ID: 1092791212

View in Genome Browser
Species Human (GRCh38)
Location 12:12072353-12072375
Sequence GCCTCTCAGCACACCCGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 225}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092791203_1092791212 25 Left 1092791203 12:12072305-12072327 CCAATACCTGGAATGTAGGTGTT 0: 1
1: 0
2: 1
3: 9
4: 124
Right 1092791212 12:12072353-12072375 GCCTCTCAGCACACCCGGCCAGG 0: 1
1: 0
2: 1
3: 20
4: 225
1092791204_1092791212 19 Left 1092791204 12:12072311-12072333 CCTGGAATGTAGGTGTTCGTTGC 0: 1
1: 0
2: 0
3: 3
4: 69
Right 1092791212 12:12072353-12072375 GCCTCTCAGCACACCCGGCCAGG 0: 1
1: 0
2: 1
3: 20
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092791212 Original CRISPR GCCTCTCAGCACACCCGGCC AGG Intronic
900240679 1:1615919-1615941 GCGCCGCAGCCCACCCGGCCCGG - Intronic
900609457 1:3538339-3538361 GCCTCAGAGCACACAGGGCCTGG + Intronic
901024911 1:6274083-6274105 GCCCCTCTGCACACCGTGCCTGG + Intronic
901656716 1:10773616-10773638 GCTTCTCAGCATACTTGGCCGGG + Intronic
902436375 1:16400609-16400631 GCCTCTCAGCTCCCTTGGCCTGG + Intronic
902920551 1:19664291-19664313 GACTCTTAACACACCTGGCCTGG + Intergenic
903324760 1:22563526-22563548 CGCTCTCCGCACACCCGGCCGGG - Intergenic
903338990 1:22642695-22642717 GCCTCTCAGCTCTGCCAGCCTGG + Intergenic
904371865 1:30052865-30052887 GCAAGTCACCACACCCGGCCAGG + Intergenic
907384385 1:54116633-54116655 GCCTCGGAGCCCACCGGGCCTGG - Intergenic
908136580 1:61139362-61139384 GCCCCTCAGCAAAGCCTGCCCGG - Intronic
910963375 1:92784798-92784820 GCCTCCCGGCCCGCCCGGCCTGG + Intronic
913099727 1:115551956-115551978 GCCCCTCACCACACCTGACCTGG + Intergenic
914899295 1:151703369-151703391 CCCTCTCCGCACACCTGCCCTGG - Exonic
916732618 1:167580193-167580215 GCCATTCAGCACCCCCTGCCTGG + Intergenic
918127310 1:181595853-181595875 ACCTATCAGCACACCATGCCTGG + Intronic
918372739 1:183877541-183877563 GTTTCTCAGCACACCAGGCAGGG - Intronic
921766977 1:218983606-218983628 GCCCCTCAGCACAAACAGCCTGG - Intergenic
922304299 1:224330458-224330480 GCGTCTCCGCACACCGCGCCGGG - Intergenic
922474911 1:225899978-225900000 CCATCTCAGTACACCCAGCCAGG + Intronic
924801361 1:247331510-247331532 TCCTCCCAGCCCGCCCGGCCGGG + Exonic
1064384646 10:14879171-14879193 GCCTCTCCGCCCGCTCGGCCCGG + Intronic
1070853776 10:79589022-79589044 GCCTCTCAGCCCACACTGACTGG + Intergenic
1071107724 10:82117646-82117668 GCCTCACAGCACACCCTGCCAGG - Intronic
1074051926 10:109888058-109888080 GCCTCTCCTCACACTGGGCCTGG - Exonic
1074165870 10:110872642-110872664 GCCTCCCAGCGCCCCCGGCGAGG - Intronic
