246 5:55120522-55120544 GATTGGTGTCCCTGGCAGTCTGG - Exonic
991173209 5:63653158-63653180 GGTTGGTGGCCTTATAAGAAGGG - Intergenic
993072864 5:83187765-83187787 GGTTGCTGTACTGGGCAGTACGG - Intronic
993140884 5:84031783-84031805 GTCTGGTGTCTTTGTCAGTTTGG - Intronic
996463521 5:123773619-123773641 GGTTGGTGACTTTGTTAGTCTGG - Intergenic
999227000 5:150033877-150033899 GGTTATTGTCCTTGTGAGAAAGG + Intronic
1001277827 5:170363416-170363438 GACTGGTGTCCTTGTAAGAAGGG + Intronic
1001751042 5:174131694-174131716 GGCTGGTGTCCTTATAAGAAGGG + Intronic
1003274577 6:4638428-4638450 GATTGGTGTCCTTATAAGAAGGG - Intergenic
1003644292 6:7901991-7902013 GACTGGTGTCCTTGTAAGAAGGG + Intronic
1004020496 6:11771778-11771800 GACTGGTGTCCTTATCAGAAAGG + Intronic
1005382215 6:25247454-25247476 GGTTGCTATCCTTGTCTGCATGG - Intergenic
1010207709 6:73337804-73337826 AGGTAGTGTCCTTGTCAATATGG + Intergenic
1015315113 6:131808233-131808255 TGTTGGGGTCCTTGGCAGTGCGG - Exonic
1015799652 6:137047166-137047188 GTTTGCTGTTCTTGTCACTAAGG + Intergenic
1015889955 6:137960578-137960600 GGTAGTTTTCCTTGTCAGTCAGG + Intergenic
1016688778 6:146911783-146911805 GCTTGGGGTCCTTGTCTATAAGG - Intergenic
1021389874 7:20079163-20079185 GATTGGTGTCTGTGTCAGAATGG - Intergenic
1023215345 7:37856505-37856527 AGTTGGTGTCTTAGTCAGTTTGG - Intronic
1026573012 7:71548334-71548356 GATTGCTGTCCTTGTCATTTGGG - Intronic
1032681547 7:134189718-134189740 TATTGGTGTCCTTGACAGTCAGG - Intronic
1038375530 8:27036564-27036586 GCTTGGTCTCCTTGTCACTACGG + Intergenic
1038482589 8:27911879-27911901 GGCTGGTGTCCTTATAAGAAGGG + Intronic
1039656151 8:39410327-39410349 GGTTGGTGTCAGTGGCTGTAAGG + Intergenic
1042162711 8:65912960-65912982 GGTTTGTGTCCTTTTCAGGGTGG - Intergenic
1043425056 8:80140224-80140246 GGTAGGTCTCCTTGCCAGTGAGG - Intronic
1047617785 8:126577269-126577291 GATTGGTGTACTTTACAGTATGG + Intergenic
1055655813 9:78449758-78449780 GTGTGGTGTCCTTATCAGCAAGG + Intergenic
1056783348 9:89568417-89568439 GTTTGGGGTCCTTGGCAGAAGGG - Intergenic
1058881852 9:109292337-109292359 TGTTAATGTCCCTGTCAGTAGGG - Intronic
1061764943 9:132875720-132875742 GGATGGTGGCCTGGTGAGTAGGG - Intronic
1062011204 9:134267776-134267798 GGATGGTGTGCTTGTTAGTGGGG + Intergenic
1185779611 X:2832841-2832863 GATTGGTGTCCTTATAAGAAAGG - Intronic
1194831671 X:98631312-98631334 AGTTGGTGTCCTTGTCTGGGGGG - Intergenic
1198962212 X:142194875-142194897 TGTTGGTGTCCATCTCAGTCAGG + Intergenic