ID: 1092796795

View in Genome Browser
Species Human (GRCh38)
Location 12:12119267-12119289
Sequence AAGGATTCAGAATTTGGGCA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 329
Summary {0: 1, 1: 1, 2: 5, 3: 28, 4: 294}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092796795_1092796805 23 Left 1092796795 12:12119267-12119289 CCTTGCCCAAATTCTGAATCCTT 0: 1
1: 1
2: 5
3: 28
4: 294
Right 1092796805 12:12119313-12119335 CCTGAAACCCAGAGAGGCCTTGG 0: 1
1: 0
2: 6
3: 40
4: 390
1092796795_1092796802 17 Left 1092796795 12:12119267-12119289 CCTTGCCCAAATTCTGAATCCTT 0: 1
1: 1
2: 5
3: 28
4: 294
Right 1092796802 12:12119307-12119329 TTGGGCCCTGAAACCCAGAGAGG 0: 1
1: 0
2: 1
3: 21
4: 232
1092796795_1092796799 -2 Left 1092796795 12:12119267-12119289 CCTTGCCCAAATTCTGAATCCTT 0: 1
1: 1
2: 5
3: 28
4: 294
Right 1092796799 12:12119288-12119310 TTTCTTCCACTGTTTTCTCTTGG 0: 2
1: 1
2: 8
3: 86
4: 753
1092796795_1092796800 -1 Left 1092796795 12:12119267-12119289 CCTTGCCCAAATTCTGAATCCTT 0: 1
1: 1
2: 5
3: 28
4: 294
Right 1092796800 12:12119289-12119311 TTCTTCCACTGTTTTCTCTTGGG 0: 1
1: 0
2: 4
3: 60
4: 611

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092796795 Original CRISPR AAGGATTCAGAATTTGGGCA AGG (reversed) Exonic
900668972 1:3837784-3837806 AAGGAATGAGCATTTGTGCATGG + Intronic
902214477 1:14925358-14925380 AAGTATTCAGAACTTGGACCTGG - Intronic
903250349 1:22048861-22048883 ATGGATTGAGAGTTGGGGCAGGG + Intergenic
903990255 1:27262677-27262699 AAGGATTCAGGGGCTGGGCATGG - Intronic
904455836 1:30647559-30647581 GAGGAGTGAGAATGTGGGCAAGG - Intergenic
905521916 1:38607051-38607073 CATGATTCTGCATTTGGGCAGGG - Intergenic
905612371 1:39365369-39365391 AAAGTTTCAGATTTTGGGCTGGG - Intronic
905756514 1:40514674-40514696 AGGGATTCAGAAGATGGGCCAGG - Exonic
906262030 1:44400327-44400349 AAACATTCAGAAATTGGGCTGGG - Intergenic
906451466 1:45952194-45952216 AAGGATTAACAATTGTGGCATGG + Intronic
907964785 1:59318529-59318551 AAGGAATCAGAATGTGGGTAGGG + Intronic
908612680 1:65880241-65880263 AAGGACTCAGAATTTAGACAAGG + Intronic
911182631 1:94874886-94874908 AATTATTCAGAACTTGGACAAGG - Intronic
912351835 1:109021334-109021356 AAGGTTTCACCATTTTGGCAAGG - Intronic
912904886 1:113693913-113693935 CAGAATTGAGAATTTGGGGAAGG + Intergenic
913711482 1:121488388-121488410 AAGGAGTCAGCATGTTGGCAAGG + Intergenic
915556361 1:156663110-156663132 AAAGACTCAGAAATTGGGAAGGG + Intergenic
917002388 1:170374409-170374431 ATGAATTAAGACTTTGGGCAGGG - Intergenic
917683377 1:177391314-177391336 ATTGATTCAGAATTTAGGAAGGG - Intergenic
917684006 1:177397399-177397421 AAGGACTCAGAATTAAGGAAAGG - Intergenic
920416586 1:205802871-205802893 AAGGATGTAGAGTTTGGGCTGGG + Intronic
920902269 1:210122271-210122293 AAAGTTTCAGGATTTGGGCCGGG - Intronic
921264669 1:213412299-213412321 AAGGCTTCACATTTAGGGCAAGG + Intergenic
921872395 1:220155013-220155035 AAGGATTCAGAGGCTGGGCGCGG - Intronic
923044223 1:230343652-230343674 GTGGATTCAGAAGCTGGGCAGGG - Intronic
923050988 1:230391301-230391323 AAAGATTCAGAAATTGCGCATGG + Intronic
