ID: 1092797260

View in Genome Browser
Species Human (GRCh38)
Location 12:12124632-12124654
Sequence CTGTGGCTGGGGATGGTGGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1180
Summary {0: 1, 1: 0, 2: 13, 3: 125, 4: 1041}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092797252_1092797260 -2 Left 1092797252 12:12124611-12124633 CCATAGTGTAATGTGATCGCTCT 0: 1
1: 0
2: 0
3: 5
4: 48
Right 1092797260 12:12124632-12124654 CTGTGGCTGGGGATGGTGGAGGG 0: 1
1: 0
2: 13
3: 125
4: 1041
1092797251_1092797260 5 Left 1092797251 12:12124604-12124626 CCAAATTCCATAGTGTAATGTGA 0: 1
1: 0
2: 1
3: 22
4: 368
Right 1092797260 12:12124632-12124654 CTGTGGCTGGGGATGGTGGAGGG 0: 1
1: 0
2: 13
3: 125
4: 1041

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092797260 Original CRISPR CTGTGGCTGGGGATGGTGGA GGG Exonic
900198812 1:1393082-1393104 CTTTTCCTGGGGAGGGTGGAGGG - Intronic
900396109 1:2453866-2453888 CGGTGGCGGGGGCTGCTGGAGGG + Intronic
900796747 1:4712633-4712655 TTGTTGCTGGGACTGGTGGAAGG - Exonic
900894587 1:5474343-5474365 CTGTGGCTGGTGATGATGGCAGG + Intergenic
900986994 1:6078883-6078905 CTTTGCCTGGGGAAGGTGCAGGG + Intronic
901445801 1:9307399-9307421 CAGGGGCTGGGGAGGGAGGATGG - Intronic
901638258 1:10680272-10680294 GGGCGGCGGGGGATGGTGGAGGG + Intronic
901638483 1:10681276-10681298 AGGTGGGTCGGGATGGTGGAAGG + Intronic
901757697 1:11451272-11451294 CTGGGGCTGGGGAAGCGGGAGGG + Intergenic
901798619 1:11694351-11694373 CTCTGGCTGGGGAGGTTGGAGGG + Intronic
901842165 1:11960623-11960645 CTGGGGTTGGGGATGGGGAAGGG - Intronic
902092678 1:13915996-13916018 CTGTGGCAGGGGTTGGGGGCCGG + Intergenic
902332380 1:15736889-15736911 CTGGGTCATGGGATGGTGGAGGG - Intronic
902542743 1:17166227-17166249 CTGATGGTGGGGATGGTGGTGGG - Intergenic
902754945 1:18542736-18542758 CTGAGGCTGGGGCTGGGGGTGGG + Intergenic
903226851 1:21898691-21898713 ATGAGGCTGGGGCTGGTGCAGGG + Intronic
903557859 1:24206398-24206420 CTGGGGCTGGGGAAGGGAGAGGG - Intergenic
903557862 1:24206404-24206426 CTGTGCCTGGGGCTGGGGAAGGG - Intergenic
903813777 1:26049767-26049789 CTGAGTCTGGAGATGGTGGGAGG - Intergenic
903929860 1:26855963-26855985 CTGAGGCAGGGGAAGGTGGAGGG - Exonic
903952560 1:27004843-27004865 CTGCGGCTGGGGTTGGGAGAAGG + Intergenic
904194552 1:28775348-28775370 CCGTGCCTGCGGATGGAGGAGGG + Intergenic
904231855 1:29080626-29080648 GGGAGGCTGGGGAGGGTGGATGG - Intronic
904287825 1:29463502-29463524 CTGTGGCTGGAGTGGGAGGAGGG - Intergenic
904314355 1:29650656-29650678 CGGTGGGTGGGCAGGGTGGAGGG + Intergenic
904326159 1:29728065-29728087 ATTTGGCTGTGGGTGGTGGAGGG + Intergenic
904377978 1:30093786-30093808 GTGTTGCTGGTGGTGGTGGAGGG + Intergenic
904433345 1:30479193-30479215 ATTTGGCTGTGGGTGGTGGAGGG - Intergenic
904497094 1:30893144-30893166 CTGAGGGTGGGGAAGGTGCAGGG + Intronic
904501572 1:30915723-30915745 CTGCCGCTGGCCATGGTGGAGGG + Intergenic
904771935 1:32885790-32885812 CAGAGGCTGGGGAGGGAGGAAGG + Intergenic
904781636 1:32954055-32954077 ATGTAGCTGGGCATGGTGGCGGG - Intronic
904825197 1:33269735-33269757 CTGGGGCGGGGGTTGGGGGATGG + Intronic
904883170 1:33715677-33715699 CCGTGGCTGAGAAAGGTGGAGGG + Intronic
904912983 1:33949334-33949356 CAGTGGCTGGGGAGGGCAGATGG + Intronic
905034865 1:34911462-34911484 CTGTGTCCTGGGATAGTGGATGG - Intronic
905035880 1:34918215-34918237 CTGTGTCAGTGGATGGTGGCAGG - Intronic
905107239 1:35571508-35571530 CTGTGGCTGGGGTTGAGGGAGGG + Intergenic
905142823 1:35861934-35861956 CTGTGGCTGGAGAAGGAAGAAGG + Intergenic
905242675 1:36590971-36590993 CTGGGGAAGGGGATGGAGGAAGG + Intergenic
905333847 1:37229698-37229720 CAGGGGCTGGGGTTGGGGGATGG - Intergenic
906033761 1:42738638-42738660 CGGTGCCTGGGGTCGGTGGAAGG + Intronic
906251127 1:44311780-44311802 TCCTGGCTGGGGATGGTGGCTGG + Intronic
906399873 1:45497022-45497044 AAGTGGCTGGGCATGGTGGCGGG + Intronic
906722362 1:48018190-48018212 AGGTGGCTGAGGATGGTGGCAGG + Intergenic
906792150 1:48668483-48668505 CTGGGGCTGGGGCCTGTGGAAGG - Intronic
906799123 1:48720831-48720853 CTGGGGCTGGGAATGAAGGATGG + Intronic
906816253 1:48882770-48882792 CAGAGGCTGGGGATGGGGGTTGG - Intronic
907279239 1:53334743-53334765 TTGAGCCTGGGGCTGGTGGAGGG - Intergenic
907538596 1:55190014-55190036 AATTAGCTGGGGATGGTGGAAGG + Intronic