1075023895 10:118969753-118969775 GAATCTCAGCACACGAGGCCGGG + Intergenic
1075253358 10:120903005-120903027 TGCACTCAGCACACCTGGCCTGG - Intronic
1075871642 10:125775520-125775542 CCCTCTCAGCCCAGCCTGCCTGG + Intronic
1076336151 10:129707667-129707689 GACTCTCAGAACACACGTCCTGG + Intronic
1076502661 10:130949517-130949539 GGCTCCCAGCACAGCCGGCCTGG - Intergenic
1076628911 10:131841188-131841210 GCCTCACCGCACACCCCGCGTGG + Intergenic
1076796863 10:132802719-132802741 GGCTGGCCGCACACCCGGCCAGG + Intergenic
1077119431 11:899959-899981 GCCTCTGAGCACAGCCCCCCGGG - Intronic
1077315530 11:1917875-1917897 GCCCCTCAGGACCCCTGGCCTGG + Intergenic
1077489042 11:2852059-2852081 TCCTCTCAGCACAGCCCTCCGGG + Intergenic
1078452258 11:11449162-11449184 GCTTCTCAGCAGACCCTGTCAGG - Intronic
1083583395 11:63839371-63839393 GCCTCCCCGCACCCCCGGCCGGG + Exonic
1083827469 11:65211625-65211647 CCCACTCAGCACCACCGGCCTGG + Exonic
1084316740 11:68350029-68350051 GTCTCTCAGCACTCCCAGCCTGG + Intronic
1084703150 11:70800721-70800743 TCCTCTCAGCCCAGCTGGCCGGG + Intronic
1088354516 11:108928333-108928355 GCTTCTGAGAACACCCTGCCAGG - Intronic
1090086450 11:123654579-123654601 GGCTGACAGCACACACGGCCTGG - Exonic
1091613605 12:2032352-2032374 GGCACTTAGCACACCCGGCCAGG + Intronic
1092353862 12:7778351-7778373 GACTCCCAACACACCCAGCCAGG - Intergenic
1092791212 12:12072353-12072375 GCCTCTCAGCACACCCGGCCAGG + Intronic
1094358889 12:29608731-29608753 CCCTCTCAGCACCCCCGTCTGGG - Intronic
1094375653 12:29784567-29784589 GCCTCTGAACACACCCGGGCAGG - Intronic
1094414140 12:30200829-30200851 GCCTCTGAACACACCCGGGCAGG + Intergenic
1094492745 12:30971137-30971159 GCCTCTCATCCCAACCTGCCTGG + Intronic
1095966219 12:47868953-47868975 GCCTCTCACCAGACTGGGCCCGG + Intronic
1097160294 12:57041532-57041554 CCCCCTCTGCACACCAGGCCAGG + Intronic
1101900532 12:108788491-108788513 ACTTCTCATCACTCCCGGCCTGG + Exonic
1102753916 12:115321246-115321268 GACTCTAAGCACACAAGGCCAGG + Intergenic
1104602664 12:130163566-130163588 GCCGCTCTGCACGCCCGGCGTGG + Exonic
1104967559 12:132515334-132515356 CCCACCCAGCACACCCAGCCAGG + Intronic
1106420287 13:29580209-29580231 GCCCCTCAGCAGTCACGGCCTGG - Intronic
1108559452 13:51628157-51628179 GCCTCTCAGCACGAACAGCCTGG - Intronic
1113928242 13:113952830-113952852 GCCTCTCAGCCCAACGGGCCGGG + Intergenic
1115310614 14:31974777-31974799 GCCCCTCAGCACAGACAGCCTGG - Intergenic
1117443575 14:55781724-55781746 GCCCCTCACCACACATGGCCTGG - Intergenic
1117882718 14:60327985-60328007 GCCTCCCCGCAAACCCGGCCCGG + Intergenic
1119164385 14:72480295-72480317 GACTCTCTGCACACCTGCCCTGG - Intronic