923910960 1:238443145-238443167 AACGATTCACCAATTGGGCAAGG + Intergenic
1063104464 10:2981030-2981052 AATGATTCAGAGGCTGGGCATGG + Intergenic
1064617531 10:17176976-17176998 AAGGAGGCAGAATTTGGGAAAGG + Intronic
1065905099 10:30243553-30243575 CAGTATCCAGAATTTGGGCCAGG - Intergenic
1067421242 10:46151037-46151059 AAGAATTCAGCCTTTGAGCAGGG - Intergenic
1067491093 10:46703696-46703718 AAGAATTCAGCCTTTGAGCAGGG - Intergenic
1067506580 10:46857496-46857518 AAGAATTCAGCCTTTGAGCAGGG - Intergenic
1067534987 10:47102517-47102539 AAGGGTTCAGAAGTGGGGCTGGG - Intergenic
1067603573 10:47636670-47636692 AAGAATTCAGCCTTTGAGCAGGG + Intergenic
1068543189 10:58319165-58319187 AAGGCTTAAGACTTTGGGCGAGG - Intergenic
1070035134 10:72714839-72714861 AAGTATTAAATATTTGGGCAGGG - Intronic
1071733920 10:88276951-88276973 TAGGATCCAGAATTTATGCAAGG - Intronic
1073750395 10:106519757-106519779 ACTGATTCAGAATTTGGACAGGG + Intergenic
1074656472 10:115594397-115594419 AAGGACTCAGAATTTGAGTTAGG + Intronic
1075304249 10:121353957-121353979 CAGGATTCTGAATTTTGGCCAGG + Intergenic
1075841002 10:125503208-125503230 AAGGATTAAGAATATGGTAAGGG + Intergenic
1077159414 11:1105915-1105937 CAGAATTCAGAATTTGTGGAAGG - Intergenic
1077632450 11:3819983-3820005 AATGATACAGAGTTTGGGGAAGG - Intronic
1078024652 11:7683279-7683301 AAGGTATCAGAATTTGGGGTCGG - Intergenic
1079607014 11:22382538-22382560 AATGATGCTGAATATGGGCAGGG - Intergenic
1086429189 11:86718889-86718911 AGGGATTTAGGATTTGGGAAGGG - Intergenic
1086433771 11:86761781-86761803 AAGAAGTGAAAATTTGGGCAAGG - Intergenic
1087461424 11:98453489-98453511 AAAGATGCAGAGTTTGGCCAGGG - Intergenic
1087462018 11:98457142-98457164 AATGATACAGAAGTTGGGTAGGG - Intergenic
1087842257 11:102932603-102932625 AAGGATTAAGACTTTGGACCTGG - Intergenic
1088835446 11:113574731-113574753 ATGGATCAAGAATTTGGACAGGG + Intergenic
1089412277 11:118255634-118255656 AAGGCTTCAGAATTAGGTGATGG - Intronic
1090187697 11:124749024-124749046 AAGGATTCAGAAACTGGCAATGG + Intronic
1092144472 12:6205014-6205036 CAGGATTCCGGATCTGGGCAGGG + Intronic
1092796795 12:12119267-12119289 AAGGATTCAGAATTTGGGCAAGG - Exonic
1093151932 12:15631930-15631952 AAGAAAACAGAATTTGGGCTTGG + Intronic
1093757671 12:22870645-22870667 AAGGTTTCAGAATTTGGAAGGGG - Intergenic
1096001000 12:48130500-48130522 AAGGACACAGAATGTGGGAAGGG - Intronic
1097131143 12:56811429-56811451 AATGACACAGAATTTGGCCAGGG - Intergenic
1097763651 12:63498246-63498268 AAGGATACAAAATTTGAGCTAGG - Intergenic
1098361795 12:69661622-69661644 AAGGATTTATAAAATGGGCAAGG + Intronic
1098786296 12:74760915-74760937 AAGGCTTCTGAGTTTGAGCATGG - Intergenic
1098797259 12:74906011-74906033 AAGGTTTCAGAAGTTGGAAAGGG - Intergenic
1099188166 12:79538404-79538426 ACGGATGAAGAATTTGGGGAAGG - Intergenic
1100524958 12:95410538-95410560 AAGGATTAAGAATAAGGGCCGGG + Intergenic
1102023812 12:109701769-109701791 AAGAATTTGGAATTTGGGCTGGG + Intergenic
1102069028 12:110002073-110002095 AAGAATACAGGATTTGGGCAAGG - Intronic
