ID: 1092778675

View in Genome Browser
Species Human (GRCh38)
Location 12:11965626-11965648
Sequence ACCTGGCATAAGGGAGGACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092778675_1092778683 -4 Left 1092778675 12:11965626-11965648 CCCAGTCCTCCCTTATGCCAGGT No data
Right 1092778683 12:11965645-11965667 AGGTTCTCGGAAGCTGCCTTGGG No data
1092778675_1092778682 -5 Left 1092778675 12:11965626-11965648 CCCAGTCCTCCCTTATGCCAGGT No data
Right 1092778682 12:11965644-11965666 CAGGTTCTCGGAAGCTGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092778675 Original CRISPR ACCTGGCATAAGGGAGGACT GGG (reversed) Intergenic
No off target data available for this crispr