1121289288 14:92761242-92761264 TCCCCTCCCCACACCCGGCCCGG + Intergenic
1122651965 14:103231163-103231185 GCGCCTCTGCCCACCCGGCCCGG + Intergenic
1122881771 14:104693518-104693540 GCCGCTGAGCACACCAGCCCCGG + Intronic
1122918873 14:104871432-104871454 GCCTCTCCCCACACCTGCCCTGG + Intronic
1123188549 14:106544335-106544357 GCACCTCAGCACACCTGTCCAGG - Intergenic
1123629452 15:22251072-22251094 GCCTCTCACCAAGCCTGGCCAGG - Intergenic
1123717072 15:23040707-23040729 GCCCCCCAGCACCTCCGGCCAGG - Intergenic
1123717299 15:23041457-23041479 GCCCCCCAGCACCTCCGGCCAGG - Intergenic
1123717861 15:23043346-23043368 GCCCCCCAGCACCTCCGGCCAGG - Intergenic
1123718543 15:23045714-23045736 GCCCCCCAGCACCTCCGGCCAGG - Intergenic
1123718844 15:23046783-23046805 GCCCCTCGGCACCTCCGGCCAGG - Intergenic
1123719049 15:23047489-23047511 GCCTCCCAGCACCTCCGGCCAGG - Intergenic
1123719340 15:23048494-23048516 GCCTCCCAGCACCTCCGGCCAGG - Intergenic
1123719507 15:23049057-23049079 GCCCCCCAGCACCTCCGGCCGGG - Intergenic
1124484088 15:30100639-30100661 GGCTCTCAGCACTCCCAGGCTGG + Intergenic
1124514281 15:30352990-30353012 TCCTCTCAGAACCCCAGGCCAGG + Intergenic
1124519494 15:30396585-30396607 GGCTCTCAGCACTCCCAGGCTGG - Intergenic
1124539161 15:30569636-30569658 GGCTCTCAGCACTCCCAGGCTGG + Intergenic
1124728638 15:32177774-32177796 TCCTCTCAGAACCCCAGGCCAGG - Intergenic
1124759489 15:32437936-32437958 GGCTCTCAGCACTCCCAGGCTGG - Intergenic
1125575830 15:40754989-40755011 GCCTCTCTTCTCACCCAGCCTGG + Exonic
1128308825 15:66617831-66617853 GCCTCTCACCACAGCCTGGCCGG + Intronic
1128704006 15:69825403-69825425 TTCTCTCTGCACACCGGGCCAGG - Intergenic
1129727428 15:77908743-77908765 GGCTCTCAGCACTCCCAGGCTGG - Intergenic
1130258446 15:82336766-82336788 GGCTCTCAGCACTCCCAGGCTGG - Intergenic
1130596479 15:85253194-85253216 GGCTCTCAGCACTCCCAGGCTGG + Intergenic
1132185551 15:99799309-99799331 GGCTCTCAGCACTCCCAGGCTGG + Intergenic
1132716319 16:1291885-1291907 GCCGCTCAGCCCACTCGGTCTGG + Intergenic
1132947268 16:2538350-2538372 GTCTGTCAGCGCCCCCGGCCAGG - Intronic
1132968448 16:2673106-2673128 GTCTGTCAGCGCCCCCGGCCAGG + Intergenic
1133130420 16:3673292-3673314 CCCTCTGAGCACACAGGGCCGGG - Intronic
1138656571 16:58495055-58495077 GCCCCTCACCCCACCTGGCCAGG + Intronic
1141160268 16:81625145-81625167 TCCTCCCAGCCCTCCCGGCCTGG + Intronic
1141678564 16:85530690-85530712 GCCTCACAGAGCACCCAGCCGGG + Intergenic
1141974105 16:87503364-87503386 GCCTCTCACCAAGCCTGGCCAGG + Intergenic
1142410458 16:89913346-89913368 ACCTCTCAGGACAGCAGGCCTGG - Intronic
