ID: 1092770586

View in Genome Browser
Species Human (GRCh38)
Location 12:11892839-11892861
Sequence GGGTGCAAACAGATGGACTA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 98}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092770578_1092770586 9 Left 1092770578 12:11892807-11892829 CCCTCGGCCTTACTGACAAGGAC 0: 1
1: 0
2: 1
3: 3
4: 70
Right 1092770586 12:11892839-11892861 GGGTGCAAACAGATGGACTATGG 0: 1
1: 0
2: 0
3: 7
4: 98
1092770579_1092770586 8 Left 1092770579 12:11892808-11892830 CCTCGGCCTTACTGACAAGGACA 0: 1
1: 0
2: 0
3: 14
4: 117
Right 1092770586 12:11892839-11892861 GGGTGCAAACAGATGGACTATGG 0: 1
1: 0
2: 0
3: 7
4: 98
1092770580_1092770586 2 Left 1092770580 12:11892814-11892836 CCTTACTGACAAGGACACCAACC 0: 1
1: 0
2: 0
3: 10
4: 133
Right 1092770586 12:11892839-11892861 GGGTGCAAACAGATGGACTATGG 0: 1
1: 0
2: 0
3: 7
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092770586 Original CRISPR GGGTGCAAACAGATGGACTA TGG Exonic
906074965 1:43045403-43045425 GTGTGGAAACAGATGGGGTATGG + Intergenic
908342047 1:63191635-63191657 CTGTCCAAACAGATGGACAAGGG - Intergenic
909067770 1:70956638-70956660 TGGTGCCAACAACTGGACTATGG + Intronic
911456245 1:98127838-98127860 AGGTGCAAACAGATGTGGTACGG + Intergenic
915819394 1:159005873-159005895 GAGAGCAACCAGATGGCCTAAGG + Intronic
921046539 1:211481769-211481791 AGCTGGAAACACATGGACTATGG + Intronic
921805407 1:219448568-219448590 AGGTGTAGACAGATGGACAATGG - Intergenic
922785610 1:228280982-228281004 GGGTGCAAGCAGGTGGACCCGGG + Intronic
1065307416 10:24382191-24382213 GTTTGCAAACAGATGGGCTTGGG + Intronic
1067450982 10:46381670-46381692 GGGTGCAAGCAGCTCGACTGAGG - Intronic
1067586261 10:47478081-47478103 GGGTGCAAGCAGCTCGACTGAGG + Intronic
1070255927 10:74813316-74813338 GGGTGCACTCAGATGGAGAAAGG + Intergenic
1071719030 10:88124061-88124083 TGGACCAAACAGATGGAGTATGG + Intergenic
1075474371 10:122720830-122720852 GGGTGCAAACACATGTAGTTGGG + Intergenic
1075870118 10:125766091-125766113 GGATACAAACAGATGAACTTTGG + Intergenic
1076657360 10:132033603-132033625 GCGTGGAAACAGATGGATGATGG + Intergenic
1078613380 11:12841628-12841650 GGGTGCAAACTGAAGGAAGATGG - Intronic
1084668707 11:70592586-70592608 GGGTGCAGACAGAGGGACAGAGG - Intronic
1090816439 11:130301082-130301104 GGGTGATAACAGATGGTATAAGG + Intronic
1090966422 11:131601209-131601231 GGGAGCATACAGATGGACAGTGG + Intronic
1092770586 12:11892839-11892861 GGGTGCAAACAGATGGACTATGG + Exonic
1104915568 12:132262682-132262704 AGGTGCAGACAGATGAGCTATGG - Intronic
1104915584 12:132262759-132262781 AGGTGCAGACAGATGAGCTATGG - Intronic
1109249122 13:59997153-59997175 GGGTGCAAACATATGGTAGAAGG - Intronic
1109589806 13:64463182-64463204 GGGAGCAGACAGATGGACAGGGG - Intergenic
1109895881 13:68689166-68689188 GGGTCAAAACTGATGGACTTTGG + Intergenic
