ID: 1092792773

View in Genome Browser
Species Human (GRCh38)
Location 12:12084189-12084211
Sequence CAAGGCGAGGCCATCATTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 1, 2: 1, 3: 9, 4: 174}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092792773_1092792776 -6 Left 1092792773 12:12084189-12084211 CCTAAAATGATGGCCTCGCCTTG 0: 1
1: 1
2: 1
3: 9
4: 174
Right 1092792776 12:12084206-12084228 GCCTTGGCCTCCCAAAATGCTGG 0: 2796
1: 62120
2: 175684
3: 221635
4: 181490
1092792773_1092792780 2 Left 1092792773 12:12084189-12084211 CCTAAAATGATGGCCTCGCCTTG 0: 1
1: 1
2: 1
3: 9
4: 174
Right 1092792780 12:12084214-12084236 CTCCCAAAATGCTGGGATTACGG 0: 256
1: 4714
2: 4821
3: 4424
4: 5298
1092792773_1092792781 3 Left 1092792773 12:12084189-12084211 CCTAAAATGATGGCCTCGCCTTG 0: 1
1: 1
2: 1
3: 9
4: 174
Right 1092792781 12:12084215-12084237 TCCCAAAATGCTGGGATTACGGG 0: 13221
1: 306476
2: 262600
3: 198956
4: 220194
1092792773_1092792778 -5 Left 1092792773 12:12084189-12084211 CCTAAAATGATGGCCTCGCCTTG 0: 1
1: 1
2: 1
3: 9
4: 174
Right 1092792778 12:12084207-12084229 CCTTGGCCTCCCAAAATGCTGGG 0: 4598
1: 96745
2: 220180
3: 237877
4: 156016

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092792773 Original CRISPR CAAGGCGAGGCCATCATTTT AGG (reversed) Intronic
901515369 1:9741677-9741699 CAAGGCGAGGAGATCACTTGAGG + Intronic
901575637 1:10198656-10198678 CAAGGCGAGGGGATCACTTGAGG - Intergenic
901972045 1:12915728-12915750 CAAGGCGAGCCCATCATTTTTGG + Intronic
901989397 1:13100572-13100594 TGAGGCGAGCCCATCATTTTTGG - Intergenic
901992416 1:13126192-13126214 TGAGGCGAGCCCATCATTTTTGG + Intergenic
902013134 1:13286034-13286056 CGAGGCGAGCCCATCATTTTTGG - Intergenic
908382497 1:63609866-63609888 CTAGGCCAGGCCATGATGTTTGG + Intronic
908434814 1:64094820-64094842 CAAGGCGAGTGGATCATTTGAGG - Intronic
909704944 1:78570434-78570456 CAGGCCTAGGTCATCATTTTTGG - Intergenic
913001445 1:114584506-114584528 CAAGGCGAGTGGATCATTTGAGG - Exonic
914719255 1:150275902-150275924 CAAGGCGAGTGGATCATTTGAGG + Intronic
920564875 1:206965467-206965489 CAAGACCAGGCCAGCATTTTAGG + Intronic
921388450 1:214595134-214595156 CAAGGCGAGCGGATCATTTGAGG + Intergenic
922462095 1:225821476-225821498 CAAGGCGAGCAGATCACTTTAGG - Intronic
923625088 1:235607177-235607199 CAAGGCGGGGGGATCATTTGAGG - Intronic
1063023138 10:2149328-2149350 CAAGGCGAGTGGATCATTTGAGG - Intergenic
1063496909 10:6518587-6518609 CAAGGCGAGGAGATCACTTGAGG + Intronic
1066352084 10:34645083-34645105 CAAGGCGAGAGGATCATTTGAGG - Intronic
1070943917 10:80372419-80372441 CAAGGCGAGAGCATCACTTGAGG + Intergenic
1072992893 10:100214628-100214650 CCCTGAGAGGCCATCATTTTAGG - Intronic
1073060648 10:100731465-100731487 CGAGGCGAGGCCCTGACTTTCGG - Intergenic
1074452774 10:113572723-113572745 CCAGGGGAGGCCACCTTTTTAGG - Intronic
1074705620 10:116127310-116127332 CAAAGCAAGTCCAACATTTTAGG + Intronic