1102538177 12:113597613-113597635 AAATATTCAGAATGTGGACAAGG + Intergenic
1103230865 12:119329228-119329250 GAGGAGTCACAATTTTGGCAAGG + Intergenic
1105627723 13:22129445-22129467 ATAGATTTATAATTTGGGCAGGG + Intergenic
1107505998 13:41033889-41033911 AGGGATACAGATTTTGGGGAGGG + Intronic
1108143539 13:47451989-47452011 AGGCATTCAGGATATGGGCATGG + Intergenic
1108513889 13:51179239-51179261 AAGGATTTATAATTTGTTCAAGG - Intergenic
1111314951 13:86543247-86543269 AATGATTTCAAATTTGGGCAAGG + Intergenic
1113022575 13:105904704-105904726 AAGGACTCATAATTTTGGGAAGG - Intergenic
1115802552 14:37011303-37011325 AAGGATTTAGAATTTAGGTCAGG - Intronic
1116900036 14:50352862-50352884 TAGTACTCAGAATTTGGGTATGG - Intronic
1118859060 14:69647687-69647709 AAAGAATCAGGATTTGGGCTGGG + Intronic
1119769915 14:77214095-77214117 AAGGTTTCAGGAGTTGGGGAGGG - Intronic
1119905204 14:78295668-78295690 AATGAATCAGAATTTTGGGAAGG - Intronic
1120252646 14:82077857-82077879 AAGGATTCAAAAATGTGGCAGGG + Intergenic
1120655272 14:87181756-87181778 AAGGATTCTTGATTTGGGGATGG - Intergenic
1121431309 14:93890332-93890354 AAGAACTCAGAAGTTGGACAAGG + Intergenic
1121997187 14:98612286-98612308 AAGGGTTCAGAAATTCGCCAAGG + Intergenic
1122593221 14:102870573-102870595 AAGGATTCACAAGCTGGGCCCGG - Intronic
1122680635 14:103459284-103459306 AAGGCTTCAGAATTTCTGCAGGG - Intronic
1124107570 15:26754437-26754459 AAGGAGTAAGAATTAGGGTAGGG + Intronic
1125107169 15:35985768-35985790 AAGAATTCAGAATTTGCACTTGG - Intergenic
1125232408 15:37471204-37471226 AAAGATTCACCATTTGTGCAAGG - Intergenic
1126103336 15:45132890-45132912 AAGGTTCAAGACTTTGGGCAGGG - Intronic
1126374727 15:47985761-47985783 AAGGTTTCATAATGTGGGTAAGG - Intergenic
1126712256 15:51472131-51472153 AAGGATTCAGGAATTGGGTATGG + Intronic
1127577184 15:60303292-60303314 AAGGATGCTGAAGTTGGGCATGG - Intergenic
1129794533 15:78366153-78366175 AAGGGATCTGACTTTGGGCAAGG - Intergenic
1130433112 15:83868968-83868990 CGGGATGCAGAATTGGGGCAAGG - Intronic
1130886796 15:88099895-88099917 AAGGCTTCAGGATTTGGGGAGGG + Intronic
1132104256 15:99051385-99051407 AAAGGTGCAGAAATTGGGCAGGG - Intergenic
1134169181 16:11955077-11955099 AAGATTTCAGAATTTAGGCTGGG + Intronic
1135341954 16:21656058-21656080 AAGGCTTCAGACTTGGGGGAAGG + Exonic
1137303672 16:47179805-47179827 AAGAACTCAGCATTTGAGCATGG - Intronic
1138128347 16:54457056-54457078 AAGGACTCAGAGTTTGGCCGGGG - Intergenic
1142392288 16:89809552-89809574 AAAGATACAAAAATTGGGCAGGG + Intronic
1143278696 17:5733908-5733930 AAGGATGCAAAAGATGGGCAAGG + Intergenic
1143819750 17:9550777-9550799 AAGGCTTAAGAATTTAGGCTGGG + Intronic
1144287969 17:13798003-13798025 TAGGATTGAGTGTTTGGGCATGG + Intergenic
1147311882 17:39600306-39600328 CAGGATTCAGAACCGGGGCAGGG + Intergenic
1147892322 17:43726094-43726116 GAGGTTTAAGAATTTGGCCAGGG - Intergenic
1149208559 17:54277519-54277541 AAGGATTGATAATTTGGGCAAGG + Intergenic
1150602993 17:66666710-66666732 AAAGAGTCAGATTTTGGGGAAGG - Intronic
1151314808 17:73315230-73315252 AAGGAGCCTGAATTTGGGTAAGG - Intergenic