908239033 1:62173504-62173526 ATTTAGCTGGGGATGGTGGTGGG - Intergenic
908543835 1:65146500-65146522 CTTTGATTGGGGTTGGTGGAGGG - Intergenic
908642851 1:66244603-66244625 CTGTGACTGGGGCTGGTGTCTGG + Intronic
909048929 1:70745413-70745435 CTGGGGTTGGGGGAGGTGGAGGG + Intergenic
909139274 1:71843216-71843238 TTGTGGCAGGGGATGGAGAAAGG + Intronic
909239580 1:73195335-73195357 CTGTGGCAGGGAATTGAGGATGG - Intergenic
909349174 1:74629575-74629597 CTGTAGCTGGGCATGGAGGAGGG - Intronic
909445217 1:75742145-75742167 CTGGGGGTGGGGAGGGGGGAAGG - Intronic
909614059 1:77587144-77587166 GTGTTGCTGGGGATGGAGGATGG + Intronic
910457539 1:87413535-87413557 CTGCGGCTGGGCATGGTGGAAGG - Intergenic
910643483 1:89489388-89489410 CTGGGGCTTGGAATGGGGGAAGG - Intergenic
910798080 1:91118655-91118677 GTGTGGCTGGGCGTGGTGGTGGG - Intergenic
910864709 1:91777564-91777586 TTGGGGCTGGGGCTGGGGGAAGG - Intronic
911090093 1:94011159-94011181 CTGTGGCAGGGGCTGGTGCTAGG - Intronic
911242767 1:95483469-95483491 CTGGAGCTGGGGATGCTGGATGG + Intergenic
911297242 1:96132642-96132664 GGGAGGCTGAGGATGGTGGATGG + Intergenic
912448962 1:109758139-109758161 CTGAGGCTGGGGCTTGTGGTGGG - Intronic
912756615 1:112329623-112329645 CGGTGGCTGAGGATAGGGGAGGG + Intergenic
913198018 1:116474162-116474184 CTTTGCCTGGGGGTGGTGAAGGG - Intergenic
914749892 1:150527597-150527619 CAGAGGCTGGGCATGGTGGCTGG + Intergenic
914807666 1:151003382-151003404 CTGTGGTTTGGGATTGTGTAAGG - Intronic
914963464 1:152228609-152228631 GTGTGGCAGGGGATAGTGGTGGG + Intergenic
914996080 1:152544341-152544363 CTGTCACTTGGGATGGTTGACGG + Intronic
915285235 1:154848093-154848115 CTCTGGCTGGGGAGGGGGGGAGG - Intronic
915326191 1:155082307-155082329 CCGGGGCTGGGGGTGGAGGATGG + Intronic
915634873 1:157179052-157179074 CTGTAGCTGGGTGTGGTGGCGGG - Intergenic
915930926 1:160060638-160060660 CTGGGGCCTGGGAGGGTGGATGG - Intronic
916059353 1:161088188-161088210 CTTTGGCTGGAGATGGAGGTAGG + Intronic
916376984 1:164166045-164166067 AATTGGCTGGGCATGGTGGAGGG - Intergenic
917201763 1:172524774-172524796 CTTTTGCTGGGGATGGGGTAGGG + Intergenic
917246371 1:173005206-173005228 CTGCTGCTCGGGATGGGGGATGG + Intergenic
917755490 1:178094085-178094107 CTCTGGCTGGGGATGGAGCGGGG - Intergenic
918144069 1:181740514-181740536 GTGGGGGTGGGGATAGTGGAGGG + Intronic
918265680 1:182839561-182839583 CGGCGGCTGGGGGTGGGGGAAGG + Intronic
919157295 1:193782584-193782606 CAGAGGCTGGGGAGGGTAGAGGG + Intergenic
919507757 1:198421307-198421329 TTGTGGCTGGGGATGTTTAAAGG - Intergenic
919834925 1:201567055-201567077 CGGTGGCTGGGGATGGGGGGTGG - Intergenic
919922334 1:202174080-202174102 CTGGGGCTGGGGAGGATGGGTGG + Intergenic
919972793 1:202591708-202591730 CTGTGGGTGGTGATGGAGGAGGG - Exonic
920047105 1:203140426-203140448 CTGTTTCTGGGGATGGGGAAGGG + Intronic
920146748 1:203867845-203867867 GTTTTGCTGGGGATGGGGGAAGG + Intronic
920200656 1:204257915-204257937 GTGGGGCTGGGGTGGGTGGAGGG - Intronic
920378410 1:205521899-205521921 CTGTGCCTGGTGCTGGTGCATGG + Intronic
920692316 1:208156014-208156036 ATGTGGCTGGTGAGGGAGGATGG + Intronic
921264880 1:213414103-213414125 CTGGAGGTGGGGATGGGGGAAGG + Intergenic
922560244 1:226564509-226564531 CAATGGCTGGGGTTGGTGGTTGG + Intronic
922702431 1:227769698-227769720 CTGTGGTTGTGGAGGGTGGAGGG + Intronic
922866216 1:228863535-228863557 CTCTGCCTGGGGAGGGTGCAAGG + Intergenic
923511118 1:234654680-234654702 CTGTTACTGGGGATGGGAGAGGG + Intergenic
923689135 1:236176070-236176092 TTGAGGCTGGGGATGTGGGAGGG + Intronic
924450213 1:244171754-244171776 CTGTGGCTGGGTCTGTTGCATGG - Intergenic
924505697 1:244681487-244681509 CTGGGGCGGGGGAGGGAGGATGG + Intronic
924510443 1:244725298-244725320 TTGTGGCTGGGGATGAATGAAGG - Intergenic
924604549 1:245521575-245521597 CTGTGGCTGGGAAGACTGGAAGG + Intronic
924664281 1:246054702-246054724 CTGGGGCTGGGGGTGGGTGAGGG + Intronic
1062932236 10:1360971-1360993 GGGGGGCTGGGGAGGGTGGAGGG + Intronic
1063350813 10:5352937-5352959 CTGTGTGTGGGGAGGATGGAGGG - Intergenic
1063367509 10:5500026-5500048 CTGAGGCTGGGGCTGGTGGAAGG + Intergenic
1063458082 10:6199065-6199087 CTTTGGCTGGTGATGATGGAAGG + Intronic
1063579528 10:7293195-7293217 CTGAGGCTGGAGATGGTGGTGGG - Intronic
1063680465 10:8182359-8182381 CTGGGGGTGGGGGTGGGGGAAGG + Intergenic
