ID: 1092797026

View in Genome Browser
Species Human (GRCh38)
Location 12:12121922-12121944
Sequence CTGTCTACCAAAATCCAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 143}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092797026_1092797033 21 Left 1092797026 12:12121922-12121944 CCAGGCTGGATTTTGGTAGACAG 0: 1
1: 0
2: 0
3: 14
4: 143
Right 1092797033 12:12121966-12121988 ATTGTTGTTATCTTAGCAAAGGG 0: 1
1: 0
2: 2
3: 29
4: 276
1092797026_1092797032 20 Left 1092797026 12:12121922-12121944 CCAGGCTGGATTTTGGTAGACAG 0: 1
1: 0
2: 0
3: 14
4: 143
Right 1092797032 12:12121965-12121987 CATTGTTGTTATCTTAGCAAAGG 0: 1
1: 0
2: 0
3: 25
4: 243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092797026 Original CRISPR CTGTCTACCAAAATCCAGCC TGG (reversed) Intronic
907537236 1:55175156-55175178 CTGCCTACCAAAATGCAACTGGG + Intronic
911371213 1:96996966-96996988 CTCTCTACCTAAATCCTGACAGG + Intergenic
913098312 1:115540477-115540499 CAGACTACAAAAAACCAGCCAGG + Intergenic
913120044 1:115731586-115731608 CTGTGTGCCAAAAACCAGCTAGG + Intronic
917136797 1:171795898-171795920 CAGTGAGCCAAAATCCAGCCTGG - Intronic
919088454 1:192949476-192949498 GTGTCTACAAAAAACTAGCCAGG + Intergenic
920409178 1:205745326-205745348 CTGTCTACAAAAAATTAGCCAGG + Intronic
922022210 1:221716668-221716690 GTGCCTACCAAGATCCAGTCTGG + Intronic
923474453 1:234319662-234319684 CTGTGCACCACACTCCAGCCTGG + Intronic
923630531 1:235646723-235646745 CTGTCTACCAATTTCCAGCAGGG + Intronic
1066112592 10:32210528-32210550 CTGTCCACCAAGATCCAGTCTGG + Intergenic
1068283860 10:54909994-54910016 CAGGCTACCAAAATACAGCGGGG + Intronic
1070351016 10:75592215-75592237 CTGTGTACCACATTCCTGCCAGG - Intronic
1070471802 10:76787831-76787853 CTCTGTAGCAAAATCCAGCTAGG - Intergenic
1070705767 10:78636874-78636896 CTGTCCAGCCAAGTCCAGCCTGG - Intergenic
1071123493 10:82308207-82308229 CTGTCATCCCAAATTCAGCCTGG - Intronic
1074815015 10:117136718-117136740 CTGTGTCCCCAAATCCAGCTCGG - Intronic
1078449702 11:11431381-11431403 CTGCCTACCATCATCTAGCCTGG - Intronic
1080831516 11:35897536-35897558 CTACCTACCAAAACCCACCCGGG + Intergenic
1081019982 11:37933495-37933517 CTCAGTACCAAAATCCAACCAGG - Intergenic
1086901724 11:92375161-92375183 CTGTCTCCCAAGATGCAGGCTGG + Intronic
1089911002 11:122100816-122100838 GTGTCTACCAAATGACAGCCTGG - Intergenic
1092797026 12:12121922-12121944 CTGTCTACCAAAATCCAGCCTGG - Intronic
1092908853 12:13127337-13127359 CTGTCATCCAAAATGCAGGCCGG - Intronic
1101774343 12:107779970-107779992 CTGTCTACAAAAAATTAGCCAGG + Intergenic
1104391441 12:128393903-128393925 CTGTGTGCCAATATCCAGGCCGG - Intronic
1105295961 13:19088131-19088153 CTGTCTACACATATGCAGCCAGG - Intergenic
1107022994 13:35770899-35770921 CTGTATAGCAAACTTCAGCCTGG + Intronic
1108046700 13:46390135-46390157 CTGCCTGCCAAAACCCAGCCAGG + Intronic
1112036911 13:95505555-95505577 CTGTCTGCCAACAACCACCCTGG - Intronic
1115006737 14:28494707-28494729 ATGTCTACAAAAATCTTGCCGGG - Intergenic