1152145033 17:78563187-78563209 GAGAAATCAGAATTTGGGTAAGG - Intronic
1152669498 17:81593920-81593942 AAGGGTTGGGAATTTGGGCTAGG - Intronic
1153142267 18:1986660-1986682 TATGATTCAGAATATAGGCATGG + Intergenic
1153713052 18:7819454-7819476 AATGACGCAGAATTTGGCCAGGG + Intronic
1155372536 18:25117129-25117151 TATGGTTCAGAATTTGGTCAGGG + Intronic
1155420621 18:25651739-25651761 GTGGTTTAAGAATTTGGGCAGGG + Intergenic
1157502792 18:48202872-48202894 AAGGGCTCAGGAGTTGGGCATGG + Intronic
1157558207 18:48627426-48627448 TAGGAGTGAGGATTTGGGCAAGG + Intronic
1158071711 18:53478098-53478120 AAGGATACAGAATTGGGGCAAGG + Intronic
1158255327 18:55540186-55540208 AAGATTTCAGAATTTTTGCAAGG + Intronic
1158979782 18:62748539-62748561 AACTATTCCGAATTTGGGCGGGG - Intronic
1160188526 18:76695571-76695593 AAAGAATCAGGATTTGGGCCGGG - Intergenic
1160286852 18:77550981-77551003 ATTGGTTCAGAATTTGGACAGGG - Intergenic
1161257617 19:3318258-3318280 AAGGATTCAAAATGTGGGGCTGG + Intergenic
1163593082 19:18205079-18205101 AGGAAGTCAGAATTTGGGGAGGG + Intergenic
1163700563 19:18784704-18784726 AATGTTTGAGAATTTGTGCAAGG + Intronic
1164448807 19:28341382-28341404 GAAGATTCAGCATTTGGGGAGGG + Intergenic
1164917215 19:32061450-32061472 AAGAAATCAGCATTTTGGCAAGG + Intergenic
1165326708 19:35118390-35118412 ATGCACTCAGCATTTGGGCAGGG + Intronic
925321574 2:2974232-2974254 AAGGATTCAGTGTTGGGGCTGGG - Intergenic
925649486 2:6074097-6074119 AATGATTTGGAATTTGAGCAAGG + Intergenic
926944619 2:18173581-18173603 AAAAATTAAGGATTTGGGCATGG - Intronic
928310486 2:30205535-30205557 CAGGATTCAGGACTGGGGCAAGG - Intergenic
928940782 2:36725372-36725394 ATGGATTCAGAGTCTGGTCAGGG + Intronic
929134506 2:38610364-38610386 TAAAAATCAGAATTTGGGCAGGG + Intergenic
930807350 2:55504047-55504069 AAAGTTTCAGAATTTGGGTGGGG + Intergenic
931095494 2:58935648-58935670 CAGGAATCAGAATTTAGGCCAGG - Intergenic
932015621 2:68023814-68023836 AAGGACTCTGAACTTGGACATGG + Intergenic
933148287 2:78883685-78883707 AAAGATTCAGTCTTTAGGCAGGG - Intergenic
933932672 2:87169933-87169955 ATGGCTTTAGAATTGGGGCAGGG - Intergenic
933971936 2:87476936-87476958 AAGGAGGCAGCATTTGGACAAGG + Intergenic
934720409 2:96571321-96571343 AAGAATCCACAATTTAGGCAAGG - Intergenic
934863750 2:97787733-97787755 GAGAATTCAGAATTTTGGAAAGG - Intronic
934957050 2:98631610-98631632 AATGACGCAGAATTTGGCCAGGG + Intronic
935563722 2:104584830-104584852 AAGGATCTAGAAGTTGTGCAGGG + Intergenic
935660359 2:105461446-105461468 AAAGATGCAGAGTTTGGGCATGG + Intergenic
936246009 2:110827822-110827844 AAGCAATCAGCATTTGTGCAGGG - Intronic
936321791 2:111473261-111473283 AAGGAGGCAGCATTTGGACAAGG - Intergenic
936329600 2:111536400-111536422 AAGCATTCAGCAGGTGGGCATGG - Intergenic
936360438 2:111795509-111795531 ATGGCTTTAGAATTGGGGCAGGG + Intronic
937757082 2:125552695-125552717 CAAGATTAAGAATTTGGCCAAGG + Intergenic
937804568 2:126123888-126123910 AAGGATAGATAATTTGGGCGGGG - Intergenic
937953480 2:127406077-127406099 AAGAATTCCGAATTGGGGCCGGG + Intergenic
938698978 2:133859446-133859468 AAGCATTCAGAATCTGGGTTGGG + Intergenic