1063787449 10:9401804-9401826 CAATGGCTGGGCATGGTGGGTGG + Intergenic
1064687984 10:17884250-17884272 CAGGGGCTGGGGATGGTGGCTGG - Intronic
1064790353 10:18951493-18951515 CAGTGGCTGCGGAGGGTGTATGG - Intergenic
1064811129 10:19199650-19199672 CAGTAGCTGGGTATGGTGGCAGG + Intronic
1065341491 10:24710943-24710965 AATTGGCTGGGCATGGTGGAGGG + Intronic
1065716062 10:28569658-28569680 CTGTGGCTGGGCAAGGAGGTTGG + Intronic
1065725849 10:28667367-28667389 CTGTGGCTGCGGCGGGTGGCAGG - Intergenic
1066336333 10:34481978-34482000 CTGTAGCTGAGCATGGTGGGGGG - Intronic
1066431617 10:35357184-35357206 CTGGGGCTGGGGCTGGGGCAGGG - Intronic
1066491518 10:35899328-35899350 CCGTGGCTGCAGATGGAGGATGG + Intergenic
1066491959 10:35902484-35902506 CTGTGTCTGGGGAAGTTTGATGG + Intergenic
1067068006 10:43114457-43114479 CTGTGGGTGGGGGTGGTGTGAGG - Intronic
1067113110 10:43414709-43414731 CTTTAGCTGGGCATGGTGGTGGG - Intergenic
1067225366 10:44372852-44372874 CTGTGGGATGGGATGGTGGAGGG - Intronic
1067229728 10:44397720-44397742 CTGGGGCAGGGAATGGGGGAGGG + Intergenic
1067317247 10:45180334-45180356 CTGGGGCTGGGGCTGGGGAAGGG + Intergenic
1067429139 10:46231357-46231379 CTGTGGGTGGCCAGGGTGGAGGG + Intergenic
1067741231 10:48897354-48897376 ATGTGGGTGGAGCTGGTGGAGGG + Intronic
1068689943 10:59905484-59905506 CTTTGGGTTGGGAGGGTGGACGG - Intronic
1069332663 10:67311460-67311482 CTGTGGCTGGGGATTGAGAAGGG + Intronic
1069565234 10:69459630-69459652 CTGTGGGTGGAGAGGGTGGCAGG + Intronic
1069595764 10:69669048-69669070 CTGAGGCTGGGGATGGGGGTGGG + Intergenic
1069658042 10:70104964-70104986 CTGTGGCAGGGGGTCGGGGAGGG + Intronic
1070442850 10:76463639-76463661 CGGTGGCAGGGGAGGGGGGAAGG + Intronic
1070782672 10:79146669-79146691 CTCTGGGTGGGGAGGGCGGAAGG + Intronic
1070838495 10:79467043-79467065 CAGGGGCTGGGGAGGGTGGAGGG + Intergenic
1070847964 10:79539287-79539309 CTGTGGTTGGGGAGGAAGGAGGG + Intergenic
1071323125 10:84484398-84484420 ATTTGGCTGGGCATGGTGGATGG - Intronic
1071396933 10:85233296-85233318 CTGTGGATGGGGGTGGTGAGCGG + Intergenic
1071520793 10:86330435-86330457 CTGTGGGTGGGCTTGCTGGAGGG - Intronic
1072427712 10:95343985-95344007 CTGTGGTTGGGGATGAAGGGAGG - Intronic
1072546338 10:96442312-96442334 CTTTTCCTGGGGGTGGTGGAAGG + Intronic
1072955226 10:99882203-99882225 CAGAGGCTGGGGGTGGTGGAAGG + Intronic
1073271128 10:102265029-102265051 CTGTGGCATGGGATGGGGCATGG + Intronic
1073423080 10:103440066-103440088 CTGTTGTTGGGGATGGTGGAGGG + Intronic
1073520312 10:104122172-104122194 CTCTCGCTGGGAATGGCGGAGGG + Exonic
1073727231 10:106247629-106247651 CTGTGGCAGTGGATGGGGGTTGG - Intergenic
1073786692 10:106897761-106897783 CTGTGGCTCTGCATAGTGGAAGG - Intronic
1074057078 10:109932250-109932272 CTGTGACTGGGGAGGATGGGAGG - Intergenic
1074769799 10:116725825-116725847 GTGTGGCAGGGGTTGGGGGAGGG - Intronic
1074781364 10:116804540-116804562 CTGTGGCTGGGGCTGGGGGCTGG - Intergenic
1074819644 10:117168507-117168529 CTGCTGCTGGGGAACGTGGAGGG - Intergenic
1075259873 10:120953956-120953978 GTGTGGCTGGGGCTGGGAGAGGG + Intergenic
1075379990 10:122011234-122011256 GTGTGGCTGGGGAAGTGGGAAGG + Intronic
1075677746 10:124307998-124308020 CTGTGTCTGGGGAAGGTGTCAGG + Intergenic
1075929407 10:126282862-126282884 CTGGGGCTGGGGGTGGGGGATGG + Intronic
1076005819 10:126947668-126947690 CTGTTGGTGGTGATGGTGGTTGG + Intronic
1076005910 10:126948172-126948194 CTGTTGGTGGTGATGGTGGTTGG + Intronic
1076236700 10:128869077-128869099 TTGAGGCTGGGCATGGTGGTGGG - Intergenic
1076248212 10:128964142-128964164 CTGTGGCTGAGGATGAGGGGTGG - Intergenic
1076474472 10:130742833-130742855 CAGAGGCTGGGGATGCAGGATGG - Intergenic
1076805931 10:132858724-132858746 CTGTGGCTGGTGGGGGTGGGTGG + Intronic
1076886974 10:133267467-133267489 CTGGAGCTGGGGGTGCTGGAGGG - Intronic
1076904164 10:133354116-133354138 CTGAGCCTGGGGATGGGCGAGGG + Intergenic
1077280824 11:1744632-1744654 ATGTGGGTGGGGGGGGTGGATGG + Intronic
1077294250 11:1817156-1817178 CAGGGGCTGGGGGAGGTGGAGGG + Intergenic
1077464668 11:2728046-2728068 GAGTGGCTGGGGAGGGAGGAGGG - Intronic
1077534114 11:3111147-3111169 CTGTGGCAGGGGGTGGGGGTGGG - Intronic
1077880577 11:6346492-6346514 CTGTGGGCGGGGTTGGGGGATGG - Intergenic
1078133738 11:8635432-8635454 CTGGGGTTGGGCAGGGTGGAGGG - Intronic