1111224809 13:85255403-85255425 GGGTTCAAACATATGGATTTTGG - Intergenic
1118143004 14:63105708-63105730 GGCCGCAAACAGATGGAGAAGGG - Intergenic
1118230217 14:63940723-63940745 GGGTCAAAACAGAAGGAGTAGGG - Intronic
1121833184 14:97069306-97069328 GTGTGACAACAGATGGACTGGGG + Intergenic
1123980321 15:25596363-25596385 GCCTGGAAACAGATGGTCTATGG - Intergenic
1126011099 15:44303254-44303276 GGGTGCATAAATATGTACTAGGG + Intronic
1126559448 15:50027156-50027178 GGGTGCACACATATGGGGTAGGG - Intronic
1126782867 15:52153312-52153334 GGTTGCCGACAGCTGGACTAAGG - Intronic
1145245616 17:21267405-21267427 GAGTGCATGCTGATGGACTAGGG + Intergenic
1150988553 17:70227899-70227921 GGGTTCAAATAGAAGGAGTAAGG + Intergenic
1153408224 18:4764479-4764501 TGGTGCAAACAGTAGGACTGGGG + Intergenic
1159428865 18:68325131-68325153 GGGAGAAAACAGATGGGCTAGGG + Intergenic
1159856813 18:73598592-73598614 GGCTGAAAATAGATGGAGTATGG + Intergenic
1160603559 18:80032901-80032923 GGGAACAATCAGATGGGCTAGGG - Intronic
1161404384 19:4083454-4083476 GGGTGCAAACAGAAGGGATGTGG + Intergenic
1162842862 19:13369070-13369092 GGGTGCTAACAGATGCAGTGTGG + Intronic
1165079804 19:33300808-33300830 GGGTGGAAACATAGGGACTTGGG - Exonic
1165752074 19:38266248-38266270 GGCTGCAGCCAGATGGCCTAGGG + Intronic
1166848410 19:45744933-45744955 GGATGTTAACACATGGACTAGGG + Intronic
1167013521 19:46824541-46824563 GGTTGCAAACACATGGCCTGAGG + Intergenic
929226297 2:39514826-39514848 TGGTCCAAACAGAAGGACCAGGG - Intergenic
929318776 2:40514360-40514382 GTGGGCAAACAGAAGGACAAAGG + Intronic
936844566 2:116815547-116815569 CTGTGCAAACAGATGCCCTATGG - Intergenic
937149694 2:119678109-119678131 GGGTGAAAACAGACTGCCTAGGG - Intergenic
938387017 2:130873826-130873848 GGATGAAATCAGATGGACCAGGG - Intronic
943888509 2:193254981-193255003 GGGTGCAAACAATTAGAATAAGG - Intergenic
946180404 2:217945664-217945686 TGGTGAAAGCAGATGGACTATGG + Intronic
948118221 2:235509678-235509700 GGGTGCAAGCAGACGGACAGAGG - Intronic
948768683 2:240236365-240236387 AGGTGCAAACAGGAGGACGATGG - Intergenic
1172342695 20:34170974-34170996 TGGTGTGAACAGATGGACTAAGG - Intergenic
1179163985 21:38920823-38920845 GGCTGCAAACAGATGAGCTAGGG + Intergenic
1179405731 21:41123998-41124020 ATGTGCAAATGGATGGACTAGGG + Intergenic
1179623784 21:42635917-42635939 GGGAACAAATAGATGGACAATGG - Intergenic
1183729847 22:39612014-39612036 GGTTGCCAACACATGAACTATGG - Intronic
1184702451 22:46185185-46185207 GAGTGAAAACAGATGGAACATGG - Intronic
951684261 3:25326652-25326674 AGGTGCCAACAGATCCACTAGGG - Intronic
951716110 3:25648316-25648338 GGGAGCAGACAGATGGACAGAGG + Intronic
952594309 3:34997420-34997442 GGGTGGAAATAGATGTAATATGG + Intergenic
953032078 3:39185832-39185854 GGCTGCACACAGATGGCCTGGGG - Exonic
960169968 3:114448452-114448474 GAGGGCAAACAGATGGATCAAGG + Intronic
