ID: 1092795436

View in Genome Browser
Species Human (GRCh38)
Location 12:12106463-12106485
Sequence CTGGCTCCCCAAATGGGAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 227}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092795436_1092795444 18 Left 1092795436 12:12106463-12106485 CCTTTTCCCATTTGGGGAGCCAG 0: 1
1: 0
2: 3
3: 27
4: 227
Right 1092795444 12:12106504-12106526 TCAAAAGCAACTGTATTTGGGGG 0: 1
1: 0
2: 0
3: 38
4: 309
1092795436_1092795443 17 Left 1092795436 12:12106463-12106485 CCTTTTCCCATTTGGGGAGCCAG 0: 1
1: 0
2: 3
3: 27
4: 227
Right 1092795443 12:12106503-12106525 TTCAAAAGCAACTGTATTTGGGG 0: 1
1: 0
2: 8
3: 50
4: 403
1092795436_1092795441 15 Left 1092795436 12:12106463-12106485 CCTTTTCCCATTTGGGGAGCCAG 0: 1
1: 0
2: 3
3: 27
4: 227
Right 1092795441 12:12106501-12106523 TTTTCAAAAGCAACTGTATTTGG 0: 1
1: 0
2: 4
3: 55
4: 515
1092795436_1092795442 16 Left 1092795436 12:12106463-12106485 CCTTTTCCCATTTGGGGAGCCAG 0: 1
1: 0
2: 3
3: 27
4: 227
Right 1092795442 12:12106502-12106524 TTTCAAAAGCAACTGTATTTGGG 0: 1
1: 0
2: 8
3: 60
4: 531
1092795436_1092795439 -9 Left 1092795436 12:12106463-12106485 CCTTTTCCCATTTGGGGAGCCAG 0: 1
1: 0
2: 3
3: 27
4: 227
Right 1092795439 12:12106477-12106499 GGGAGCCAGAAAATGAGACTAGG 0: 1
1: 0
2: 6
3: 98
4: 922

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092795436 Original CRISPR CTGGCTCCCCAAATGGGAAA AGG (reversed) Intronic
900830403 1:4961245-4961267 CTGGACCCCCAAAGGGGACAGGG + Intergenic
901308595 1:8251375-8251397 CTCGCTCTCCAAATGGGCACCGG - Intergenic
902412329 1:16218655-16218677 CAGGCTCCCCAAATTGTAAGTGG + Intergenic
902453296 1:16513279-16513301 CTGGCACCAGAAATAGGAAAGGG + Intergenic
902473348 1:16665953-16665975 CTGGCACCAGAAATAGGAAAGGG + Intergenic
902475945 1:16687511-16687533 CTGGTTCTCCAACTGTGAAAGGG + Intergenic
902485455 1:16741489-16741511 CTGGCACCAGAAATAGGAAAGGG - Intronic
902499187 1:16896971-16896993 CTGGCACCAGAAATAGGAAACGG - Intronic
903382912 1:22909203-22909225 CTGGCCCACCAGATGGGAGAGGG + Intronic
905234249 1:36534928-36534950 CTGGCTCTCCCAAAGGGACATGG - Intergenic
905908436 1:41636989-41637011 TTTGCTAACCAAATGGGAAAAGG - Intronic
905910245 1:41648479-41648501 CTGGCCCCCCTAGTGGGACATGG - Intronic
906073937 1:43038001-43038023 CAGGCTCCCCACATGTAAAATGG + Intergenic
908177717 1:61572301-61572323 CTGGCTCTCCAAATTTGAAGTGG + Intergenic
908510595 1:64847479-64847501 CTGGCTCCAGAAACGGGAGAGGG + Intronic
912068214 1:105774001-105774023 TTGGATCCCCAAATAAGAAAAGG - Intergenic
912593394 1:110850038-110850060 CTGGCTCCCCAAATTGGGAGTGG + Intergenic
914005394 1:143728568-143728590 CTGGCGCCAGAAATAGGAAAGGG + Intergenic
914096768 1:144550930-144550952 CTGGCGCCAGAAATAGGAAAGGG + Intergenic
914097874 1:144559827-144559849 CTGGCGCCAGAAATAGGAAAGGG + Intergenic