940850295 2:158681969-158681991 AAGGCCTCAGACTTTGGGCCTGG - Intronic
940952551 2:159692558-159692580 AAGTCTGCAGAATCTGGGCATGG + Intergenic
943500243 2:188680053-188680075 AAGAACTCAGCATTTGAGCATGG + Intergenic
944318187 2:198306005-198306027 AATGTTTTAGAATGTGGGCATGG - Intronic
944781878 2:203027172-203027194 AAGGTATCAGAATTCAGGCAAGG + Intronic
944866920 2:203871386-203871408 AGGAAGTCAGAATCTGGGCACGG - Exonic
946076509 2:217077988-217078010 ATGGATCAGGAATTTGGGCAAGG + Intergenic
947504500 2:230696778-230696800 AAGGATTGACAATTTGGGCAAGG + Intergenic
947601965 2:231457599-231457621 AAGGTTTCAGAATTGGTGGAGGG - Intronic
1169635588 20:7688178-7688200 AAGGATTCAGCATCTGGTGAGGG - Intergenic
1170140235 20:13118587-13118609 TAGGTGTCAGAATTTGGACAAGG - Intronic
1170598000 20:17819953-17819975 ATGGATTGGGAATCTGGGCAGGG + Intergenic
1171141771 20:22749748-22749770 GAGGAAGCAGAATTTGGCCAAGG + Intergenic
1171171272 20:23017515-23017537 AAAGAATAAGAATGTGGGCATGG - Intergenic
1171446719 20:25209689-25209711 AAAGAGTCAGAATTTAGACAAGG + Intronic
1172566582 20:35935338-35935360 AAGGCTTCAGAATATGGGCCAGG - Intronic
1172813523 20:37668794-37668816 AAGAATTCAGGTTTTGGGCCCGG + Intergenic
1173140350 20:40476396-40476418 AAGTATTCAGAATGTGTTCATGG - Intergenic
1175005117 20:55673757-55673779 AAGGAATCATAAGTTAGGCAAGG - Intergenic
1175063610 20:56266488-56266510 AGGGATGCAGAATTTTGGTAAGG - Intergenic
1175198459 20:57262602-57262624 AAGCCTTCAGAATTCAGGCAAGG + Intronic
1177959830 21:27649647-27649669 ATGGAGGAAGAATTTGGGCAGGG + Intergenic
1178590253 21:33903546-33903568 CAAGATTCAGAAGCTGGGCAGGG - Exonic
1179347385 21:40571883-40571905 AAAGCTTCAGATTTTGGGCCAGG - Intronic
1179580671 21:42341737-42341759 AAAGAGTCAGAATTTTGGCCAGG - Intergenic
1182196819 22:28527532-28527554 AAGGTTTCAGACATTGGGGAAGG + Intronic
1182917172 22:34045035-34045057 TAGAATTCAGAAAATGGGCATGG - Intergenic
1184541231 22:45126643-45126665 ACGGATTCAGTATCTGGGGAGGG + Intergenic
1184926726 22:47646903-47646925 AAGGGTCAAGAATTTGGCCATGG + Intergenic
1185112781 22:48911329-48911351 AAGATTTCAGAATCTGGGCGGGG - Intergenic
1185112872 22:48911893-48911915 AAGATTTCAGAATCTGGGCGGGG - Intergenic
1185390725 22:50560191-50560213 AAGATTACAGTATTTGGGCATGG + Intronic
949591083 3:5495020-5495042 AAGGATTGACAATTTAGTCAGGG - Intergenic
949643390 3:6065666-6065688 AAGGAGTCACATTTTGGGAAAGG + Intergenic
949673849 3:6429875-6429897 AAGGTTTTAGAACCTGGGCAAGG + Intergenic
949889492 3:8723081-8723103 AAGGATTGTGAATGTGGGCCTGG - Intronic
950565693 3:13768376-13768398 AGGGCTTCAGAAGTTTGGCATGG + Intergenic
950984070 3:17341489-17341511 AAGAATTCAGATTTTAGGCCAGG - Intronic
953042921 3:39270703-39270725 AAGGATTGAGGATATGGGAAAGG + Intronic
955486200 3:59437414-59437436 AGGGATTCACAATGTTGGCAAGG + Intergenic
955533379 3:59898060-59898082 AAAGTTTCAGATTTTGGGCTGGG - Intronic
955947903 3:64213025-64213047 AAGGATTAAAAACTTGGTCAAGG - Intronic
956295971 3:67714005-67714027 AAGGCTTAAGAATTCAGGCACGG - Intergenic
959269810 3:104192749-104192771 AATGATACAGAAAGTGGGCAGGG - Intergenic