1117977910 14:61316862-61316884 CTGGCTCCCTAAATACAGCCAGG - Intronic
1118051035 14:62028096-62028118 CTGCCTTCCAAAACCCAGCCAGG - Intronic
1120706907 14:87754856-87754878 CTGTCTCTCTAAAACCAGCCAGG - Intergenic
1124951720 15:34328855-34328877 CTGCCTACCCAAGTCCAGCCTGG + Intronic
1128973573 15:72130856-72130878 CTGTTTATAAAAATCCTGCCGGG - Intronic
1129103715 15:73290399-73290421 GTGTCTACAAAAAACTAGCCAGG - Intronic
1129909295 15:79212869-79212891 CTGTCTACAGAGACCCAGCCGGG + Intergenic
1134056162 16:11171080-11171102 CTGTCTTCCCAAATGCAGACGGG + Intronic
1134483648 16:14639552-14639574 CTGTCTACCAAAATGGAGGTGGG - Intronic
1134773146 16:16828344-16828366 CTGTCTCCCAAAATAAAGCCAGG + Intergenic
1137676744 16:50307397-50307419 CTGTCAACCAAAATGCATGCAGG - Intronic
1137894065 16:52192148-52192170 TTGTGATCCAAAATCCAGCCTGG + Intergenic
1138321834 16:56120691-56120713 CATTCTACAAAAATCCAGCCAGG - Intergenic
1142819777 17:2456635-2456657 GTGTCTACAAAAAATCAGCCTGG - Intronic
1143625250 17:8106198-8106220 CTGTCTTCCTAAATCCAGTTAGG - Intronic
1147122449 17:38343656-38343678 CTGTCTTCCCAAGTCAAGCCAGG - Exonic
1148778711 17:50109988-50110010 CTGTCTACAACAAGTCAGCCTGG + Exonic
1152065203 17:78108598-78108620 CAGTCTGTCAAAATCCAACCTGG - Exonic
1152188425 17:78873459-78873481 ATCTCTACAAAAAACCAGCCAGG - Intronic
1152333204 17:79685304-79685326 CTATCTGCCAAGGTCCAGCCAGG + Intergenic
1154101751 18:11481267-11481289 TTGTCTGTCAAAATCCAGACTGG + Intergenic
1159625092 18:70683727-70683749 CTTTCTACCAAAATTCACCTAGG + Intergenic
1160196623 18:76760411-76760433 CGCTCCACCACAATCCAGCCTGG - Intergenic
1161866228 19:6833862-6833884 CTGTCTACCTATGCCCAGCCTGG - Intronic
1162565590 19:11444576-11444598 CTGTATACCAAGCTCCAGCTTGG - Intronic
1164220935 19:23193093-23193115 CTTTATTCCAAAATCCAGGCTGG + Intergenic
1164805669 19:31114616-31114638 CTGTCTATGGAAATCCAGCCAGG + Intergenic
1164930506 19:32172161-32172183 CTTTTTATCAAAATCCAGTCTGG + Intergenic
1166134864 19:40769958-40769980 CTGCACTCCAAAATCCAGCCTGG + Intergenic
1166786922 19:45373155-45373177 CTGTCTCCAAAAATACAGCCGGG - Intergenic
1167462508 19:49633299-49633321 CTGTCTACAAAAATAGAGACAGG - Intergenic
1167550748 19:50159153-50159175 CTGTCTCCCCAAATCAAGCCTGG - Intronic
925103755 2:1271971-1271993 CTGTGAACCAACATCCACCCTGG + Intronic
929697138 2:44127809-44127831 CTGTCTACAAAAAATTAGCCTGG + Intergenic
934725713 2:96617100-96617122 CTGTCTGCCAGGATCCAGTCTGG + Intronic
936792021 2:116162371-116162393 CTCTCTATCATCATCCAGCCAGG - Intergenic
940094676 2:149961031-149961053 CTGTCAACCAAAAACCACCCAGG - Intergenic
941906248 2:170717509-170717531 CTGCCTCCCAAAATGGAGCCAGG + Exonic
944870257 2:203904067-203904089 CAGTCTACCCAGATCCAGCTTGG + Intergenic
945026264 2:205622513-205622535 CTTGCTACTACAATCCAGCCTGG + Intergenic
945792155 2:214318540-214318562 CTCTCTACAAAAAACTAGCCAGG - Intronic
948349483 2:237326929-237326951 CTGTCACCCAAATTCCAGGCTGG + Intronic