914301117 1:146377786-146377808 CTGGCGCCAGAAATAGGAAAGGG - Intergenic
915333860 1:155129423-155129445 CTTGCTCCCCATCTGGGAAAGGG - Intronic
916916918 1:169417088-169417110 CTGGTTACCAAAATGGGGAAGGG + Intronic
919083388 1:192892048-192892070 CTTGCTCCCCAAGTCAGAAAAGG + Intergenic
919537197 1:198802408-198802430 CTGGTTCCCAGAATTGGAAATGG + Intergenic
921279954 1:213556881-213556903 CTGGCTCCACAAATCTGTAATGG - Intergenic
922479215 1:225927238-225927260 CTGGCTCCCGGAAGCGGAAACGG - Intergenic
923106598 1:230858624-230858646 CTGGCCACCCAAATGGAAAGAGG + Intronic
923575043 1:235150878-235150900 TAGGCTCCCCAAAGGGGAGAAGG + Intronic
924642486 1:245847556-245847578 TTGGCTCCCTACAGGGGAAATGG + Intronic
1065420007 10:25532639-25532661 CTGGCTCTTAAAATGGGGAATGG - Intronic
1065800992 10:29352204-29352226 CTGACTGCAGAAATGGGAAAGGG + Intergenic
1065916997 10:30360791-30360813 CTTGCTACCCTAATGGTAAAGGG + Intronic
1066587076 10:36947326-36947348 CTGGGTCCTCACATAGGAAAAGG - Intergenic
1069674705 10:70239125-70239147 CTGCCACCCCATCTGGGAAATGG - Intergenic
1069818476 10:71213204-71213226 CTGCCTCCCAAAGTGGGCAATGG + Intronic
1070188202 10:74086576-74086598 CTGGCTACCACACTGGGAAAAGG - Intronic
1074153353 10:110778139-110778161 CCGGCTCCCCAAAGGAGAACAGG + Intronic
1075796289 10:125122028-125122050 CTGGCTCCCCAAAAAGCAAAGGG + Intronic
1076140381 10:128073640-128073662 CTCACTCCCAAAAAGGGAAAGGG - Intronic
1076520337 10:131077166-131077188 CTGGCACCCAAAATGGGAGATGG + Intergenic
1077085947 11:750910-750932 CTGGCTGTCCAAATGGAAAGTGG - Intronic
1077456032 11:2681466-2681488 CAGGCTCCCTAGATGAGAAATGG + Intronic
1078097391 11:8308929-8308951 CTGGCTCCTCACATGAGAGAAGG + Intergenic
1078354621 11:10624683-10624705 CTTGCTAACCAAATGGGTAAAGG - Intronic
1078901538 11:15647186-15647208 CTGGCTCCTCATGTGGAAAATGG + Intergenic
1081562049 11:44226688-44226710 CATGCTGCCCAGATGGGAAAGGG - Intronic
1081621408 11:44621214-44621236 CTGGCTCCAGAAATGAGAGAAGG - Intergenic
1083311762 11:61787422-61787444 ATGGGTCCAGAAATGGGAAAGGG + Exonic
1084453033 11:69251293-69251315 CAGCTTCCCCAAATGTGAAATGG + Intergenic
1084536782 11:69762060-69762082 CTGTGTCCCCAAATGACAAAGGG - Intergenic
1085163673 11:74374745-74374767 CTGAGTCCCCAAAGGAGAAAGGG + Intronic
1087183987 11:95167058-95167080 CTGGCTCCCCAAGTCTGATAAGG - Exonic
1090488455 11:127136243-127136265 CTGGCTCCTCAAAGTGGGAAGGG - Intergenic
1091038213 11:132252866-132252888 ATGGATCTCCAAATGGGAAATGG - Intronic
1092795436 12:12106463-12106485 CTGGCTCCCCAAATGGGAAAAGG - Intronic
1093246839 12:16749085-16749107 CTCCCTACCAAAATGGGAAACGG + Intergenic
1093394191 12:18660474-18660496 CTGGCTCTCAAAAGGGGAAAAGG - Intergenic
1094038014 12:26091184-26091206 CTCATTCCCCAAATGGGAAAAGG - Intergenic