959811089 3:110620318-110620340 AAGGATTCAGCAGCAGGGCAAGG + Intergenic
960650237 3:119939932-119939954 AAGGATTGAGAATATGGCCCAGG + Intronic
960891336 3:122451786-122451808 CAGAATTCAGAATTTTGGCATGG + Intronic
962034108 3:131632715-131632737 AAGGACTCAGCTTTGGGGCATGG - Intronic
964081884 3:152768741-152768763 AAGTATTCTAAATTTGGGCGGGG + Intergenic
965683767 3:171279600-171279622 AATGGTTCATAATTTGGTCAGGG + Intronic
966053456 3:175651742-175651764 AAGGCTTTATAATTTGTGCAGGG + Intronic
967289169 3:187902413-187902435 AATGAGTCAGAATGGGGGCAGGG + Intergenic
967412635 3:189181980-189182002 AAAGAAAGAGAATTTGGGCAGGG + Intronic
967563687 3:190948044-190948066 AAAAATTCAGAATTTGGGCTGGG - Intergenic
967600610 3:191383245-191383267 AAGGATTCAAGATTTTGTCAAGG - Intronic
968052242 3:195663040-195663062 GAGGATTCAGAATTTAGGTTGGG + Intergenic
968103568 3:195985298-195985320 GAGGATTCAGAATTTAGGTTGGG - Intergenic
968301870 3:197622891-197622913 GAGGATTCAGAATTTAGGTTGGG - Intergenic
969252108 4:5974721-5974743 CAGGACACAGAATTTGGTCAAGG - Intronic
969927798 4:10601471-10601493 TAGGATTCAGATTTAGGGCAGGG - Intronic
970306280 4:14735491-14735513 AAGGACTCAGAAGTTGGTCAAGG + Intergenic
971356057 4:25896234-25896256 GGTGATTAAGAATTTGGGCATGG - Intronic
971395772 4:26225954-26225976 AAGGTTTCAGCATGTTGGCAAGG - Intronic
972388546 4:38591136-38591158 ATGGATCAAGAATTTAGGCAAGG + Intergenic
972917852 4:43903297-43903319 AAGGAGGCAGAGTTTGGCCAGGG + Intergenic
973789429 4:54364654-54364676 AAAAATTCAAAAATTGGGCATGG + Intergenic
973956946 4:56071830-56071852 AAAGTTTCAGAATTGGGGCCGGG + Intergenic
975181031 4:71345316-71345338 ATGAATAAAGAATTTGGGCAGGG - Intronic
976368082 4:84253484-84253506 AAGGATACTGGATTTGGGCCAGG + Intergenic
976662249 4:87551768-87551790 AAGGAGAAAAAATTTGGGCAGGG - Intergenic
976910646 4:90301212-90301234 AATGATTCATAATTTGGATATGG - Intronic
977041144 4:92020740-92020762 AAGGATTGACAACTTGGACAAGG - Intergenic
977280855 4:95038031-95038053 GAGGATTGAGAGTTTGGGAATGG + Intronic
984712831 4:182900017-182900039 AAGGTTTCAGATTTTGGGCCAGG + Intronic
986071319 5:4287586-4287608 AAATATTCTGAATTTGAGCAAGG + Intergenic
987710890 5:21499652-21499674 AAGAATTCAGAACTGGGGCTGGG - Intergenic
987760819 5:22161053-22161075 AAAGCTTCAGGATTTGGGCAAGG - Intronic
987822537 5:22984532-22984554 AAGAATTCAGTAGTTGGGCTGGG + Intergenic
987824401 5:23009865-23009887 AAGCATTGAGATTATGGGCATGG + Intergenic
988267213 5:28967625-28967647 AATGACTCAGAGTTTGGCCAGGG + Intergenic
988334358 5:29886745-29886767 TAGGATACAGAATTTGGGGGAGG + Intergenic
988567198 5:32328952-32328974 AAGAATTCAGAAAGAGGGCAGGG - Intergenic
989499098 5:42145117-42145139 AGGGATTCAGCTTTTTGGCAGGG - Intergenic
989752549 5:44913237-44913259 GTGGATTAAGAATTTGGACAGGG + Intergenic
990536319 5:56726656-56726678 AAGGATTGAGAATTAGGTCCAGG + Intergenic
991337126 5:65561638-65561660 AAGGATACAAAATGTGGGAACGG - Intronic
991621304 5:68548137-68548159 AAGGATTTAAAATTTTGGCAGGG - Intergenic