948635832 2:239336853-239336875 CTGTATTCCAAGATCCATCCAGG + Intronic
948691889 2:239711434-239711456 CTGGCCACCAACACCCAGCCTGG + Intergenic
1170280203 20:14637929-14637951 CTGACTTCCAAAATCCTGACAGG - Intronic
1170621550 20:18000533-18000555 CTGTCTATAATAGTCCAGCCAGG - Intronic
1172009797 20:31839940-31839962 CTGTCAGCCAGAAGCCAGCCTGG - Intergenic
1172014016 20:31862398-31862420 CTGTCTAACAAAATACACCTAGG + Intronic
1174388576 20:50202289-50202311 CTGTCTACCAAGACCCATTCAGG + Intergenic
1175007682 20:55702783-55702805 CTCTCCACCACACTCCAGCCTGG - Intergenic
1179574976 21:42302270-42302292 CTGGCTACCACATTCCAGCCTGG + Intergenic
1179994063 21:44965908-44965930 GTGTCTACCACAGTCCAGGCAGG + Intronic
1181002798 22:19995753-19995775 CTGTCTACCAGAACACAGCCAGG + Intronic
1181494091 22:23278218-23278240 CTGTTTCCCAAGAGCCAGCCAGG + Intronic
1181781887 22:25199757-25199779 CTGTCCACCCAATTCCATCCAGG - Intergenic
1183647879 22:39137020-39137042 CTGGCTTCCAATATCCTGCCTGG + Intronic
949133881 3:538456-538478 ACGTCTTCCAAAATCCAGCATGG - Intergenic
951510182 3:23491780-23491802 CTGTTTACCAAACTGCAGCTAGG - Intronic
952626723 3:35414791-35414813 TTGTCTACCACATTCCAGACAGG - Intergenic
955820322 3:62889662-62889684 CTGTCCCCCCAAATCCAGCAAGG - Intergenic
956083012 3:65579443-65579465 GTGACTTCCAAAATGCAGCCAGG + Intronic
956597697 3:70986262-70986284 CTCTCTGCCAACACCCAGCCCGG + Intronic
957262543 3:77920441-77920463 CTGTCTTCCAAATTATAGCCAGG - Intergenic
959632365 3:108521801-108521823 CTGTGAACAAAAAGCCAGCCAGG - Intronic
960594771 3:119398222-119398244 CACTCTACCACACTCCAGCCTGG + Intronic
964938276 3:162122121-162122143 CTTGCTACCACACTCCAGCCTGG + Intergenic
966655489 3:182353055-182353077 CTGTCTACCCAGAGCCAGGCTGG + Intergenic
970595618 4:17597435-17597457 GTGTCTACAAAAAGCTAGCCAGG - Intronic
972343367 4:38172141-38172163 CAGTCTCCCAAAACCCAGTCAGG - Intergenic
972476167 4:39451794-39451816 CTCTCTACAAAAAACTAGCCAGG + Intergenic
973784515 4:54322729-54322751 CTGACCTCCAAATTCCAGCCAGG - Intergenic
974070950 4:57123084-57123106 CTGTCCAACAACATCCAGCAAGG - Intergenic
976802830 4:89011794-89011816 CTGACCACCATAATCCAGGCTGG + Intronic
986342796 5:6805570-6805592 CTGCCGGCCAAACTCCAGCCAGG + Intergenic
987296922 5:16561451-16561473 CGCTCTACCACACTCCAGCCTGG + Intronic
989052233 5:37332910-37332932 CTGTGCACCACACTCCAGCCTGG + Intronic
990192814 5:53279556-53279578 CTGCATACCAAAATCCAGAAGGG - Intergenic
990500028 5:56386975-56386997 CTGTCTTCCACACTCCAGGCGGG + Intergenic
992069954 5:73138912-73138934 GTGCCTACCACACTCCAGCCTGG + Intergenic
993466072 5:88248874-88248896 CTGTTTACCACACTCTAGCCAGG + Intronic
998466703 5:142350838-142350860 GTGTCTACCAAAATCCTACATGG - Intergenic
1001450573 5:171821307-171821329 CTCTCTTCCAAACTCCATCCAGG + Intergenic
1005569807 6:27133821-27133843 CTGTCTGCTAAATTCTAGCCCGG - Exonic
1007351771 6:41278725-41278747 CTTTCAGCCAAAATCCAGTCTGG - Intronic
1008814886 6:55553392-55553414 CAGGCCACCAAACTCCAGCCTGG + Intronic