1075709748 10:124524507-124524529 CAAGGCGGGGGGATCATTTGAGG - Intronic
1076445780 10:130512839-130512861 GAGGGCGAGGCCATCCTGTTGGG + Intergenic
1080801355 11:35613144-35613166 CAAGGCGGGGGGATCATTTGAGG + Intergenic
1082018858 11:47514155-47514177 CAAGGTGAGCCCATCACTTGAGG - Intronic
1083675923 11:64324559-64324581 CAAGGCGGGTGGATCATTTTAGG + Intergenic
1083911061 11:65710345-65710367 CAGGGCGAGTCCAGCACTTTGGG - Intergenic
1084440461 11:69169876-69169898 CTGGGCCAGGCCATCATTGTGGG - Intergenic
1085056143 11:73405141-73405163 AAAGGAGAGGCCATGCTTTTAGG - Intronic
1085231171 11:74972294-74972316 CAAGGCTAGGCGATCACTTGAGG - Intronic
1086114024 11:83228460-83228482 CAAGGCGAGTGGATCATTTGAGG - Intronic
1091973545 12:4808401-4808423 CAAGGAGAGGACATCTTTCTGGG + Intronic
1092792773 12:12084189-12084211 CAAGGCGAGGCCATCATTTTAGG - Intronic
1092825116 12:12391618-12391640 CAAGGCGGGCGCATCATTTGAGG - Intronic
1094543494 12:31381789-31381811 CAAGGCGAGTGCATCACTTGAGG - Intergenic
1095317758 12:40786476-40786498 CAAGGTGATCCCTTCATTTTTGG + Intronic
1096110737 12:49027685-49027707 CAAGGCGAGTGAATCACTTTAGG - Intronic
1097113310 12:56678882-56678904 CAAGGTGAGAGTATCATTTTGGG + Intronic
1097799930 12:63902569-63902591 CAAATCTAGTCCATCATTTTAGG - Intronic
1103442882 12:120976689-120976711 CAAGGCGAGGGCATCACCTAAGG + Intergenic
1106696471 13:32179545-32179567 CAAGGCACTGCCATCATTTCAGG - Intronic
1108862598 13:54880596-54880618 CAAGGCGAGTGGATCATTTGAGG - Intergenic
1109134551 13:58630466-58630488 CAGGGCTAGGCTATCATTTAAGG - Intergenic
1109342641 13:61080589-61080611 TAAGTCAAGTCCATCATTTTTGG + Intergenic
1111608426 13:90571539-90571561 CAAGGCGGGTGCATCATTTTAGG - Intergenic
1115202914 14:30873486-30873508 AATGGCGAGGAGATCATTTTGGG + Intergenic
1115244791 14:31283985-31284007 TCAGCCGAGGCCATCAGTTTTGG + Intergenic
1115345750 14:32341758-32341780 TCAGGCCTGGCCATCATTTTAGG + Intronic
1120879682 14:89405367-89405389 CAAGACGGGGGCATCATTTGAGG - Intronic
1121271699 14:92641969-92641991 CAAGGTGAGGCCCTAATTCTAGG - Intronic
1124050823 15:26196156-26196178 CAAGGCGGGGGGATCATTTGAGG + Intergenic
1126927425 15:53605620-53605642 CAAGGCGGGGGGATCATTTGAGG + Intronic
1127442316 15:59022090-59022112 CAAGGCGGGGAGATCACTTTAGG - Intronic
1127859015 15:62977508-62977530 CAAGGCGAGAGGATCATTTGAGG + Intergenic
1128012986 15:64316302-64316324 CAAGGCGAGCTCATCACTTGAGG + Intronic
1129323377 15:74787012-74787034 CCAGGCCAGGCCAGCATCTTGGG - Intronic
1134509532 16:14834845-14834867 CAAGGCCTGGGCCTCATTTTTGG + Intronic
1134697237 16:16233661-16233683 CAAGGCCTGGGCCTCATTTTTGG + Intronic
1134974609 16:18561013-18561035 CAAGGCCTGGGCCTCATTTTTGG - Intronic
1135241138 16:20807667-20807689 CAAGGCGGGAGCATCATTTGAGG + Intronic
1135292980 16:21256149-21256171 CAAGGCTAAGCTATCATGTTTGG + Intronic