991761230 5:69918712-69918734 AAGAATTCAGAACTGGGGCTGGG - Intergenic
991786099 5:70199388-70199410 AAGAATTCAGAACTGGGGCTGGG + Intergenic
991840458 5:70793763-70793785 AAGAATTCAGAACTGGGGCTGGG - Intergenic
991878543 5:71199776-71199798 AAGAATTCAGAACTGGGGCTGGG + Intergenic
991895597 5:71394506-71394528 AAAGCTTCAGGATTTGGGCAAGG - Intergenic
993772258 5:91944000-91944022 AATGATACAGAATTTAGTCATGG - Intergenic
995860789 5:116638171-116638193 ACTGGTTCAGAATTTGGGCAGGG + Intergenic
997641824 5:135454109-135454131 AAGGATTCTTTATCTGGGCATGG - Intergenic
999864725 5:155688173-155688195 AGGGAGTCAGAATTGGGGGAGGG + Intergenic
999992491 5:157062210-157062232 AATGATTCAGAACATGGGCCGGG + Intergenic
1000307610 5:160009646-160009668 AATAAATCAGAATTTGGTCAGGG + Intronic
1002347042 5:178555336-178555358 AAAGTCTCAGAATTGGGGCATGG - Intronic
1003205871 6:4010836-4010858 AAGGATTCAGAATTCGGGCATGG - Intergenic
1003292006 6:4787961-4787983 AAGGATTCACCATTTTGGCCAGG + Intronic
1005087768 6:22024452-22024474 AAGGATGCAGAAGATGGGAAAGG - Intergenic
1007238520 6:40408424-40408446 AAGGAGACAGCATTTGGGGAGGG + Intronic
1007307565 6:40918839-40918861 AAGGACGCAGAGTTTGGCCAGGG + Intergenic
1007742144 6:44018767-44018789 ATGGTTTGAGAATTTTGGCAGGG - Intergenic
1008838305 6:55865629-55865651 AATGTTTCAGAATTTCAGCAAGG + Intronic
1009017555 6:57921929-57921951 AAGAATTCAGAACTGGGGCTGGG + Intergenic
1009361501 6:62819814-62819836 AAGGAGTCAGGATGTTGGCATGG + Intergenic
1009399708 6:63239827-63239849 AGGGAGTGAGAATTTGGGAAAGG + Intergenic
1009720915 6:67468130-67468152 AAAGACACAGAATTTTGGCAGGG - Intergenic
1011150279 6:84264587-84264609 AAGACTTCAGAATTTGGCCATGG - Intergenic
1011325799 6:86149085-86149107 AATGATACAGAATTGGGGAAGGG - Intergenic
1012824350 6:104127891-104127913 ATGGATTCAAAATTTGGATATGG - Intergenic
1014112283 6:117632180-117632202 AAGAATTCAGAATTTCAGCAAGG - Intergenic
1015103654 6:129510726-129510748 GAGGAATCAGCATTTGAGCAAGG + Intronic
1018638714 6:165887403-165887425 ATGGCTTCAGAAGTTGGGGACGG - Intronic
1018727014 6:166620834-166620856 AAGGATTCAGTGGTTTGGCAAGG + Intronic
1018976327 6:168570183-168570205 AAATATTCAGAAATTGGCCATGG + Intronic
1020794096 7:12661162-12661184 AAGGACTCAGAACTTGGGGGTGG - Intergenic
1021240332 7:18192599-18192621 AAGGATATAGTATTTGGGGATGG + Intronic
1021931674 7:25587037-25587059 AAGAATTCATAATTTAGGAAAGG - Intergenic
1022864172 7:34400050-34400072 AGGGATCCAGAATTTGGGCAGGG + Intergenic
1024176349 7:46844700-46844722 AATGATTCAGAATTGTGGCAGGG - Intergenic
1025056376 7:55768636-55768658 AAAGATTCAAAAGCTGGGCACGG - Intergenic
1025116858 7:56265494-56265516 AAGGATTCACAAGTTAGGCTGGG - Intergenic
1026444224 7:70470182-70470204 AAGACTTCAGAGATTGGGCAGGG - Intronic
1026632049 7:72046015-72046037 AAGGATTCAGAACTAAGGCCAGG + Intronic
1028531718 7:91845673-91845695 TAGGATCCTGAATATGGGCAAGG + Intronic
1030137220 7:106266279-106266301 AAGGATACTGTATGTGGGCAAGG - Intronic
1030823090 7:114119553-114119575 AAAAATTAAAAATTTGGGCAAGG + Intronic
1031558070 7:123202963-123202985 AAGGATTGGGGATTTGTGCAAGG - Intergenic
