ID: 1092790918

View in Genome Browser
Species Human (GRCh38)
Location 12:12070261-12070283
Sequence GATCCAAATCGTGCTCTTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 69}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092790918_1092790920 -5 Left 1092790918 12:12070261-12070283 CCAGAAAGAGCACGATTTGGATC 0: 1
1: 0
2: 0
3: 2
4: 69
Right 1092790920 12:12070279-12070301 GGATCTCAGCTCAACTGATAGGG 0: 1
1: 0
2: 0
3: 9
4: 95
1092790918_1092790919 -6 Left 1092790918 12:12070261-12070283 CCAGAAAGAGCACGATTTGGATC 0: 1
1: 0
2: 0
3: 2
4: 69
Right 1092790919 12:12070278-12070300 TGGATCTCAGCTCAACTGATAGG 0: 1
1: 0
2: 0
3: 8
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092790918 Original CRISPR GATCCAAATCGTGCTCTTTC TGG (reversed) Intronic
906257464 1:44361110-44361132 GATTCAAATCCTGCACTGTCTGG - Intergenic
907783568 1:57589943-57589965 GGGCCAATTTGTGCTCTTTCAGG - Intronic
910497742 1:87851836-87851858 GATCTAAAGTTTGCTCTTTCTGG + Intergenic
913183616 1:116346192-116346214 GATACAAATCGTGTGCTTCCTGG - Intergenic
921742795 1:218705793-218705815 GATCCAGATGGTGCTATTTGGGG - Intergenic
1063667862 10:8075831-8075853 GATGCAAATGGAGCTCTCTCTGG + Intergenic
1065498422 10:26354029-26354051 GATCCCTATCCTTCTCTTTCTGG - Intergenic
1068439071 10:57028938-57028960 GATCAAATTCCTGGTCTTTCTGG - Intergenic
1068801669 10:61147527-61147549 GATCCAGACTGTGGTCTTTCGGG - Intergenic
1069658122 10:70105515-70105537 TATCCATTTCTTGCTCTTTCTGG - Intronic
1073199063 10:101720089-101720111 GCTCCAAACTGTTCTCTTTCTGG + Intergenic
1073706509 10:105990003-105990025 GATCCAAAGCGTGCACTCCCTGG + Intergenic
1078827464 11:14942936-14942958 GCTCCAAAGCGTGCTCTCACAGG - Intronic
1082160648 11:48884830-48884852 GATGCAAAGCCTGCTGTTTCAGG + Intergenic
1082161718 11:48895576-48895598 GATGCAAAGCCTGCTGTTTCAGG - Intergenic
1082167298 11:48964004-48964026 GATGCAAAGCCTGCTGTTTCAGG - Intergenic
1082236279 11:49822694-49822716 GATGCAAAGCCTGCTGTTTCAGG + Intergenic
1082239731 11:49857202-49857224 GATGCAAAGCCTGCTGTTTCAGG + Intergenic
1082242427 11:49887149-49887171 GATGCAAAGCCTGCTGTTTCAGG - Intergenic
1087007782 11:93486255-93486277 GATTCCAATCAAGCTCTTTCTGG + Intronic
1089238700 11:117055489-117055511 GATTCAAATCCTGGTCTCTCTGG + Intronic
1090168107 11:124572669-124572691 GTCCCAAATCATTCTCTTTCAGG + Intergenic
1092790918 12:12070261-12070283 GATCCAAATCGTGCTCTTTCTGG - Intronic
1100032889 12:90214768-90214790 TATCCAAATTAAGCTCTTTCTGG - Intergenic
1108072514 13:46642701-46642723 TATCCAAATCGGACCCTTTCTGG + Intronic
1112502418 13:99953315-99953337 GTTCTAATGCGTGCTCTTTCGGG + Intergenic
1114767247 14:25387784-25387806 GATTCAAATCAAGGTCTTTCTGG - Intergenic
1127356473 15:58205481-58205503 AATAAAAATAGTGCTCTTTCTGG - Intronic
1132939215 16:2498724-2498746 CATCCACATGGTGCTCTGTCGGG + Intronic
1144057169 17:11553658-11553680 GATCCAATTAATGCTCTTTGTGG - Intronic