1142595005 17:1025574-1025596 GCCTCTGAGCACACCTGCCTCGG + Intronic
1143130913 17:4676383-4676405 GCCTCACTGCACACCCTGCTGGG - Exonic
1143446438 17:7012806-7012828 GCCTCCCAGCCCTCCCAGCCCGG - Intronic
1143786979 17:9263058-9263080 GCCTCTGAGGACACCCCGTCTGG + Intronic
1143972144 17:10803563-10803585 GCCTCTCTGGCCACCCTGCCAGG + Intergenic
1144018571 17:11220416-11220438 GCCTCCCAGCACACAGGGCCAGG - Intergenic
1144441976 17:15291960-15291982 GCCCCTCAGCACACCCACCTTGG + Intergenic
1144626819 17:16848096-16848118 GCCTCGCAGCCCACCCGGGAAGG - Intergenic
1144850555 17:18241991-18242013 GCCCCTCCACACACCTGGCCTGG - Exonic
1145002311 17:19313935-19313957 GCCTCCCAGGGCACCAGGCCAGG - Intronic
1145152621 17:20519771-20519793 GCCTCGCAGCCCACCCGGGAAGG - Intergenic
1145797453 17:27664105-27664127 GCCTCTCAGCTCACCCCGATGGG - Intergenic
1145811850 17:27769041-27769063 GCCTCTCAGCTCACCCCGATGGG - Exonic
1145902358 17:28497082-28497104 GACTCTCCTCACACCAGGCCCGG + Exonic
1146008394 17:29176708-29176730 GGAGCTCAGCACAGCCGGCCGGG - Intronic
1146163958 17:30573935-30573957 GCCTCGCAGCCCACCCGGGAAGG - Intergenic
1146941506 17:36846938-36846960 GCCTCTCTGTACACATGGCCTGG - Intergenic
1147580963 17:41626789-41626811 GCCTCGCAGCCCACCCGGGAAGG - Intergenic
1147646850 17:42039480-42039502 GCATCTCTGCCCACCCGCCCAGG + Intronic
1147954322 17:44123758-44123780 GCCTCTCGGCCCTCCCCGCCGGG + Intergenic
1148384396 17:47223557-47223579 CCATCTCAGCTCACCCAGCCGGG - Exonic
1148896310 17:50841076-50841098 GCCTCTCAGCAAACTGGGCGAGG + Exonic
1149349639 17:55773910-55773932 GCCTGTCAGTGCACCCAGCCAGG + Intronic
1150250022 17:63700023-63700045 GGCTCTCACCAGGCCCGGCCTGG + Exonic
1151802003 17:76384367-76384389 CCGCCTCAGCTCACCCGGCCAGG + Intronic
1151946288 17:77321742-77321764 GCCGCTGAGCACACCCAGTCGGG + Intronic
1151984675 17:77534623-77534645 GCAGCTCAGCACCCCCAGCCTGG + Intergenic
1152585808 17:81188985-81189007 GCATCTCTTCACACCCAGCCTGG - Intergenic
1156309266 18:35907776-35907798 GCCTCACAGCACATCCTCCCAGG + Intergenic
1157335117 18:46732358-46732380 GCCTCTCAGCACCCAAGGTCTGG + Intronic
1157833504 18:50878789-50878811 GCCCCCCAGCACTCCTGGCCCGG - Intergenic
1157970089 18:52257253-52257275 GCCCCACAGCATACCCAGCCAGG - Intergenic
1158234800 18:55301016-55301038 GTCCCTCAGCACATCCGGCCTGG + Intronic
1159161388 18:64646918-64646940 GCCCCTCAGCACAAACAGCCTGG - Intergenic
1160083606 18:75753919-75753941 GCCCCTCAGCACAAACAGCCTGG - Intergenic
1160192333 18:76724225-76724247 GCCTCTCAGGGTACACGGCCTGG - Intergenic
1160801280 19:970868-970890 GCCTCTGACCACAGCCGGGCGGG - Intronic