1138752079 16:59434965-59434987 CAAGGCGAGGGAATCACTTGAGG - Intergenic
1138889118 16:61120458-61120480 TAAGGTGAGGCCATCAGTTTAGG - Intergenic
1140065753 16:71609805-71609827 CAAGGCGAGTGGATCATTTGAGG + Intergenic
1141081555 16:81057314-81057336 CAAGGCGGGCGCATCATTTGAGG + Intronic
1143185917 17:5010156-5010178 CAAGGCCAGTGCATCATTTGAGG - Intronic
1143311362 17:5992452-5992474 CAAAGCGATGCAATCACTTTTGG - Intronic
1143522248 17:7451511-7451533 CAAGGCGGGTGGATCATTTTAGG - Intronic
1146360881 17:32176801-32176823 CAAGGCGAGCAGATCATTTGAGG - Intronic
1146649492 17:34597898-34597920 CAAGGCCACACCATCACTTTAGG - Intronic
1147249808 17:39146301-39146323 CAAGGCGGGAGCATCATTTGAGG - Intronic
1147973396 17:44233049-44233071 CAAGGCGAGCAGATCATTTGAGG + Intergenic
1150765814 17:68001421-68001443 CAAGGCGGGGGGATCACTTTAGG - Intergenic
1152711987 17:81876079-81876101 TAATGTGATGCCATCATTTTAGG - Intergenic
1155910730 18:31501741-31501763 CAAGCTGAGGTCATTATTTTGGG - Intronic
1157609369 18:48946765-48946787 CCAGGCCAGGGCCTCATTTTCGG - Intronic
1160355623 18:78226167-78226189 CAAGGCGGGGGGATCATTTGTGG - Intergenic
1160899353 19:1419479-1419501 CGAGGGGTGGCCGTCATTTTAGG - Intronic
1160956186 19:1693016-1693038 CAAGGCGAGAGGATCATTTGAGG - Intergenic
1162026727 19:7898589-7898611 CAAGGCGAGTGGATCACTTTAGG - Intronic
1164956509 19:32391363-32391385 CAAGGCGGGTGGATCATTTTAGG + Intergenic
1167181601 19:47908097-47908119 CAAGGCGAGTGGATCATTTGAGG - Intergenic
1167182252 19:47913471-47913493 CAAGGCGAGTGGATCATTTGAGG - Intergenic
1167182917 19:47918848-47918870 CAAGGCGAGTGGATCATTTGAGG - Intergenic
1167183587 19:47924198-47924220 CAAGGCGAGTGGATCATTTGAGG - Intergenic
1167184217 19:47929238-47929260 CAAGGCGAGTGGATCATTTGAGG - Intergenic
1167184885 19:47934600-47934622 CAAGGCGAGTGGATCATTTGAGG - Intergenic
1167185541 19:47939963-47939985 CAAGGCGAGTGGATCATTTGAGG - Intergenic
1167186207 19:47945341-47945363 CAAGGCGAGTGGATCATTTGAGG - Intergenic
1167186858 19:47950714-47950736 CAAGGCGAGTGGATCATTTGAGG - Intergenic
1167187510 19:47956102-47956124 CAAGGCGAGTGGATCATTTGAGG - Intergenic
1167541665 19:50092168-50092190 CAAGGCGAGTGGATCATTTGAGG + Intergenic
1167542338 19:50097505-50097527 CAAGGCGAGTGGATCATTTGAGG + Intergenic
1167542775 19:50100570-50100592 CAAGGCGAGTGGATCATTTGAGG + Intergenic
1167543211 19:50103635-50103657 CAAGGCGAGTGGATCATTTGAGG + Intergenic
1167543645 19:50106691-50106713 CAAGGCGAGTGGATCATTTGAGG + Intergenic
1167544319 19:50112045-50112067 CAAGGCGAGTGGATCATTTGAGG + Intergenic
1167544994 19:50117398-50117420 CAAGGCGAGTGGATCATTTGAGG + Intergenic
1167545670 19:50122749-50122771 CAAGGCGAGTGGATCATTTGAGG + Intergenic
1167546347 19:50128077-50128099 CAAGGCGAGTGGATCATTTGAGG + Intergenic
1167547021 19:50133424-50133446 CAAGGCGAGTGGATCATTTGAGG + Intergenic
1167547679 19:50138796-50138818 CAAGGCGAGTGGATCATTTGAGG + Intergenic
