ID: 1092780793

View in Genome Browser
Species Human (GRCh38)
Location 12:11984928-11984950
Sequence AACCTGCAGAGACGCTCACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092780785_1092780793 14 Left 1092780785 12:11984891-11984913 CCCTCAGATAGAGTAGGACAATC No data
Right 1092780793 12:11984928-11984950 AACCTGCAGAGACGCTCACATGG No data
1092780790_1092780793 -8 Left 1092780790 12:11984913-11984935 CCATGGACCCTAGGGAACCTGCA No data
Right 1092780793 12:11984928-11984950 AACCTGCAGAGACGCTCACATGG No data
1092780786_1092780793 13 Left 1092780786 12:11984892-11984914 CCTCAGATAGAGTAGGACAATCC No data
Right 1092780793 12:11984928-11984950 AACCTGCAGAGACGCTCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092780793 Original CRISPR AACCTGCAGAGACGCTCACA TGG Intergenic
No off target data available for this crispr