ID: 1092778663

View in Genome Browser
Species Human (GRCh38)
Location 12:11965495-11965517
Sequence CCCTGTGTAGGAGGGGGCTA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092778649_1092778663 24 Left 1092778649 12:11965448-11965470 CCCAGATACACTGTGTTCTTCTG No data
Right 1092778663 12:11965495-11965517 CCCTGTGTAGGAGGGGGCTACGG No data
1092778654_1092778663 -10 Left 1092778654 12:11965482-11965504 CCAGCCCTGAGAGCCCTGTGTAG No data
Right 1092778663 12:11965495-11965517 CCCTGTGTAGGAGGGGGCTACGG No data
1092778653_1092778663 -4 Left 1092778653 12:11965476-11965498 CCAAATCCAGCCCTGAGAGCCCT No data
Right 1092778663 12:11965495-11965517 CCCTGTGTAGGAGGGGGCTACGG No data
1092778650_1092778663 23 Left 1092778650 12:11965449-11965471 CCAGATACACTGTGTTCTTCTGG No data
Right 1092778663 12:11965495-11965517 CCCTGTGTAGGAGGGGGCTACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092778663 Original CRISPR CCCTGTGTAGGAGGGGGCTA CGG Intergenic
No off target data available for this crispr