ID: 1092778682

View in Genome Browser
Species Human (GRCh38)
Location 12:11965644-11965666
Sequence CAGGTTCTCGGAAGCTGCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092778675_1092778682 -5 Left 1092778675 12:11965626-11965648 CCCAGTCCTCCCTTATGCCAGGT No data
Right 1092778682 12:11965644-11965666 CAGGTTCTCGGAAGCTGCCTTGG No data
1092778676_1092778682 -6 Left 1092778676 12:11965627-11965649 CCAGTCCTCCCTTATGCCAGGTT No data
Right 1092778682 12:11965644-11965666 CAGGTTCTCGGAAGCTGCCTTGG No data
1092778672_1092778682 23 Left 1092778672 12:11965598-11965620 CCAGAAATACCTATTTTGCTCAA No data
Right 1092778682 12:11965644-11965666 CAGGTTCTCGGAAGCTGCCTTGG No data
1092778673_1092778682 14 Left 1092778673 12:11965607-11965629 CCTATTTTGCTCAAAATAGCCCA No data
Right 1092778682 12:11965644-11965666 CAGGTTCTCGGAAGCTGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092778682 Original CRISPR CAGGTTCTCGGAAGCTGCCT TGG Intergenic
No off target data available for this crispr