1161768810 19:6220591-6220613 TCCGCTCTGCTCACCCGGCCTGG - Intronic
1165096571 19:33412982-33413004 GCCTCCAAGCACACCCAGCCAGG + Intronic
1165139144 19:33688744-33688766 GCTTCTCTGCCCACCGGGCCGGG + Intronic
1166783470 19:45354151-45354173 GCCTCTGAGCACACCATGGCCGG - Intronic
1167437231 19:49486522-49486544 GCCTCTCTGCTCTCCCTGCCTGG - Intergenic
1168051519 19:53833020-53833042 TCCCCTCCTCACACCCGGCCCGG + Intergenic
1168231148 19:55032422-55032444 GCCTCCCCGCAGACCCCGCCTGG + Intronic
1168355448 19:55697073-55697095 CCCTCTTCTCACACCCGGCCTGG + Intronic
925883314 2:8370658-8370680 GCCCCCCAGCACACCCTGGCTGG + Intergenic
927110183 2:19858945-19858967 GCCTCTCAGGAATCCTGGCCTGG - Intergenic
929594714 2:43168887-43168909 ACATCTCAGCTCACCAGGCCAGG - Intergenic
929764987 2:44837002-44837024 GCCTGTCAGCTCACCCAGGCTGG + Intergenic
929934502 2:46284977-46284999 GCCTCTGAGCATTCCTGGCCTGG - Intergenic
932538697 2:72627833-72627855 TCCTCTCACCTCACCCTGCCAGG + Intronic
937263504 2:120601460-120601482 TCCTCTCAACACACCCTCCCCGG + Intergenic
937349531 2:121151957-121151979 GGCTCTCAGCACACCTTGCAGGG - Intergenic
937980017 2:127609302-127609324 GGCTCTCTACACACCCTGCCGGG - Intronic
938311117 2:130288651-130288673 GCCCCTCCGCCCACCCGGGCCGG - Intergenic
938843684 2:135186553-135186575 GCCCTTCAGTAAACCCGGCCGGG + Intronic
940282381 2:152001213-152001235 GCCTCTCAACAAACTGGGCCTGG + Intronic
943460249 2:188164835-188164857 TCCCCTCATCACACCCGGTCTGG - Intergenic
946450407 2:219774561-219774583 GCCACTCAGCAAACACGGTCTGG - Intergenic
946845664 2:223856739-223856761 GACTCTCTGCACACCAAGCCTGG - Intronic
947795589 2:232892036-232892058 GCCTCTGTGCTCACACGGCCTGG + Intronic
947869791 2:233428197-233428219 TCTTCTCAGCACACCCCTCCTGG - Intronic
948177893 2:235958514-235958536 ACCTATCAGCACACCTGGCGAGG + Intronic
948678445 2:239612695-239612717 GCTTCTCAGCAGACCCGGGCAGG + Intergenic
948762337 2:240199736-240199758 GCCCCCCAGCAGACCCGGGCAGG + Intergenic
1170680517 20:18521595-18521617 TCCCCTCCTCACACCCGGCCTGG - Intronic
1173949940 20:46983602-46983624 GCCTCTCACCGCACCCAGCTTGG + Intronic
1174203455 20:48823249-48823271 GCCTCTCTGCCCACCCACCCAGG + Intronic
1175769299 20:61613290-61613312 GCCTCCCAGCTCACTCTGCCTGG - Intronic
1176993155 21:15522331-15522353 GCCCCTCAGCACAAGCAGCCTGG - Intergenic
1178958139 21:37041730-37041752 GCCTCTCCCCACAGCAGGCCTGG + Intergenic
1179457454 21:41508722-41508744 GTCTCTCGGCACCACCGGCCAGG + Intronic
1179940519 21:44636727-44636749 CCCTCTCAGGACACCTGACCAGG + Intronic
1180083481 21:45497259-45497281 CCCTCCCAGCACAGCCGTCCAGG + Intronic