1032254057 7:130283123-130283145 AAGGATTCAGAACCTGCACAAGG - Intronic
1033652236 7:143352112-143352134 GAGGAATCAGCATTTAGGCAGGG + Intergenic
1034358252 7:150471178-150471200 GAGGAGTCAAAACTTGGGCAGGG - Intronic
1034926307 7:155125073-155125095 AAGGATCCAGGTTTTGGGAATGG + Intergenic
1036390427 8:8319722-8319744 AAGGATACAGAATCATGGCATGG + Intronic
1038216243 8:25564235-25564257 AAGGTTTCAGCAGCTGGGCATGG - Intergenic
1038275430 8:26117115-26117137 GAGGATCAGGAATTTGGGCAAGG - Intergenic
1040400752 8:47046770-47046792 AAGGATTCAGAACTTGGCTGAGG + Intergenic
1040479230 8:47808628-47808650 AAGAATTTTGAAGTTGGGCATGG - Intronic
1041136986 8:54769363-54769385 CAGGTTTCAGATTTTGAGCATGG - Intergenic
1041240850 8:55847970-55847992 AAGAATTCAGACTGTGGGCCGGG - Intergenic
1042982424 8:74545366-74545388 AAGGATTCAGGAAATGGGCAGGG - Intergenic
1043917280 8:85937615-85937637 AAGGGTTCAGAACTTGGGCAGGG - Intergenic
1044446064 8:92277453-92277475 ATGGATCCAGAATTTGTGCAGGG - Intergenic
1044609229 8:94076016-94076038 AAAGATTCAGAACTTTGGTACGG - Intergenic
1044739642 8:95313064-95313086 ATGAATCCAGAATTTGGGGAAGG + Intergenic
1045177986 8:99746854-99746876 AATGGTCCAGAATTGGGGCAAGG - Intronic
1045677244 8:104620786-104620808 AAGGATTGTGAATGTGGGTAAGG + Intronic
1046638143 8:116695644-116695666 AAGGAGTCAGCATCTGAGCAGGG + Intronic
1047012702 8:120689379-120689401 GATGATTCAGAAATTGGGCTTGG + Intronic
1047041245 8:120998676-120998698 AAGGACTAAGAATTTGGCCAAGG - Intergenic
1051220466 9:14843308-14843330 AAGGCTTGAGAAGATGGGCAAGG - Intronic
1054959471 9:70951635-70951657 AAGGATTCATAATTCTGGCCAGG - Intronic
1054961488 9:70975058-70975080 AAGGTTTCAGCATGTTGGCAAGG + Intronic
1058952842 9:109919541-109919563 GAGGATTCAGGATTAGGGAAGGG + Intronic
1059867193 9:118528725-118528747 AAGAATTCAGGCTTTGGGCCAGG - Intergenic
1060157907 9:121332757-121332779 AAGGACTCTGAATTTTTGCAGGG - Exonic
1186384536 X:9095302-9095324 AGAGATGCAGAATTTTGGCAGGG + Intronic
1186553477 X:10532138-10532160 AAGGATTCAGAAGTTGAACAAGG - Intronic
1186639554 X:11440936-11440958 CAGCATTCAGCACTTGGGCATGG - Intronic
1187980326 X:24749637-24749659 AAGGATTAAGAATTCTGTCATGG + Intronic
1187981051 X:24757732-24757754 AAAGTTTCAGAGTTTGGGCTGGG - Intronic
1188021347 X:25161981-25162003 AAGGATTCAGGAATTAGGCCAGG - Intergenic
1188539688 X:31235925-31235947 AAGGAGAAAGAATTTGGGAAGGG - Intronic
1193857224 X:86618836-86618858 AAGTTTTGAGAATTTGGGGAAGG + Intronic
1195026125 X:100879458-100879480 GAGGTTTCAGATTTGGGGCATGG - Intergenic
1196672743 X:118386668-118386690 AAGGATTAAGGATTTAAGCAAGG - Intronic
1198409943 X:136356567-136356589 AAGAACTGAGAATTGGGGCAAGG - Intronic
1198542045 X:137650216-137650238 AAGGGTACAGAATTTCGGCTAGG + Intergenic
1199068074 X:143443702-143443724 AAGCATGCAGAATTTTGTCACGG - Intergenic
1200032667 X:153309098-153309120 CAGAAATCAGAATATGGGCAGGG + Intergenic
1200316026 X:155134181-155134203 AAAGCTGCAGAGTTTGGGCAGGG + Intronic
1201281363 Y:12345292-12345314 AAGGTTTCAGAGGTAGGGCAGGG - Intergenic