1094754937 12:33456792-33456814 CTGGCTTCCAAGAGGGGAAAAGG - Intergenic
1095703857 12:45216932-45216954 TGGGCTCCGCAGATGGGAAAGGG - Intronic
1101433490 12:104645687-104645709 TTGGCTCACCTAATGGGAAAAGG - Intronic
1108101710 13:46964121-46964143 GTTGCTCCCCAAGTGGGAGAAGG - Intergenic
1112773042 13:102812695-102812717 CTGGCTCCCCAAACAGAAAATGG + Intronic
1116862433 14:50005381-50005403 CTGGCTGACCAACTGGGAAGTGG - Intronic
1119408662 14:74414358-74414380 CTGGGTCCCACAATGGGAGAGGG + Intronic
1119415362 14:74466083-74466105 CTGGCTGGCCGAATGGGAAGGGG - Intergenic
1124099615 15:26681370-26681392 CTGCCCCCCCGTATGGGAAAGGG + Intronic
1124716120 15:32063892-32063914 CTGGATCCACAAATGGAGAATGG - Intronic
1124937446 15:34186422-34186444 CTGGCTCCCCAAAGAGCACAGGG - Intronic
1126675475 15:51156552-51156574 CTGTCTCCCCAAAGGAGAAGAGG - Intergenic
1128138326 15:65280864-65280886 TTGGCACCCCAAATGAGAACAGG + Intronic
1129210821 15:74066883-74066905 CTTGCTACCCTAATGGTAAAGGG + Intergenic
1129352241 15:74962858-74962880 CTGGCCCCACAGATGGGGAATGG + Intronic
1129403190 15:75298446-75298468 CTTGCTACCCTAATGGTAAAGGG - Intergenic
1129476673 15:75790571-75790593 CTTGCTACCCTAATGGTAAATGG - Intergenic
1129494393 15:75964115-75964137 CCTGCTTCCCAAAAGGGAAATGG + Intronic
1129728015 15:77911496-77911518 CTTGCTACCCTAATGGTAAAGGG + Intergenic
1130259000 15:82339555-82339577 CTTGCTACCCTAATGGTAAAGGG + Intergenic
1130269675 15:82439565-82439587 CTTGCTACCCTAATGGTAAAGGG - Intergenic
1130462016 15:84166863-84166885 CTTGCTACCCTAATGGTAAAGGG - Intergenic
1130473635 15:84245785-84245807 CTTGCTACCCTAATGGTAAAGGG - Intergenic
1130481050 15:84359849-84359871 CTTGCTACCCTAATGGTAAAGGG - Intergenic
1130490662 15:84427910-84427932 CTTGCTACCCTAATGGTAAAGGG + Intergenic
1130502249 15:84506680-84506702 CTTGCTACCCTAATGGTAAAGGG + Intergenic
1130595919 15:85250386-85250408 CTTGCTACCCTAATGGTAAAGGG - Intergenic
1130843810 15:87725728-87725750 CTGGCTCAGCAAATGGTAGAGGG - Intergenic
1132562945 16:606724-606746 CTGGCTCTGCAGATGGGCAAGGG - Intronic
1132730042 16:1356658-1356680 CTGGCTCCCCAGCTGGGAGGAGG - Intronic
1135930454 16:26731926-26731948 CTAGCTCAGCAAATGAGAAAAGG + Intergenic
1139311995 16:66035192-66035214 CTGGCTTCTGCAATGGGAAATGG - Intergenic
1142660299 17:1424526-1424548 CTACCTGCCCATATGGGAAAAGG - Intronic
1143091982 17:4454279-4454301 CTGTCCCCCAACATGGGAAAGGG + Intronic
1145398790 17:22515131-22515153 CTGGGTCACCATCTGGGAAATGG + Intergenic
1146186724 17:30729074-30729096 CAGTCTCCTCACATGGGAAATGG - Intergenic
1146463274 17:33065053-33065075 CAGGTTCCCCAGCTGGGAAATGG + Intronic
1146673972 17:34760397-34760419 GTGGGTCCCCAAAAGGAAAAGGG + Intergenic
1146738460 17:35260205-35260227 CCGGCTCCCCAAAGGAAAAATGG - Intronic
1146858358 17:36274185-36274207 CTGCCTCACCTAAGGGGAAAAGG - Intronic
