ID: 1092776475

View in Genome Browser
Species Human (GRCh38)
Location 12:11948707-11948729
Sequence GTGGTGGGAACGAGATGACG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092776475_1092776481 11 Left 1092776475 12:11948707-11948729 CCCCGTCATCTCGTTCCCACCAC No data
Right 1092776481 12:11948741-11948763 GACTTTGAAGAGACACCGAGAGG No data
1092776475_1092776485 26 Left 1092776475 12:11948707-11948729 CCCCGTCATCTCGTTCCCACCAC No data
Right 1092776485 12:11948756-11948778 CCGAGAGGCCAAGAGGCCCTGGG No data
1092776475_1092776483 25 Left 1092776475 12:11948707-11948729 CCCCGTCATCTCGTTCCCACCAC No data
Right 1092776483 12:11948755-11948777 ACCGAGAGGCCAAGAGGCCCTGG No data
1092776475_1092776482 19 Left 1092776475 12:11948707-11948729 CCCCGTCATCTCGTTCCCACCAC No data
Right 1092776482 12:11948749-11948771 AGAGACACCGAGAGGCCAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092776475 Original CRISPR GTGGTGGGAACGAGATGACG GGG (reversed) Intergenic
No off target data available for this crispr