ID: 1092783780

View in Genome Browser
Species Human (GRCh38)
Location 12:12010045-12010067
Sequence CTTTGGCCATAGATGGACCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092783771_1092783780 21 Left 1092783771 12:12010001-12010023 CCTAGGGCGGCACTTGCTATCAG No data
Right 1092783780 12:12010045-12010067 CTTTGGCCATAGATGGACCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092783780 Original CRISPR CTTTGGCCATAGATGGACCT CGG Intergenic
No off target data available for this crispr