ID: 1092780677

View in Genome Browser
Species Human (GRCh38)
Location 12:11983815-11983837
Sequence CTCGGAAGACATCACTGCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092780670_1092780677 25 Left 1092780670 12:11983767-11983789 CCACATGTGGTGTGATTTTTCAG No data
Right 1092780677 12:11983815-11983837 CTCGGAAGACATCACTGCTCTGG No data
1092780674_1092780677 -9 Left 1092780674 12:11983801-11983823 CCTTGGATGCCCTTCTCGGAAGA No data
Right 1092780677 12:11983815-11983837 CTCGGAAGACATCACTGCTCTGG No data
1092780669_1092780677 26 Left 1092780669 12:11983766-11983788 CCCACATGTGGTGTGATTTTTCA No data
Right 1092780677 12:11983815-11983837 CTCGGAAGACATCACTGCTCTGG No data
1092780672_1092780677 0 Left 1092780672 12:11983792-11983814 CCTTCATTACCTTGGATGCCCTT No data
Right 1092780677 12:11983815-11983837 CTCGGAAGACATCACTGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092780677 Original CRISPR CTCGGAAGACATCACTGCTC TGG Intergenic
No off target data available for this crispr