1181643095 22:24215094-24215116 GCCTCCCAGCACCCCGGCCCAGG + Intergenic
1182828414 22:33285046-33285068 GCCACTTGGCACACCTGGCCGGG + Intronic
1183298524 22:37046454-37046476 GCCCCTCCCCACAACCGGCCTGG - Intergenic
1183743648 22:39681343-39681365 GCCTCACAGCCCCGCCGGCCAGG - Intronic
1184094439 22:42309037-42309059 GCCTCACAGGACACCCTGGCGGG + Intronic
1184441966 22:44522672-44522694 CCCCCTCAGCTCACCCTGCCAGG + Intergenic
1185199073 22:49491078-49491100 GCCCCTCAGGACACCGGTCCTGG - Intronic
951226364 3:20125912-20125934 TTCTGTCAGCACACTCGGCCAGG + Exonic
952279687 3:31911018-31911040 GCCTTTCAGGACACCAGGGCAGG + Intronic
953383921 3:42493973-42493995 GCCTCTGCCCACACCCGTCCTGG + Intronic
953547638 3:43875391-43875413 GCCCCTCAGCCCACCCTACCAGG + Intergenic
953603027 3:44386802-44386824 GCCCCTCAGCACAAACAGCCTGG + Intronic
962845038 3:139266695-139266717 GCCTGTGAGCACACCTGCCCAGG - Intronic
964927872 3:161979109-161979131 GCCACTCAGCACAAGCAGCCGGG - Intergenic
965984690 3:174736814-174736836 GCCCCTCAGCACAAACAGCCTGG - Intronic
968576474 4:1368599-1368621 GCGTCCCAGCACACCCGGCAGGG - Intronic
968810988 4:2799636-2799658 GCTTCTCAGGACACCAGCCCTGG - Intronic
979146545 4:117253843-117253865 TCCCCTCCTCACACCCGGCCCGG + Intergenic
980771211 4:137375714-137375736 GCCTTTCATCACACCCTGCAAGG - Intergenic
984966860 4:185146895-185146917 GCCTCTCAGCACATTGGACCAGG - Exonic
985513045 5:322605-322627 GCCTCACAGCCGCCCCGGCCTGG + Intronic
985531919 5:438843-438865 GCCCATCAGCAAACCCGTCCTGG + Intergenic
987030774 5:13974825-13974847 GCCTCTGAGCCCACCTTGCCAGG + Intergenic
987875380 5:23674751-23674773 GCCTTTCAGCACAAACAGCCTGG + Intergenic
989849749 5:46194164-46194186 GACTGACAGCACACACGGCCGGG + Intergenic
994891268 5:105639634-105639656 GCCCCTCAGCACAAACAGCCTGG + Intergenic
995742385 5:115368740-115368762 GCCCCTCAGCACAAACAGCCTGG + Intergenic
996176717 5:120368455-120368477 GCCCCTCAGCACAGACAGCCTGG + Intergenic
996519311 5:124409381-124409403 GCCTCCCAGAAGACCAGGCCTGG + Intergenic
998173349 5:139885346-139885368 GCCTCTCAGCGGCCTCGGCCTGG - Intronic
1000303070 5:159972683-159972705 GGCTCTCAGCATGCTCGGCCCGG - Intergenic
1002509194 5:179701885-179701907 GCCCACCACCACACCCGGCCCGG + Intronic
1003438949 6:6121996-6122018 GCCTCTCAGCACAAACAGCCTGG + Intergenic
1003524355 6:6885741-6885763 GCCCCTCGCCACACCTGGCCAGG + Intergenic
1005131547 6:22514148-22514170 ACCTCTCAGAACACCAGACCTGG - Intergenic
1005989542 6:30894453-30894475 GTTGCTCAGCACACACGGCCTGG - Intronic
1006090846 6:31627920-31627942 GCTTCTCAGCACAGGCTGCCCGG - Exonic