1011569538 6:88719967-88719989 CTGTGCACCAAATGCCAGCCTGG - Intronic
1012440475 6:99257588-99257610 GTGTCTACAAAAATTTAGCCAGG - Intergenic
1015769689 6:136755643-136755665 CTTGCTACCACACTCCAGCCTGG + Intronic
1016815637 6:148300490-148300512 CTCGCTACCACACTCCAGCCTGG - Intronic
1018388918 6:163328523-163328545 CTGTCCACCACACGCCAGCCTGG + Intergenic
1021971187 7:25967397-25967419 ATGTCTGCCATAATCTAGCCAGG + Intergenic
1023554330 7:41404936-41404958 CAGCCTGCCAGAATCCAGCCAGG - Intergenic
1025744322 7:64229693-64229715 CTGTGTCCCTAAATCTAGCCAGG + Intronic
1026468698 7:70676269-70676291 ATGTCTACCAAAAATTAGCCTGG + Intronic
1030140248 7:106296883-106296905 CTGGCTACAAACATGCAGCCAGG - Intergenic
1033133640 7:138766824-138766846 CTGTTTAACAAAATCAAGACAGG + Intronic
1033204833 7:139409910-139409932 ATTTATAACAAAATCCAGCCGGG + Intronic
1033741105 7:144276553-144276575 CTGCCTGCCCAATTCCAGCCTGG - Intergenic
1033752801 7:144373061-144373083 CTGCCTGCCCAATTCCAGCCTGG + Intronic
1034411197 7:150943057-150943079 GTGTCCACCAACACCCAGCCCGG + Intergenic
1036293920 8:7519820-7519842 CTGTGAACCAACATTCAGCCAGG + Intergenic
1036328642 8:7801171-7801193 CTGTGAACCAACATTCAGCCAGG - Intergenic
1037163630 8:15800541-15800563 CTCACTCCCAAAATCCAGGCTGG - Intergenic
1038700756 8:29847440-29847462 CTGGCTCCCAAAATCCACTCAGG + Intergenic
1040536576 8:48316069-48316091 CTGTCTACCCAAAGCAAGCAGGG - Intergenic
1043051568 8:75392371-75392393 TTCTCTACCAAAAACTAGCCAGG + Intergenic
1044316000 8:90750861-90750883 CTGTCAACCACATTGCAGCCTGG - Intronic
1051365276 9:16317276-16317298 CAGACTGCCAAAATCCAGGCAGG - Intergenic
1051369100 9:16343240-16343262 GTGTGAAACAAAATCCAGCCGGG + Intergenic
1051582152 9:18688622-18688644 CTTGCCACCAAACTCCAGCCTGG + Intronic
1055407004 9:75985602-75985624 ATGTGGAACAAAATCCAGCCTGG + Intronic
1057588263 9:96348734-96348756 CTTTCAACCAAGAGCCAGCCTGG - Intronic
1057765343 9:97912054-97912076 CTGTCTAATAGCATCCAGCCAGG - Intronic
1057833991 9:98429434-98429456 ATATATACCAAAATCCGGCCAGG - Intronic
1057941927 9:99292676-99292698 CTGTCTACCAAGAGCCTGACTGG - Intergenic
1059344534 9:113619389-113619411 CTGTCTTCCAATATCCTACCTGG + Intergenic
1061608759 9:131731948-131731970 CTGTCTTTCAAACTACAGCCTGG + Intronic
1062336650 9:136073842-136073864 CTGTCTGCTAAAATGCTGCCTGG + Intronic
1062424788 9:136501086-136501108 CTGGCACCCAAAATCCACCCAGG + Intronic
1186372497 X:8961503-8961525 CTGTCTACTAAGACCAAGCCTGG + Intergenic
1190389622 X:49919291-49919313 CTCTCTACAGAAATCCAGCCAGG - Intergenic
1191886727 X:65895904-65895926 CATTCTACCACACTCCAGCCTGG + Intergenic
1192461338 X:71319873-71319895 TTTTCTACCACACTCCAGCCTGG - Intergenic
1192579658 X:72270550-72270572 TTGTCTACCAAAAATTAGCCGGG - Intronic
1196390092 X:115197783-115197805 CTCTCTACTACACTCCAGCCTGG + Intronic
1197984686 X:132255160-132255182 TAGTCTACTACAATCCAGCCTGG + Intergenic
1201478101 Y:14406246-14406268 CTTTAGACCAAAATCCAGGCTGG + Intergenic