961244905 3:125442417-125442439 GGGTGAAAACAGGGGGACTGAGG + Intergenic
961662241 3:128475543-128475565 GGGTGCAAACAGAGGGAAGAAGG + Intergenic
962658879 3:137580493-137580515 GGGAGCAAACAGACAGCCTATGG - Intergenic
964579804 3:158220353-158220375 GAGTACAGACAGATGGACTGAGG - Intronic
964739747 3:159952926-159952948 GGGTGGAAAGTGATGGACAAGGG + Intergenic
968066195 3:195761160-195761182 AGGTGGACACAGATGGAATAAGG - Intronic
973547085 4:51992762-51992784 TGATGCCAACAGGTGGACTAGGG + Intergenic
973661724 4:53114352-53114374 GGGGGCGAAAAGATGGAGTATGG - Intronic
976093861 4:81487068-81487090 GGCTGCAATTAAATGGACTATGG + Intronic
979872659 4:125844644-125844666 AGGGGCAAAGAGATGGATTAAGG - Intergenic
984744744 4:183203482-183203504 GAGTGGATACAGAAGGACTATGG - Intronic
990368281 5:55091854-55091876 ACGTGCAAACAAATGAACTAGGG - Intergenic
994740551 5:103612323-103612345 GAGTGAAAAAGGATGGACTATGG - Intergenic
994874381 5:105397602-105397624 TCGTGCATCCAGATGGACTAAGG + Intergenic
996940484 5:128999610-128999632 GGGTGTAAAAAGTTGGACTTTGG - Intronic
1001815782 5:174668336-174668358 GGTTGCAAACAGGTGGCCTGAGG - Intergenic
1002953344 6:1837883-1837905 GGGAGCAGACAGGAGGACTAGGG + Intronic
1004054040 6:12116487-12116509 AGATGCAAACAGAAGGACGATGG - Intronic
1013835046 6:114324764-114324786 AGGTGCATTCAGATGGACCAGGG + Intronic
1014007964 6:116442934-116442956 GGGAGTAAACATATGGAATATGG - Intergenic
1024818084 7:53294568-53294590 GTTTGCAAACAGGTGAACTAAGG + Intergenic
1027225932 7:76243706-76243728 GGGTGGGAAGAGATGGCCTAAGG - Intronic
1039348213 8:36731692-36731714 GGGTGCAAACACATGGACACAGG + Intergenic
1045607702 8:103795964-103795986 TGGTGCAATAAGATGGGCTAGGG - Intronic
1051035188 9:12736053-12736075 GAGTGCAAGCAGATGGAATTGGG - Intergenic
1051531785 9:18112247-18112269 AGGTGAACTCAGATGGACTAAGG - Intergenic
1053461692 9:38276518-38276540 GGTTGCAAACTGATGGCCCACGG - Intergenic
1053608761 9:39688172-39688194 TGGTGGAATCAGATGGGCTATGG - Intergenic
1053866606 9:42444538-42444560 TGGTGGAATCAGATGGGCTATGG - Intergenic
1054244763 9:62654226-62654248 TGGTGGAATCAGATGGGCTATGG + Intergenic
1054558890 9:66688769-66688791 TGGTGGAATCAGATGGGCTATGG + Intergenic
1057195638 9:93114561-93114583 GGGTGCACACAGATGGACAGGGG - Intergenic
1058078403 9:100674225-100674247 GGGTGAAAACAGATGGAAAGGGG + Intergenic
1187527421 X:20066714-20066736 GGGTTTAAACAGATGGAGCAGGG - Intronic
1188186427 X:27121382-27121404 GGCTGCAAACGAATGGACTTAGG - Intergenic
1190979171 X:55440693-55440715 GGTTGCAGACTGATGGAGTAGGG - Intergenic
1193668315 X:84351602-84351624 AGGTGCAAACAAATGGAAAAAGG - Intronic
1198974570 X:142321866-142321888 GGGTGGAAGCAGAAGAACTAGGG - Intergenic
1200979229 Y:9246830-9246852 GCATGAAAACAAATGGACTAAGG - Intergenic
1202116650 Y:21475446-21475468 GCATGAAAACAAATGGACTAAGG - Intergenic