1078278665 11:9876885-9876907 ATTTAGCTGGGGATGGTGGTGGG - Intronic
1078600633 11:12727294-12727316 CTGTGGGTGGGGATGCTGGATGG + Intronic
1078992505 11:16664326-16664348 CTGTGCCAGGGGATGGGGTAGGG - Intronic
1079025999 11:16948162-16948184 CAGAGGCTGGGGTGGGTGGAGGG + Intronic
1079130887 11:17746348-17746370 CTGTGGTTGTGGATGGTGGGTGG - Intronic
1079131188 11:17747793-17747815 CTGGGGCTGGCCAGGGTGGAAGG - Intronic
1079338585 11:19593148-19593170 CAGGGGCTGGGGGTGGCGGAAGG - Intronic
1079579840 11:22050271-22050293 CTGTGGTTGGGAGTGGGGGAGGG - Intergenic
1082737946 11:56877119-56877141 CTGTTGCTGGGGATGGAGGGTGG - Intergenic
1083018512 11:59481791-59481813 ATGTTACTGGGGAGGGTGGAAGG + Intergenic
1083292959 11:61699924-61699946 GTGGGGCTGGGGAGGGTGGCAGG + Intronic
1083301367 11:61741124-61741146 AGGAGGCTGGGGGTGGTGGAGGG - Intronic
1083339883 11:61952107-61952129 CTGAGGCTGGGGCTGGGGGCTGG + Intronic
1083389233 11:62335959-62335981 CTGAGGCTGGGGAAGGTGGCTGG - Intergenic
1083481280 11:62949215-62949237 CTGTGGATGGGGATGGCAGCAGG + Intronic
1083564968 11:63706441-63706463 CTGTGGATGGCTAAGGTGGAAGG - Intronic
1083766835 11:64845269-64845291 CTGAGGCTTGGGAAGGAGGAAGG + Intergenic
1083989631 11:66239000-66239022 TGGTGGCTGGGGGAGGTGGAAGG + Intronic
1083997262 11:66278549-66278571 CTGGGGCTGGGGCTGGGGGCGGG + Intronic
1084028470 11:66467098-66467120 GCGTGTCTGGGGGTGGTGGAGGG + Intronic
1084094793 11:66903974-66903996 CTGTAGCTGGGCATGGTGCTGGG - Intronic
1084178886 11:67437010-67437032 CTGAGGCCTGGGATGGGGGATGG + Intronic
1084289852 11:68155622-68155644 CTGTGTCTGGAGGTGCTGGAGGG - Exonic
1084485348 11:69444843-69444865 ATGTGGCTGGAGAGAGTGGACGG + Intergenic
1084602024 11:70151524-70151546 CTGTGGCTGGGGAAAGTTGGCGG + Intronic
1084603679 11:70160792-70160814 CTGTGCTTGGGGATGGTGCCTGG + Intronic
1084805004 11:71572688-71572710 GTGGGTCTGGGGATGGTGGTGGG - Intergenic
1084971379 11:72774094-72774116 CAGGGGCAGGAGATGGTGGAGGG + Intronic
1085048288 11:73365925-73365947 CTGTGTCTGGGGGAGGTGGTGGG - Exonic
1085122075 11:73973690-73973712 CTGGGGCAGGGGCAGGTGGAGGG + Intergenic
1085122158 11:73974162-73974184 CTGTGGCTGTGGAGGGTGGAAGG + Intergenic
1085274629 11:75290400-75290422 ATGTGGCTGGAGATGGGTGAGGG - Intronic
1085514565 11:77104836-77104858 CTGTGGCTGGGGCTGCCGGGAGG + Intronic
1085625974 11:78073341-78073363 ATTTGGCTGGGGGTGGTGGCGGG + Intronic
1085665426 11:78411158-78411180 TTGGGGGGGGGGATGGTGGAAGG + Intronic
1085689262 11:78652197-78652219 CAGTGACTGGGGGTGGTGGTGGG + Intergenic
1086730717 11:90245623-90245645 CTCTGGCTTGGGAGGCTGGATGG - Intergenic
1087491766 11:98837075-98837097 CTGAGGGTGTGGAGGGTGGAGGG - Intergenic
1087529041 11:99355558-99355580 CTGTGGATGATGGTGGTGGAGGG + Intronic
1087603042 11:100339915-100339937 CTGGGGGTAGGGAGGGTGGAGGG - Intronic
1088494687 11:110421219-110421241 CTGTTGCAGGGGCTTGTGGAGGG - Intergenic
1088685600 11:112282032-112282054 CTGTGGCAGGGGATGAGGGCAGG + Intergenic
1088902373 11:114127971-114127993 AGGAGGCTGGGGATGGAGGAAGG - Intronic
1089016067 11:115166460-115166482 ATGGGGCTGGGGAAGGAGGAGGG + Intergenic
1089081259 11:115777927-115777949 ATGTGGCTGGTGGTGGTGGTGGG + Intergenic
1089118102 11:116112494-116112516 CTGTGGGTGATGAGGGTGGAGGG + Intergenic
1089165062 11:116469600-116469622 TTATGCCTGGGGATGATGGAAGG + Intergenic
1089173500 11:116532462-116532484 CTATATCTGGGGATGGGGGAAGG + Intergenic
1089286189 11:117409550-117409572 CTGTGTCTGGGAATGGTCCAGGG + Intronic
1089303483 11:117512602-117512624 CTGAGGGTGGGGAAGGGGGAAGG + Intronic
1089307225 11:117534208-117534230 CTTGTGCTTGGGATGGTGGAGGG - Intronic
1089536272 11:119162324-119162346 CAGTGGCTGGGGAAGGGGTAGGG - Exonic
1089581461 11:119484128-119484150 GAGTGGCTGGGCATGGAGGAGGG + Intergenic
1089710426 11:120310619-120310641 CTGGGGATGGTGATGGTTGAAGG + Intronic
1089808468 11:121112974-121112996 CTGTGGGTGGGGAGGGCGCAGGG + Intronic
1090073606 11:123564747-123564769 CTCTTGCTGAGGATGGGGGAGGG + Intronic
1090125953 11:124084307-124084329 CTGGGGATGGGGAAGGTGGATGG + Intergenic
1090381960 11:126333657-126333679 CTGGGGCTTGGGCTGCTGGAGGG + Intronic
1090920592 11:131203232-131203254 CTGTGGGTGAGGGTGGTGCAGGG - Intergenic
1091662286 12:2393365-2393387 CTGGAGCAGGAGATGGTGGAGGG - Intronic
