ID: 1092777036

View in Genome Browser
Species Human (GRCh38)
Location 12:11952833-11952855
Sequence ACGTGTGTGGTGCCCAGCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092777032_1092777036 11 Left 1092777032 12:11952799-11952821 CCGCGTTCCTGGGAGTGACTATG No data
Right 1092777036 12:11952833-11952855 ACGTGTGTGGTGCCCAGCGCTGG No data
1092777034_1092777036 4 Left 1092777034 12:11952806-11952828 CCTGGGAGTGACTATGAGGTGAG No data
Right 1092777036 12:11952833-11952855 ACGTGTGTGGTGCCCAGCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092777036 Original CRISPR ACGTGTGTGGTGCCCAGCGC TGG Intergenic
No off target data available for this crispr