1147088677 17:38078248-38078270 CTGCCTCACCTAAGGGGAAAAGG - Intergenic
1147108533 17:38242277-38242299 CTGCCTCACCTAAGGGGAAAAGG + Intergenic
1147110989 17:38261327-38261349 CTGTTTCCTCAAATGTGAAATGG - Intergenic
1148127085 17:45242480-45242502 CTGGCTCCCCATGTGGGCACCGG + Intronic
1148418521 17:47527113-47527135 CTGTTTCCTCAAATGTGAAATGG + Intronic
1148420923 17:47545895-47545917 CTGCCTCACCTAAGGGGAAAAGG - Exonic
1153263853 18:3248452-3248474 CTTTCCCCCCAAATGGGACAAGG - Intronic
1157444509 18:47734729-47734751 CTGGCTCTGCAAGTGGGAACAGG - Intergenic
1158204823 18:54980972-54980994 TTTGCTCCCCAAATAGGAAATGG - Intergenic
1158956082 18:62540285-62540307 ATGGCTCCCCAAATGCAAAGAGG - Intronic
1159045102 18:63362142-63362164 CTTGCTCCCCATATGGGGACTGG - Intronic
1163190227 19:15672266-15672288 CAGGCTTCCCATCTGGGAAATGG - Intergenic
1163202949 19:15781168-15781190 CAGGCTTCCCATCTGGGAAATGG + Intergenic
1163223110 19:15935646-15935668 CAGGCTTCCCATCTGGGAAATGG + Intergenic
1163616323 19:18331005-18331027 CTGGTTCCCCGGATGGGAGAGGG - Intergenic
1164590292 19:29503131-29503153 CTGGAGCCCCTGATGGGAAATGG + Intergenic
1165167443 19:33866785-33866807 CCGGCTCCACAGATGGGCAAAGG + Intergenic
1165283216 19:34815534-34815556 GTGGCTGTGCAAATGGGAAAAGG - Intergenic
1166978759 19:46620726-46620748 CTGGCATCCCAAAGGGGCAACGG - Exonic
1202705536 1_KI270713v1_random:21017-21039 CTGGCACCAGAAATAGGAAAGGG + Intergenic
1202709959 1_KI270714v1_random:13365-13387 CTGGTTCTCCAACTGTGAAAGGG + Intergenic
926108028 2:10164721-10164743 CTGGCCGCCCAGATAGGAAATGG - Intronic
927833946 2:26376127-26376149 AAGGTTCACCAAATGGGAAAGGG - Intronic
928395781 2:30942390-30942412 TTCTTTCCCCAAATGGGAAATGG - Intronic
932085672 2:68756476-68756498 CTGGCTCCCAAAAAGGGAAAAGG - Intronic
933558172 2:83857766-83857788 CTGTGTCCCCACATGGCAAAAGG - Intergenic
935377684 2:102416811-102416833 CTGGCTCCCAAAAGAGGAATCGG + Intergenic
936677100 2:114728221-114728243 CTGGCTCCTCCCATAGGAAAGGG - Intronic
937787797 2:125922912-125922934 CTGGTTCCCCCAGTGGGAAGGGG - Intergenic
937803423 2:126107847-126107869 CCTGTTCCCCAAATGGAAAAAGG - Intergenic
938105866 2:128529374-128529396 CTGGCTCCTCTCATGAGAAATGG + Intergenic
940565846 2:155358858-155358880 CTGGCTCCCAAAAGAGGAAAAGG + Intergenic
948829430 2:240590979-240591001 CTGGCTCCCCTTACTGGAAAAGG + Exonic
1169510854 20:6262236-6262258 CTGGCTCCCCAGCTGGCAGATGG + Intergenic
1169568472 20:6881511-6881533 CTTGGTCCCCAAATGGGAGAGGG + Intergenic
1172664718 20:36591149-36591171 CCAGCTCCCCACGTGGGAAAGGG - Exonic
1175994995 20:62808033-62808055 CTGGCTGGCGAAATGGGGAAGGG + Intronic
1177327783 21:19614743-19614765 CTGTCTCTCTACATGGGAAAAGG - Intergenic
1177647401 21:23917419-23917441 CTGTGACCCCAAATGGGAACAGG + Intergenic