1091668931 12:2438624-2438646 ATGTGGCTGGGGAACGGGGAGGG + Intronic
1091704406 12:2684040-2684062 GTGTGGCTGGAGGTGGTGGGAGG + Intronic
1091710980 12:2740390-2740412 GTGTGGCTGGAGGTGGTGGGAGG + Intergenic
1091849277 12:3682191-3682213 CTGAGGGTGGGGAAGGAGGAAGG - Intronic
1092181327 12:6448935-6448957 CTGGGGCTGGGGTTGGTTGGGGG - Intronic
1092184653 12:6470204-6470226 CGGGGGCTGGGGGTGGTGGATGG - Intronic
1092290784 12:7158424-7158446 CTGGGGCTGGGGCTGGGGGTGGG + Exonic
1092525898 12:9310199-9310221 GTGTGACTGGCGATGGTGGGTGG + Intergenic
1092541395 12:9421610-9421632 GTGTGACTGGCGATGGTGGGTGG - Intergenic
1092595370 12:9998305-9998327 CTGTGCGTGGGGATGGTTGTCGG - Exonic
1092599093 12:10039174-10039196 CTGTGCATGGGGATGGTTGTCGG + Intronic
1092728394 12:11506311-11506333 GTGTGGCTGGAGGTGGTGGGAGG - Intergenic
1092797260 12:12124632-12124654 CTGTGGCTGGGGATGGTGGAGGG + Exonic
1093458921 12:19390907-19390929 CTGTGGCCGGGCGTGGTGGGTGG - Intergenic
1093621273 12:21292742-21292764 ATGTAGCTGGGAATGGTGGCAGG - Intronic
1094043383 12:26141263-26141285 CTGTGTTTGGGGATGGAGGAAGG + Intronic
1094493537 12:30975942-30975964 CCGTAGCTGAGGATGGTGGAGGG + Intronic
1094511653 12:31100886-31100908 GTGTGACTGGTGATGGTGGGCGG + Intronic
1094532853 12:31293736-31293758 TTTTGGCTGGGGGTGGTGTATGG - Intronic
1095048958 12:37540753-37540775 CTGGGGCTGGGGCTGGTTGCAGG + Intergenic
1095313795 12:40733487-40733509 CTCTGGCAGGGGAAGGGGGAGGG - Intronic
1095976808 12:47945930-47945952 CTGTGGCTGAGTTTGCTGGATGG + Intergenic
1096255147 12:50058015-50058037 CGGTGGCTGGGGAGGGGGGCGGG + Intronic
1096382798 12:51173068-51173090 CTGGGGCGGCGGACGGTGGAAGG - Intronic
1096499148 12:52054908-52054930 CTGGGGCTGGGGCCGGTGGGAGG - Exonic
1096585007 12:52614271-52614293 CTGTGGCTGGGGATGTTTCCTGG - Intronic
1096843145 12:54391146-54391168 CGGTGCCGGGAGATGGTGGAGGG + Intronic
1097193905 12:57233416-57233438 CTGATGCTGGGGCTGATGGAAGG + Intronic
1097197080 12:57248928-57248950 CTGTGGCTAGAGTTGGTGTAAGG - Intronic
1097637139 12:62136980-62137002 CTGGGGATGGGGGTGGAGGATGG - Intronic
1097651494 12:62303602-62303624 ATGTGGCGGGGGATGGGGGGAGG - Intronic
1098040841 12:66352814-66352836 TTCTGGCTGGGTGTGGTGGAAGG + Intronic
1098981715 12:76963218-76963240 CTCTCTCTGGGGCTGGTGGAAGG + Intergenic
1100039468 12:90296287-90296309 TTTTGCCTGGGGATGGGGGATGG - Intergenic
1101086826 12:101244613-101244635 ATGTAGCTTGGCATGGTGGAAGG - Intergenic
1101211501 12:102539373-102539395 CTCTGGCTGGGGATGGAGAATGG + Intergenic
1101253809 12:102958279-102958301 CTGCGGCTGGGGCTGCTGGCCGG - Exonic
1101417223 12:104518774-104518796 CTTTAGCTGGGGATGTTGGGAGG + Intronic
1101478102 12:105070591-105070613 CTGTGCCTGGGCAGGATGGATGG + Exonic
1101483616 12:105128924-105128946 ATGTAGCTGGGCATGGTGGTAGG - Intronic
1101674597 12:106906536-106906558 GTGTGGTTGGGGATGGTGGGTGG - Intergenic
1101850950 12:108401863-108401885 AGGTGGCTGGGGATGGAGGCGGG - Intergenic
1102247223 12:111362996-111363018 CTGGGGCTGGGGCTGGGGCAGGG + Exonic
1102928936 12:116847995-116848017 CTGTTGCGGGGGCTGGGGGAGGG - Intronic
1103011804 12:117463771-117463793 GTGGGGATGGGAATGGTGGAAGG + Exonic
1103347965 12:120264150-120264172 CTGGAGCTGGGGTTGGTGTAGGG - Intronic
1103606140 12:122087388-122087410 CTGGGGCTGGGGAGGGTGGGTGG + Intronic
1103912586 12:124360558-124360580 GTGTGGCAGGGGCTGCTGGAGGG - Intronic
1103939790 12:124495493-124495515 GTGTGGCAGTGGATGGAGGAGGG - Intronic
1104287171 12:127433909-127433931 CTGGGGGTGGGGACGTTGGAAGG - Intergenic
1104564937 12:129872092-129872114 CTGTGATTGAGGTTGGTGGAAGG - Intronic
1104915219 12:132260883-132260905 CTTAGGAGGGGGATGGTGGAGGG + Intronic
1105309245 13:19191578-19191600 CTGTGGCCAGGGATGGTTGTAGG + Intergenic
1105528350 13:21196529-21196551 CTGTGGCTAGGGATGGTTGGAGG - Intergenic
1105640997 13:22264033-22264055 TTGTGGGTGGGGATGGCGGAAGG + Intergenic
1105706686 13:22971644-22971666 CTGTGGCTGTGGGCGGTGTAGGG + Intergenic
1106020709 13:25912379-25912401 CAGAGGCTGGGGATGGGGGATGG + Intronic
1106615461 13:31323097-31323119 CTGTTGCAGGGGACGGAGGAGGG + Intronic
1107112545 13:36713454-36713476 CAGAGGCTGGGGAGGGTGGAGGG - Intergenic
1107822143 13:44295840-44295862 CTGGGGCTTGGGATGGAGAAGGG - Intergenic