930065942 2:47327645-47327667 CAAGGCGAGGGGATCACTTGAGG + Intergenic
935750651 2:106230911-106230933 CAAGGCAGGCCCATCATTTGAGG - Intergenic
936580612 2:113697221-113697243 CAGGGCCGGGCCATCAGTTTAGG - Intergenic
937556608 2:123165730-123165752 CAAGGCGAGTGAATCATTTGAGG - Intergenic
939679887 2:145117318-145117340 AAAGACAAGGCCATCATTTGGGG - Intergenic
940053834 2:149492857-149492879 CAAGGACAGACCAACATTTTAGG - Intergenic
944689147 2:202144044-202144066 CAAAGAGATGCAATCATTTTTGG - Intronic
945914227 2:215685750-215685772 AAAGGCAAGCCCATTATTTTTGG - Intergenic
1170274306 20:14566682-14566704 CAGGGAGAGGCCATAATCTTAGG - Intronic
1171152485 20:22839349-22839371 CAGGGCCAGGCCATCCTTGTAGG + Intergenic
1179895693 21:44361343-44361365 CAAGGCGAGTGGATCATTTGAGG - Intronic
1183936897 22:41267773-41267795 AAAGGCGGGGCAATCATATTGGG + Intronic
954267070 3:49478032-49478054 CGAGGCGGGTACATCATTTTAGG + Intronic
956136388 3:66103111-66103133 CAAGGCGAGCAGATCATTTGAGG - Intergenic
965261765 3:166495664-166495686 CAAGGCGGGCAGATCATTTTGGG - Intergenic
965576741 3:170224754-170224776 CAAGACGAGCGCATCATTTGAGG - Intronic
966818179 3:183905987-183906009 AAAGGAGGGGCCATCTTTTTGGG - Intergenic
968778587 4:2561413-2561435 CAAGGCGGGCCCATCACTTAAGG - Intronic
969177409 4:5409117-5409139 CAAGCAGAGGCCATCTTTTTGGG - Intronic
971409443 4:26354680-26354702 CAAGGCGACCCGATCATTTGAGG - Intronic
971945787 4:33275136-33275158 CAAGGAGATGCCTACATTTTAGG + Intergenic
972786712 4:42333011-42333033 CAAGGTGAGGCCATTAGGTTGGG + Intergenic
972908035 4:43775273-43775295 CAAGGCGAGTGCATCAGTTGAGG - Intergenic
974168934 4:58241129-58241151 CAAGGCGAGTGAATCATTTGAGG + Intergenic
975480435 4:74873658-74873680 CAAGAAGAGGAAATCATTTTCGG - Intergenic
978863232 4:113476542-113476564 CAAGGAGGGGGCATAATTTTGGG - Intronic
979443351 4:120779667-120779689 CAAGGCGGGCACATCATTTGAGG + Intronic
979883214 4:125988575-125988597 GAATCCTAGGCCATCATTTTTGG - Intergenic
987762736 5:22186701-22186723 CAAGGCGGGGGCATCACTTGAGG - Intronic
987920071 5:24268260-24268282 CAAGGCGAGAGGATCATTTGAGG - Intergenic
989629523 5:43466914-43466936 CAAGGTGAGTCGATCATTTGAGG + Intronic
991038062 5:62147966-62147988 GAATGGAAGGCCATCATTTTAGG - Intergenic
992478283 5:77125232-77125254 CAAGGCGGGGGAATCATTTGAGG - Intergenic
992699532 5:79328149-79328171 CAAGGCGAGCCGATCACTTGAGG + Intergenic
993698429 5:91090381-91090403 CAAGGCAAGACCATAATTCTAGG + Intronic
996587739 5:125110109-125110131 AAAGGCCAGGACATAATTTTTGG + Intergenic
998417762 5:141958017-141958039 CAAGGCAAGGCCATCTTCATTGG + Exonic
999577068 5:152990600-152990622 CAAGGGCAGGCCTTTATTTTAGG + Intergenic
1000814067 5:165898884-165898906 CAAGGGTTGGCAATCATTTTTGG - Intergenic
1002636777 5:180612553-180612575 CAAGGCGAGACCTGCATTCTCGG - Exonic
1004541902 6:16558601-16558623 CAAGGCGAGAGCATCACTTGAGG - Intronic