1178231456 21:30789748-30789770 CTGTGTCCCCACATGGCAAAGGG - Intergenic
1179508477 21:41857196-41857218 GAGGGTCGCCAAATGGGAAAAGG - Exonic
1181660277 22:24341819-24341841 CTGGCTCACAACATGGGAACTGG - Intronic
1181687761 22:24541372-24541394 CGGCCTCCCAAAGTGGGAAATGG - Intronic
1183334453 22:37238705-37238727 CAGGCTCCCCATCTGCGAAACGG + Intronic
1184094716 22:42310364-42310386 CTGTCTCCCCCAGTGGGACATGG - Intronic
1184104159 22:42357833-42357855 CTGGCTCCCTAGCTAGGAAACGG - Intergenic
1184289374 22:43490239-43490261 ATGGCTCCCCAAATGGGCAAGGG + Intronic
949271824 3:2225730-2225752 AGGGCACCCCAAATGGGGAATGG - Intronic
949563137 3:5221081-5221103 CTTGCTCCACAGATGGCAAAGGG - Intergenic
949602314 3:5613566-5613588 CTGGTTCCCCACATGGCAAAAGG - Intergenic
952173885 3:30840364-30840386 CTGTCTCCCAAGATGGCAAATGG - Intronic
960167730 3:114422775-114422797 CATTCTCCCCAAATGAGAAATGG - Intronic
962492537 3:135908356-135908378 TTGGCTCCCCAGAAGGGAATTGG + Intergenic
964659783 3:159107302-159107324 CTGTGTCCACAAATGGCAAAAGG - Intronic
965083252 3:164063422-164063444 ATGGCTTCCAAAATGGGAAAAGG + Intergenic
968543542 4:1181912-1181934 CTGGCTTCCAAAAAGGGAAAAGG - Intronic
969519960 4:7671003-7671025 CTGGCTCCCAAAAGGGAAAAGGG - Intronic
972277499 4:37570859-37570881 CTGTCTCCCAAGATGGGAAGGGG + Intronic
972321673 4:37977741-37977763 CAGTCTCCCCAACTGTGAAATGG - Intronic
973260908 4:48162165-48162187 CTGCCTGCCCACATGGGAACAGG + Intronic
977005800 4:91568463-91568485 CTGGCTTCCCAGAAAGGAAAGGG - Intronic
977364607 4:96052206-96052228 AGGGCTCCTAAAATGGGAAATGG - Intergenic
980599295 4:134998652-134998674 CCGGCTTGCCAAGTGGGAAAGGG + Intergenic
982799690 4:159688640-159688662 CTGGCTCCCAAAGAGGGGAAAGG - Intergenic
983923288 4:173370474-173370496 CTGTCTCCACAAATGCGAAACGG + Intronic
986073557 5:4311664-4311686 CTTGCTCCCTACAAGGGAAACGG - Intergenic
986746961 5:10753464-10753486 CTGCCTGCCCAAGTGGGAAGGGG + Intronic
988532719 5:32040472-32040494 CTGCCGCCCCATCTGGGAAATGG + Intronic
988532751 5:32040583-32040605 CTGCCACCCCATCTGGGAAATGG + Intronic
988532847 5:32040931-32040953 CTGCCACCCCATCTGGGAAATGG + Intronic
991697235 5:69284630-69284652 CTGGTACTCCAACTGGGAAAAGG + Intronic
993255665 5:85587704-85587726 CTGCCTCCTCAAGTGGGATAGGG - Intergenic
993818102 5:92578543-92578565 CTGGTTTTCCAAATGGGAAGGGG - Intergenic
994335758 5:98563847-98563869 CTGTTTCCCCATGTGGGAAATGG - Intergenic
996273819 5:121640343-121640365 CTTGCTCTGCAATTGGGAAAGGG + Intergenic
997395595 5:133557446-133557468 GTGGATCCCCAAATGGCAATTGG - Intronic
998494037 5:142571463-142571485 CTGGCTCCCCCAATGGGCCCTGG - Intergenic
998512433 5:142724683-142724705 CTGACTCTCCAAGTGGGAGAGGG + Intergenic
999102630 5:149038963-149038985 CAGTCTCCCCAACTGGAAAATGG + Intronic
999447981 5:151656345-151656367 CTGCCTCCCCACATGAGAACTGG - Intergenic