1107863823 13:44684254-44684276 CAGAGGCTGGGGATGGTGTGTGG + Intergenic
1108563856 13:51674731-51674753 ATGTGGGTGGGGAGGGTGGAGGG + Intronic
1108586102 13:51871114-51871136 GTGTGGGTGGGGATGGTCCAAGG - Intergenic
1109309111 13:60671767-60671789 CTTTGCATGGGGATGGGGGATGG + Intergenic
1110657763 13:78020441-78020463 CTTTGGATAGGGATGGTGAAAGG + Intergenic
1111721828 13:91956023-91956045 CAGTGGCTGGGGAGGGTGGTTGG - Intronic
1113554075 13:111217034-111217056 CTGTTGCTGGGGATGTTGCTTGG + Intronic
1113849142 13:113408022-113408044 CTGGGTCTGGGGCTGGTGGCTGG + Intergenic
1113873712 13:113581381-113581403 TTGTGTCTGGGGGTGGTGGGGGG + Intergenic
1113902327 13:113804040-113804062 TGGGGGCTGGGGAAGGTGGAGGG + Intronic
1114015023 14:18420593-18420615 CAGTGTGTGGGGATGGGGGAGGG - Intergenic
1114231360 14:20785863-20785885 CTGTGGCTGAGGCAGGTGGCTGG + Intergenic
1114487488 14:23071576-23071598 CTGTGTGTGCGGATGGGGGAGGG + Intronic
1114673493 14:24427215-24427237 CTGTGGCTGGTGAGGAAGGAAGG - Exonic
1114985258 14:28218266-28218288 CTGCTGCTAGGGATGGAGGATGG + Intergenic
1115488290 14:33934181-33934203 CTGGGAATGGGGATGGTGGGAGG - Intronic
1115518142 14:34205960-34205982 GTGGAGCTAGGGATGGTGGAGGG - Intronic
1116149150 14:41116452-41116474 CTGATGTGGGGGATGGTGGAGGG - Intergenic
1116502678 14:45639361-45639383 CTGGGGTTGGGGTTGGAGGACGG + Intergenic
1116718251 14:48455831-48455853 CTGTGTGTGGGGATGGGGGGTGG + Intergenic
1116855044 14:49944666-49944688 CTGTGGGTGGGAGTGGGGGATGG + Intergenic
1117870707 14:60197805-60197827 CAGTGCCTGGGGTTGGGGGAAGG - Intergenic
1118878281 14:69803454-69803476 CTATGGCTGATGGTGGTGGAGGG + Intergenic
1118895591 14:69942995-69943017 CTGTGGCTGCTGGTGGTGGGGGG + Intronic
1119092933 14:71801416-71801438 CTGTGGGATGGGATGGGGGATGG - Intergenic
1119480868 14:74956816-74956838 CTGGGCCTGGGGCTGGTGGGTGG + Intergenic
1120854891 14:89203683-89203705 CTGGGGCTGGACAAGGTGGAGGG + Intronic
1121252966 14:92513538-92513560 CTGTGGCTGGGGCTGGGGCGCGG - Intergenic
1121322381 14:92999522-92999544 CAGTGGGTGGGGAGGCTGGAAGG + Intronic
1121432933 14:93900196-93900218 CTGGGAGTGGGGGTGGTGGACGG + Intergenic
1121449092 14:93996468-93996490 CTGTGGCTGGAGTTGGGGCACGG - Intergenic
1121449471 14:93998252-93998274 CTGGGGCTGGGGCTGGGGCAGGG - Intergenic
1121553680 14:94820575-94820597 CTGAGGCTGGGCAAGGTCGAGGG + Intergenic
1121958007 14:98231558-98231580 CTCTGGCAGGGTAGGGTGGAAGG - Intergenic
1122018888 14:98820130-98820152 CTGGGGCTGGGGGTGGAGGCAGG - Intergenic
1122211836 14:100178559-100178581 CTGTGGCTGGGGAAGGGGAGTGG + Intergenic
1122850044 14:104523118-104523140 CTGTGGCTGTGGGTGGTGTGGGG + Intronic
1122920020 14:104876165-104876187 CTGGGGCAGGGGATGGAGCAGGG + Intronic
1122923009 14:104887649-104887671 CTGAGGCTGCGGATGGTGAGCGG + Exonic
1124011996 15:25846141-25846163 CAGGGGCTGGGCATGGGGGAAGG + Intronic
1124061025 15:26293839-26293861 CTGTGGCTGGGGATGTGGGTGGG + Intergenic
1124106167 15:26740137-26740159 GTGAGGATGGGGATGGTGGGGGG - Intronic
1124192683 15:27594245-27594267 CTTTCCCTGAGGATGGTGGAAGG + Intergenic
1124343950 15:28908944-28908966 CGGGGGCTGGGGGAGGTGGAAGG - Intronic
1125494262 15:40176095-40176117 CTTTAGCTGGGCATGGTGGAAGG - Intronic
1125759081 15:42084925-42084947 CTGTGGCTGTGGGTCTTGGAGGG - Intronic
1126440603 15:48683902-48683924 CTCTGCCTGGGGAAAGTGGAGGG + Intergenic
1126808110 15:52373629-52373651 CTGTGACTGGACAGGGTGGAAGG - Intronic
1127012281 15:54643678-54643700 CTGCTGCTGGGGATGGAGAAGGG - Intergenic
1127257033 15:57301257-57301279 TTGTAGCTGGGCATGGTGGCAGG + Intergenic
1127455801 15:59155051-59155073 CTGGGGATGGGGAGGGTAGAAGG + Intronic
1127879288 15:63142290-63142312 AAGTGGCTGGGCATGGTGGTGGG - Intronic
1128317447 15:66670041-66670063 CTGGGTCTGGGGATTGGGGATGG + Intronic
1128325261 15:66719906-66719928 CTGGGGAGGGGGGTGGTGGAGGG + Intronic
1128390149 15:67177204-67177226 CTATGGCTCTGGTTGGTGGATGG - Intronic
1128465130 15:67904234-67904256 AATTGGCTGGGCATGGTGGAGGG - Intergenic
1129518240 15:76169996-76170018 CTGTGGCTGTGCATGTTGGGTGG + Intronic
1129793464 15:78358202-78358224 TTGTGGCAGGGGATGGAGGTCGG + Intergenic
1129843682 15:78758572-78758594 CTGTAGCTGGGGCTGGTGGTGGG + Intergenic
1130258123 15:82335228-82335250 CTGTTGCTTGGGCTGGTGGTGGG - Intergenic