1006811318 6:36822246-36822268 GCGCCTCAGCAGACCCAGCCTGG + Intronic
1013311866 6:108902006-108902028 CCCTCTCAGCACCTCCTGCCAGG + Intronic
1013457103 6:110340207-110340229 GCCCCTCAGCAACCCAGGCCTGG - Intronic
1013613903 6:111823281-111823303 GCCTCTCAGCAGCCACGGCTGGG - Intronic
1013662018 6:112307687-112307709 GCCTCTCAGAAAACCCTGCAAGG - Intergenic
1014899453 6:126944893-126944915 GCCACTCAGCAGTCCCAGCCTGG - Intergenic
1018756285 6:166852551-166852573 GCTCCTGAACACACCCGGCCTGG + Intronic
1025090704 7:56061489-56061511 ACCTGCCACCACACCCGGCCAGG + Intronic
1025833083 7:65071599-65071621 GCCTGCCACCACACCCGGCTAGG + Intergenic
1029199027 7:98826491-98826513 GCTTCTCCGCAGACCCTGCCAGG - Intergenic
1029595893 7:101537542-101537564 GCGTCTCAGCCCTCCTGGCCTGG - Intronic
1034551457 7:151823144-151823166 CCCTCTCAGCACAGCCGCCTGGG + Intronic
1035747584 8:1973605-1973627 GCCCCTCCGCAGACCCAGCCAGG + Intergenic
1036644079 8:10601294-10601316 GCCTCTCACCACCCCCAGCCAGG - Intergenic
1039449336 8:37659066-37659088 GCGTACCACCACACCCGGCCCGG - Intergenic
1047336606 8:123942285-123942307 GCCTCTCAGCCCTCACCGCCAGG + Intronic
1047752446 8:127891951-127891973 GCCTCCCAGGCCACCAGGCCTGG - Intergenic
1048983163 8:139714203-139714225 GCCTCTCAGCAGGGCCGGTCGGG - Intergenic
1048995681 8:139792445-139792467 GCCCCACAGCACACCATGCCAGG - Intronic
1049578871 8:143401800-143401822 GCCCCTCAGCACCCCCTTCCCGG + Intergenic
1049618372 8:143586539-143586561 GGCCCTGAGCAGACCCGGCCCGG + Intronic
1049700317 8:144008206-144008228 GCCTCTCAGCGCACCCAGCATGG + Intronic
1052609911 9:30758929-30758951 GCCCCTCAGCACAAACAGCCTGG - Intergenic
1057199376 9:93132231-93132253 GCCGCTCTGCTCACCCAGCCTGG - Intronic
1057517058 9:95730728-95730750 GCTTCTTAGCACAGCCTGCCTGG - Intergenic
1061061641 9:128253596-128253618 GGCTCTCAGCACTCCCAGGCTGG - Intronic
1061886276 9:133592506-133592528 GCCCCTCAGCACAGCCAGCGTGG - Intergenic
1062024583 9:134334421-134334443 GGCCCTCTGCACACCAGGCCTGG - Intronic
1062046662 9:134427559-134427581 GTCTGTCAGCACACCTGGGCGGG + Intronic
1062129827 9:134886252-134886274 GCTGCTCAGCACACCCTGCCGGG + Intronic
1062378420 9:136275305-136275327 CCCTCCCAGCACCCCCAGCCGGG - Intergenic
1192165161 X:68823486-68823508 GCCCCTCAGCCAACCCAGCCAGG - Intergenic
1193211486 X:78811370-78811392 GCCCCTCAGCACAAACAGCCTGG - Intergenic
1202368112 Y:24180408-24180430 GGCTCTCAGCACTCCCAGGCTGG + Intergenic
1202372584 Y:24208774-24208796 GGCTCTCAGCACTCCCAGGCTGG - Intergenic
1202498200 Y:25461346-25461368 GGCTCTCAGCACTCCCAGGCTGG + Intergenic
1202502673 Y:25489709-25489731 GGCTCTCAGCACTCCCAGGCTGG - Intergenic