999634943 5:153612053-153612075 CTGCCTCTCCAAATGTGAGATGG + Intronic
1001068148 5:168556611-168556633 CTGGCTCCTCAAACAGCAAAGGG + Exonic
1001602331 5:172937183-172937205 CTTGCCATCCAAATGGGAAAGGG + Intronic
1002793534 6:452203-452225 CTGTTTCCACAAATGTGAAATGG + Intergenic
1004439986 6:15641131-15641153 CTGGCTCTCCAAGAGGGAAAGGG - Intronic
1007737282 6:43989734-43989756 CTGCCTCCCAAAATAAGAAAGGG - Intergenic
1009312202 6:62169609-62169631 GAAGCTCCCCATATGGGAAAGGG + Intronic
1009366538 6:62861430-62861452 CTTACTTCCCAAATGGGGAAGGG + Intergenic
1011982130 6:93392363-93392385 CTGGCTGCCTCAATAGGAAAAGG + Intronic
1012973499 6:105755854-105755876 CTGCCTCCCTAAAAGGGAGAAGG - Intergenic
1013002545 6:106038476-106038498 CTGGCTCCCAAAAGGGGAAAAGG + Intergenic
1014153245 6:118082987-118083009 GTGGCTCCTCAAAGGGGGAATGG + Intronic
1014986532 6:128017956-128017978 CAGGCTTCCAAAATGGGAAGTGG + Intronic
1015989269 6:138919379-138919401 CTGGCTCTCCTAATGGTAATAGG - Intronic
1018030199 6:159835686-159835708 CTGGCTGCCCAGATGGGGTAGGG + Intergenic
1018185382 6:161261954-161261976 CAGGCTCCCCATCTGTGAAATGG + Intronic
1019331289 7:462058-462080 CTGGACCCACACATGGGAAAGGG + Intergenic
1020173567 7:5864494-5864516 ATTGCTCCCCAAATGAGAGATGG - Intergenic
1020173679 7:5865375-5865397 ATTGCTCCCCAAATGAGAGATGG + Intergenic
1021738586 7:23662906-23662928 CTGGCTTTGGAAATGGGAAAAGG - Intergenic
1021940071 7:25670301-25670323 CTGGCTCTCTAGATGGGAGAGGG - Intergenic
1023860237 7:44213997-44214019 CAGGGTCCTCAAGTGGGAAAGGG - Exonic
1024177220 7:46852881-46852903 CTGGCTCGTACAATGGGAAAAGG + Intergenic
1026869020 7:73839758-73839780 CTGACTCCCAGACTGGGAAAAGG + Intronic
1029085063 7:98005035-98005057 ATTGCTCCCCAAATGAGAGATGG - Intergenic
1029085176 7:98005945-98005967 ATTGCTCCCCAAATGAGAGATGG + Intergenic
1029269526 7:99368735-99368757 CTTCCTCCCCACATGAGAAATGG - Intronic
1029662345 7:101971091-101971113 CAGTCTCCCCAGATGGAAAATGG - Intronic
1030941212 7:115651627-115651649 CTGTGTCTCCAAATGGCAAAGGG - Intergenic
1031621295 7:123937149-123937171 ATGGCTCCCAAAATGTCAAAAGG + Intronic
1031973870 7:128081901-128081923 CTTGCTCCCCCAGAGGGAAACGG - Intronic
1032211981 7:129923904-129923926 CTAGCTCCCCATATTGGACAAGG + Intronic
1032447836 7:131999935-131999957 CTGGCTCCTCACCTTGGAAATGG - Intergenic
1033461274 7:141549652-141549674 GTGGTTCCCCAAATAAGAAAAGG - Intergenic
1034074365 7:148217551-148217573 CTGTCTGCCCAAATGTTAAATGG - Intronic
1034608528 7:152342419-152342441 CTGGCTTACCAAATTAGAAAAGG + Intronic
1034845494 7:154440623-154440645 CTCGCTCCCAAAATGGAAAGTGG - Intronic
1034991564 7:155550874-155550896 CCTGCTCCCCAAAGTGGAAATGG + Intergenic
1035177079 7:157059115-157059137 CTGGGTCCCCCAAGGGGGAAAGG + Intergenic