1130380350 15:83366588-83366610 CTGGGGATGGGGGTGGTGGCGGG + Intergenic
1130596806 15:85254733-85254755 CTGTTGCTTGGGCTGGTGGTGGG + Intergenic
1130662968 15:85845150-85845172 ATGTGGCTGGGGGAGGTGGCGGG + Intergenic
1130689582 15:86070143-86070165 GTGGGGTGGGGGATGGTGGAGGG - Intergenic
1131082773 15:89550796-89550818 CTGTTGGTAGGGATGGGGGAAGG + Intergenic
1131376494 15:91928497-91928519 TCATGCCTGGGGATGGTGGAGGG - Intronic
1131540078 15:93268424-93268446 CTGTGGCTGGATGTGGAGGATGG + Intergenic
1131832549 15:96363018-96363040 CTGGGGCTGAGGTTGGGGGAGGG + Intergenic
1132039185 15:98510889-98510911 CTGGGGCTGGGGAGGGTAGAAGG + Intronic
1132354413 15:101160502-101160524 CTATTGCTGGAGATGGAGGAGGG + Intergenic
1132494349 16:253999-254021 CTGTGCTTGAGGCTGGTGGAAGG + Intronic
1132676357 16:1122930-1122952 CTGTGGGTGGGTATGGAGGTAGG - Intergenic
1132981623 16:2741189-2741211 CTGAGGCAGGGGTTGGTGCAGGG - Intergenic
1133238893 16:4403176-4403198 CTGTGGCTGGAGCTGCTGGATGG - Intronic
1133370018 16:5239989-5240011 CTGCGGCTGGGGCTGGAGGGGGG + Intergenic
1133398796 16:5469665-5469687 CAGGGGCTGGGGATGGAGGAAGG - Intergenic
1133857474 16:9563307-9563329 CTGGGGCTGGGGATGGGAAAAGG + Intergenic
1134070600 16:11257229-11257251 CCGGGGCTTGGGATGGTGGGCGG + Intronic
1134219014 16:12338775-12338797 CTGGGGGTGGGGATGGGGTAGGG - Intronic
1134240576 16:12503098-12503120 CTGGGGGTGGGGGTGGTGGATGG - Intronic
1134291290 16:12904109-12904131 CTGTGGTTGCGGAAGGTGGGCGG - Intronic
1135737140 16:24940758-24940780 ATGTGGCTGGAGAGGGTGGAAGG + Intronic
1135926466 16:26698097-26698119 CTGTTGCTGCAGATTGTGGAGGG - Intergenic
1135961321 16:26996747-26996769 AGGTCCCTGGGGATGGTGGAAGG - Intergenic
1136144317 16:28307028-28307050 CTGGGGCTGGGGCTGCTGGAGGG - Intronic
1136272181 16:29154898-29154920 CCAGGGCTGGGGATGGTGGGTGG + Intergenic
1136395115 16:29988250-29988272 CTGGGGCCAGGGGTGGTGGAGGG + Exonic
1136478665 16:30527740-30527762 CAGGCGCTGGGGAAGGTGGAGGG - Intronic
1136544404 16:30947587-30947609 CAGGGGCTGGGGGAGGTGGAAGG + Exonic
1137538049 16:49342385-49342407 CAGCGGCTTGGGATGGTGGTGGG + Intergenic
1138460165 16:57143300-57143322 CTGTGTGTGGGCATGGTGGCTGG + Intronic
1138795422 16:59962611-59962633 CTGTGGCTGTGGTTTGTGGCAGG + Intergenic
1139037472 16:62965217-62965239 CTGTGGGTGAGGATTTTGGAAGG + Intergenic
1139432519 16:66918749-66918771 CTGAGGCTGAGGTTGGTGGTGGG - Intronic
1139482426 16:67237822-67237844 CTGTTGCTGGGGAAGGGGAAGGG + Intronic
1139651350 16:68363749-68363771 CTGGGGCTGGGGGAGGAGGATGG - Intronic
1139722724 16:68869925-68869947 CAGTGAGTGGGGATGGTGGCTGG + Intronic
1140027432 16:71303439-71303461 CTGTGGCTGGGGGCGGTGGGGGG - Intergenic
1140031342 16:71341555-71341577 CTCTGGATGGGGATGGAGGGGGG + Intergenic
1140057805 16:71540808-71540830 CTGTTGCTGGGGGTTGGGGATGG - Intronic
1140094820 16:71865901-71865923 CTGTGGCTGGGGAGTCTGCAAGG + Intronic
1140338124 16:74130854-74130876 CTGAGGCTGGGAAGGGTAGAGGG + Intergenic
1140546996 16:75820327-75820349 CTGCAGATGGGCATGGTGGAAGG + Intergenic
1140980414 16:80103795-80103817 AAGTGGGTGGGGGTGGTGGACGG - Intergenic
1141048630 16:80740002-80740024 ATGTGGCTGTGGAGGGTGGTGGG + Intronic
1141635242 16:85310897-85310919 CAGGGGCTGGGGATGGAGGGGGG + Intergenic
1141665211 16:85462348-85462370 CTGAGGGTAGGGAGGGTGGAGGG - Intergenic
1141790862 16:86233113-86233135 CGGAGGCTGGGGATGGGGAATGG + Intergenic
1141792813 16:86248386-86248408 TGGTGGCTGGAGATGGGGGAGGG - Intergenic
1141875969 16:86824845-86824867 CGGTGGGTGGGGATGGTTGGTGG - Intergenic
1142015220 16:87742262-87742284 GTGTAGCTGGGGATGGTACAGGG - Intronic
1142205876 16:88782930-88782952 CTGTGTCTGGGGATGGGGCGTGG - Intronic
1142228358 16:88888317-88888339 CTGTGGCCTGGGCTGGGGGAGGG - Intronic
1142284698 16:89167005-89167027 CTGTGGCTGGGGATGGGGCTGGG - Intergenic
1142294915 16:89214493-89214515 CAGAGGATGGGGTTGGTGGAAGG + Intergenic
1142416058 16:89943206-89943228 CCGAGGCTGGGAAAGGTGGAGGG - Intergenic
1142479587 17:210648-210670 CTGCTGCTCGGGATGGTGGAGGG + Intergenic
1142488291 17:260819-260841 CTGTGCCTGGTGATGGGGGTGGG - Intronic
1142728161 17:1831477-1831499 CTGTGGATGGGAATGGTGGCAGG - Intronic
1142742981 17:1941564-1941586 CAGTGCCTGAGGATGGTGGAGGG + Intronic