1010522941 6:76863457-76863479 CAAGGCCAGGGGATCAGTTTTGG + Intergenic
1010996106 6:82534968-82534990 GAAGGAGAGGCCTTCATTATAGG + Intergenic
1011713181 6:90076000-90076022 CAAAGTGAGGCCAGCCTTTTTGG - Intronic
1012896950 6:104959562-104959584 GAAGGCCTGGCCATCATTATTGG + Intronic
1013335709 6:109158253-109158275 CAAGGCGAGTGGATCATTTGAGG + Intronic
1020220818 7:6235241-6235263 CAAGGCGAGCACATCATTTGAGG + Intronic
1025600160 7:62986756-62986778 CCAGGTGAGGCCATCTTTTATGG - Intergenic
1026035884 7:66830373-66830395 CAAGGCGAGGGGATTATTTGAGG - Intergenic
1026037235 7:66838404-66838426 CAAGGCGAGGGGATTATTTGAGG - Intergenic
1026221102 7:68398434-68398456 CAAGGCGAGGGCTGCATTTCTGG - Intergenic
1030240917 7:107323294-107323316 CAAGGCGGGCCGATCATTTGAGG + Intronic
1031525192 7:122816895-122816917 CAAGGTAATGCCATCATTTAAGG - Intronic
1033227664 7:139574056-139574078 CAAGGCGGGGGGATCATTCTAGG - Intronic
1033486218 7:141791463-141791485 CAAGGCTAGGGCTTCATGTTTGG + Intergenic
1034860473 7:154590897-154590919 CTTGTCGAGGCCATCATTATGGG - Intronic
1035752404 8:2005496-2005518 CAAGGTGTGGCTTTCATTTTGGG + Exonic
1036760987 8:11508448-11508470 CATGGCGAAGCCATCATGTGTGG + Intronic
1037306287 8:17507444-17507466 CAAGGCGAGAAGATCATTTGAGG - Intronic
1037437168 8:18875149-18875171 CAAGGCGAGAGGATCATTTGAGG - Intronic
1038558199 8:28543611-28543633 CAAGGCGAGCACATCACTTGAGG - Intronic
1038588270 8:28811354-28811376 CAAGGCGAGTGGATCACTTTAGG - Intronic
1041520781 8:58753748-58753770 CAAGTCTAGGCCATCCTTTTTGG + Intergenic
1041919777 8:63168724-63168746 GAGCGCGAGGCCCTCATTTTGGG + Exonic
1042009039 8:64218843-64218865 CCAGATGAGGCCATCATTTTAGG + Intergenic
1043654380 8:82643499-82643521 CCAGGCTAAGCCATGATTTTGGG - Intergenic
1046999972 8:120563875-120563897 CAAGGCGAGTGGATCATTTGAGG + Intronic
1047257259 8:123224377-123224399 CAAGGCGGGACGATCATTTGAGG + Intronic
1049231492 8:141487073-141487095 CAAGACGAGCCCATCACTTGAGG - Intergenic
1051957976 9:22720549-22720571 CAAGGCGAGTGGATCATTTGAGG + Intergenic
1052794005 9:32905595-32905617 CAAGGAGAAGACCTCATTTTGGG + Intergenic
1055117732 9:72623772-72623794 CCAGGCTATTCCATCATTTTAGG + Intronic
1059155004 9:111981749-111981771 CAAGGCGAGTGGATCATTTGAGG - Intergenic
1059262145 9:112987947-112987969 CAAGGCGGGTGCATCATTTGAGG - Intergenic
1059310935 9:113388774-113388796 CAAGCAGAGCCCTTCATTTTTGG - Intronic
1062202478 9:135311564-135311586 CAAGGCGAGTGGATCATTTGAGG + Intergenic
1187066651 X:15846419-15846441 CAAGGTGAGGTCAATATTTTGGG + Intronic
1188626032 X:32285930-32285952 CAAGGCGGGCACATCATTTGAGG - Intronic
1194189969 X:90822966-90822988 CAAGGAGAGGCCATATATTTAGG - Intergenic
1197204395 X:123777413-123777435 CAAGGTAAGGCCATCAGTTAAGG - Intergenic
1198150342 X:133902488-133902510 CAAGGCGAGGGAATCACTTGAGG + Intronic
1200536569 Y:4405085-4405107 CAAGGAGAGGCCATATATTTAGG - Intergenic