1035405637 7:158595359-158595381 CTGTTTGCCTAAATGGGAAAGGG - Intergenic
1037231898 8:16669093-16669115 CTGGGTCCCCAAAGGGCAAGAGG + Intergenic
1037784116 8:21892471-21892493 CAGGCTCCCCATCTGGAAAATGG + Intergenic
1040958007 8:52999743-52999765 CTGACTATACAAATGGGAAATGG + Intergenic
1041892850 8:62890760-62890782 CTGTCTACCCAAAAGGGAAGTGG + Intronic
1041940558 8:63382512-63382534 CTGGCTCCCCAAATAAGACAAGG + Intergenic
1043490600 8:80744736-80744758 CTGGCCTCCCCAATGGTAAAAGG - Intronic
1046217579 8:111169663-111169685 CTGGCTCCCCAAAAATGAAATGG - Intergenic
1046427116 8:114068637-114068659 CTAATTCCCCAAATGGAAAAAGG - Intergenic
1046601670 8:116324430-116324452 CTGTTTCTCCAAATGGAAAATGG - Intergenic
1046745127 8:117868254-117868276 GTGGCTCCCCATAAGGGAATAGG - Intronic
1047265936 8:123309355-123309377 CCGGCTCCCCAAAGGGAAAAAGG + Intergenic
1047709590 8:127538426-127538448 CTGGCCCCCAAATTGGGGAAGGG - Intergenic
1047734927 8:127756885-127756907 CTGGCTGTCCAAATTGGGAAAGG + Intergenic
1048299060 8:133238404-133238426 CCCCCTCCCCAAATGAGAAAAGG + Exonic
1048767394 8:137859898-137859920 CTCACTCTACAAATGGGAAAAGG + Intergenic
1050582115 9:7069744-7069766 GTGACTCCCTAAATGGGTAAAGG + Intronic
1052024435 9:23558871-23558893 CTGTGTCCCCACATGGTAAAAGG - Intergenic
1052438119 9:28456946-28456968 GAGGCTCTCCAAATGTGAAAGGG - Intronic
1052692481 9:31833217-31833239 GTGTGTCCCCAAAAGGGAAAAGG - Intergenic
1053147126 9:35719274-35719296 CAGGGTCCCCTAAGGGGAAAAGG + Exonic
1057140832 9:92725934-92725956 CTGATTCCCCATCTGGGAAATGG + Intronic
1057713260 9:97466321-97466343 ATGCCTCTGCAAATGGGAAAGGG - Intronic
1058663994 9:107292747-107292769 CTGGCTACTCATATGGGAGATGG - Intronic
1059651354 9:116318950-116318972 CAGTCTCCCGAAAGGGGAAATGG + Intronic
1188629140 X:32329483-32329505 TTGGCCTCCCTAATGGGAAAGGG - Intronic
1189131252 X:38500161-38500183 CTGGCTACCCAAATTGGAGCTGG + Intronic
1192464427 X:71343956-71343978 CTGGCTTCTCAAAAGGGAAATGG + Intergenic
1192658855 X:73021685-73021707 CTGGCTGCCCATCTGGGAAGTGG - Intergenic
1193348613 X:80431860-80431882 CTGGCTTCTCACATGGGAAAAGG + Intronic
1194965141 X:100279764-100279786 CTGGGTACTCAAATAGGAAAAGG + Intergenic
1196216475 X:113058145-113058167 CTGGGTCCAGAAATGGGAAAAGG - Intergenic
1196623663 X:117853192-117853214 CTGGCTCACCAAATGGCCATTGG + Intergenic
1196708322 X:118736959-118736981 CTGGCTCCCAAAAGTGGAAAAGG + Intronic
1198311711 X:135431138-135431160 CTGGCTTCCAAAAGGAGAAAAGG - Intergenic
1198692915 X:139303561-139303583 CTGCCACCCCAAATGGAAAAAGG - Intergenic
1200211974 X:154350756-154350778 TTGGGTCACCAATTGGGAAAGGG + Intronic
1201511153 Y:14764698-14764720 CTGTGTCCCCACATGGGAAAAGG + Intronic
1202377262 Y:24248289-24248311 CTTGCTACCCTAATGGTAAAGGG + Intergenic
1202493518 Y:25421832-25421854 CTTGCTACCCTAATGGTAAAGGG - Intergenic