1144282565 17:13741188-13741210 GATCCAAAATTAGCTCTTTCAGG + Intergenic
1157782591 18:50453339-50453361 GATCCAAATCTTGCTATTCTGGG - Intergenic
1161620460 19:5294323-5294345 GTTCCAATTCCTGCTCTTCCCGG - Intronic
1163322007 19:16580325-16580347 GATCCATTTCCTGCTCCTTCAGG + Intronic
928594694 2:32848724-32848746 GATCTAAATCCTAGTCTTTCTGG - Intergenic
930799978 2:55433776-55433798 ACTCCAAATCCTGCTCTTTTGGG - Intergenic
931414244 2:62065684-62065706 GATCTAAATGGTACTATTTCTGG - Intronic
933352575 2:81173580-81173602 AATACAAACCGTGATCTTTCAGG - Intergenic
934589138 2:95530596-95530618 GATGCAAAGCCTGCTGTTTCAGG + Intergenic
940018132 2:149128381-149128403 GATCCAAATCATGGACTTTAGGG + Intronic
1172438734 20:34950120-34950142 GATCCAACACTTGGTCTTTCTGG - Intronic
1174051116 20:47768288-47768310 AACCCAAATCTTCCTCTTTCAGG - Intronic
1181845332 22:25703311-25703333 GATACAAGTCTTGCTATTTCAGG + Intronic
1183937766 22:41273442-41273464 GATCCAAGTGGTGCCCTTTTTGG - Intronic
962969529 3:140385936-140385958 GATCCAAATAGGGCCATTTCTGG - Intronic
963666210 3:148190528-148190550 GATACAAATGGTTCTTTTTCTGG + Intergenic
966305590 3:178530375-178530397 GACCCAAATCGTGGTCGTACTGG + Intronic
969946212 4:10785849-10785871 GATCCAATGATTGCTCTTTCAGG - Intergenic
972801940 4:42485596-42485618 GAGCAAAATCATTCTCTTTCCGG + Exonic
975556005 4:75665349-75665371 GATCCAAATACTGCCATTTCAGG + Intronic
976385630 4:84454402-84454424 GATGGAAATCGTGCACTTTTAGG - Intergenic
984698632 4:182804229-182804251 GATCCACATCATGTTCTGTCTGG + Intergenic
985385803 4:189447112-189447134 GATTCAAATGCTGCCCTTTCTGG - Intergenic
987157466 5:15104590-15104612 CATCCAAATTGAGCTCTTTCAGG - Intergenic
997632719 5:135381058-135381080 GATACAATTAGTGCTATTTCTGG - Intronic
1000154047 5:158533387-158533409 GAGCCAAATCCTGCTCTTTATGG - Intergenic
1001332150 5:170770023-170770045 ATTCCAAATCATGCTCGTTCAGG - Intronic
1004780840 6:18906695-18906717 GATCCAAAATGTACTCTTTAAGG + Intergenic
1014825712 6:126046895-126046917 TATCTAAATGGGGCTCTTTCTGG - Intergenic
1018292094 6:162302200-162302222 GATGATTATCGTGCTCTTTCAGG - Intronic
1024992206 7:55244170-55244192 GATCCAATTTCTGCTCATTCCGG - Intronic
1026875974 7:73879375-73879397 GACCCTAATCGTGCCCTTGCAGG - Intergenic
1030650934 7:112115367-112115389 AATCTAAATGGTGTTCTTTCAGG - Intronic
1032632511 7:133669202-133669224 GAGCCAAATCGAGCTGTCTCTGG + Intronic
1041797303 8:61759042-61759064 GATTCAAATCCAGGTCTTTCTGG - Intergenic
1047711383 8:127556028-127556050 GATCCAAGTCTGGCTCTTTAGGG - Intergenic
1051878218 9:21812838-21812860 GATACAAATCTAGGTCTTTCAGG - Intronic
1055667528 9:78567533-78567555 GTTCCAGACCCTGCTCTTTCTGG - Intergenic
1062191687 9:135251108-135251130 GATTCAAATCCAGCTCTCTCTGG - Intergenic
1188333959 X:28905422-28905444 GATCCATTTTGTTCTCTTTCTGG - Intronic
1190571107 X:51782664-51782686 GATCCACATTGAGCTCATTCAGG - Intergenic
1196429000 X:115602229-115602251 GATCCAAATCCCCTTCTTTCTGG - Intronic