1143092236 17:4455706-4455728 CTGTGGGTGGGGATGCCAGATGG - Intronic
1143116139 17:4582795-4582817 CTGAGGCTGGAGAGTGTGGATGG + Intergenic
1143118725 17:4594674-4594696 CTGTGATTGGGGATGGGGGTAGG + Intronic
1143150331 17:4803868-4803890 ATGTGGCTGGGGATGGTGGCGGG - Intergenic
1143203730 17:5129337-5129359 CTGTGGGTGGGGAGGAGGGAAGG + Intronic
1143521267 17:7445575-7445597 CTCTGGCCGTGGGTGGTGGACGG + Intronic
1143543987 17:7585764-7585786 CTGGGGCTGGGCATTGTGGCTGG + Exonic
1144037709 17:11382320-11382342 CTTTGGGAGGGGAAGGTGGAAGG - Intronic
1144125842 17:12202333-12202355 CTGTGGCATGTGATGGTGGAGGG + Intergenic
1144649614 17:16999037-16999059 CAGGGGCTGGGGAAGGGGGAAGG - Intergenic
1144733124 17:17540133-17540155 CCGTGGGTGGGGATGGGGCAGGG + Intronic
1144867616 17:18347010-18347032 CTGTGGCTGTGGATGGTGCCGGG + Intronic
1144874910 17:18392448-18392470 CTGTGGGTGGGGAGGAGGGAAGG + Intergenic
1144889716 17:18487638-18487660 CTCTGGCAGGTGATGGTGAACGG + Exonic
1145111780 17:20170059-20170081 CAGAGGCTGGGTCTGGTGGAAGG - Intronic
1145142495 17:20456658-20456680 CTCTGGCAGGTGATGGTGAACGG - Exonic
1145157315 17:20551973-20551995 CTGTGGGTGGGGAGGAGGGAAGG - Intergenic
1145252064 17:21302051-21302073 CTGGGGCTGGGGCTGGTGCTGGG + Intronic
1145781210 17:27564743-27564765 CTGTGGGTGGGGGAGGTGGGGGG - Intronic
1145793410 17:27642229-27642251 CTCTGGCAGGTGATGGTGAACGG + Exonic
1145808215 17:27749775-27749797 CTCTGGCAGGTGATGGTGAACGG + Intergenic
1145827537 17:27888346-27888368 CTCTTGCTGGGGTTGCTGGAAGG + Intronic
1146514132 17:33475798-33475820 CAGGGGATGGGGATGGGGGAGGG - Intronic
1146646156 17:34578901-34578923 CTGTTGCTGGGGAAGGAAGACGG - Exonic
1146884013 17:36459013-36459035 CTGAGGCTGAGGAAGGTGAAGGG + Intergenic
1147342050 17:39758507-39758529 CTGTGGCGAGGGATTGGGGAAGG + Intergenic
1147650671 17:42060066-42060088 CTGTGGCTGAGGATGTTGTCTGG - Intronic
1147976331 17:44250251-44250273 TTCTGGCTGGGGATGGCCGATGG - Exonic
1148020490 17:44549969-44549991 CTGTGACGGGGGAAGGTGAAAGG + Intergenic
1148206163 17:45781561-45781583 CTCTGGCTGGGGCTGAGGGAAGG + Intergenic
1148242076 17:46006421-46006443 CAGAGGCTGAGGAGGGTGGAGGG + Intronic
1148382391 17:47209488-47209510 CTGGGGCAGGGGCTGGTGCAGGG - Exonic
1148437254 17:47694207-47694229 CTGGGGCTAGGGCTGGGGGAGGG + Intronic
1148450845 17:47777132-47777154 CAGTGGGTGAGGCTGGTGGAGGG - Intergenic
1148464761 17:47858164-47858186 CTGGGGCTGAGGATGGGGGCCGG - Intergenic
1148806897 17:50268503-50268525 CTGTGGGCCGGGAGGGTGGAGGG - Intergenic
1149287087 17:55176912-55176934 GTGAGGGTGGGGCTGGTGGAAGG - Intergenic
1149486364 17:57045993-57046015 CCCAGGCTGGGGATGGTGGCGGG - Intergenic
1149493448 17:57101426-57101448 CGGGGGTTGGGGGTGGTGGAGGG - Intronic
1150230723 17:63548810-63548832 CTTTAGCTGGGCATGGTGGCGGG + Intronic
1150580471 17:66469171-66469193 CTCTGGCTGGGGGTAGAGGAGGG - Intronic
1151562408 17:74877781-74877803 CTTTGGCTGAGGATCGAGGAAGG + Exonic
1151620299 17:75240914-75240936 CTGAGGCCTGGGGTGGTGGAGGG + Exonic
1151669631 17:75564986-75565008 CTCTAGCTGGGGAGGGTGGCAGG - Intronic
1151679289 17:75615168-75615190 CTGTGCCTGGGGCTGGAGGGAGG + Intergenic
1151889146 17:76941943-76941965 CTGTGGCTGAGGGTGGTGCCTGG + Intronic
1151905309 17:77044363-77044385 TTGTAGCTGGGCATGGTGGCAGG - Intergenic
1152036153 17:77874368-77874390 CTGTGTTTGGTGATGGTGCAGGG - Intergenic
1152163926 17:78689005-78689027 TTTTGGCTAGGGTTGGTGGATGG + Intronic
1152210786 17:79001958-79001980 GTGGGGCTGGGGAGGGAGGAGGG - Intronic
1152250944 17:79212259-79212281 CTGGGGCTGGGGCTGGGGCAGGG + Intronic
1152266118 17:79295878-79295900 CTGTGGCAGGGCATGGGGAAGGG + Intronic
1152269580 17:79316163-79316185 GGGTGGCTGGTGATGGTGGAGGG + Intronic
1152276763 17:79362541-79362563 CTGTGGCTTGGGATGGAGATGGG + Intronic
1152308633 17:79535884-79535906 CAGTGGCTGGGGGAGGTGCAGGG - Intergenic
1152461685 17:80445225-80445247 CGCTGGCTGGGGATGCTGGTGGG + Intergenic
1152550523 17:81027757-81027779 CTGGAGCTGGGCAGGGTGGAGGG - Intergenic
1152553728 17:81042715-81042737 ATGGGGGTGGGGATGGTGGTGGG + Intronic
1152626704 17:81390922-81390944 CTGAGGCTGGGGCTGGCGGCAGG - Intergenic
1152790337 17:82275223-82275245 TTGTGGCTGGGGCTGGTGGTGGG - Intergenic
1152844015 17:82588315-82588337 CTGTGGCTGTGGATGCTCTAAGG + