ID: 1092779174

View in Genome Browser
Species Human (GRCh38)
Location 12:11969619-11969641
Sequence CTGAAAATGACCCTTGTGTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092779174_1092779179 23 Left 1092779174 12:11969619-11969641 CCGGACACAAGGGTCATTTTCAG No data
Right 1092779179 12:11969665-11969687 TATTTTAAGTAGCCAGGCTATGG No data
1092779174_1092779178 17 Left 1092779174 12:11969619-11969641 CCGGACACAAGGGTCATTTTCAG No data
Right 1092779178 12:11969659-11969681 TTTGAGTATTTTAAGTAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092779174 Original CRISPR CTGAAAATGACCCTTGTGTC CGG (reversed) Intergenic
No off target data available for this crispr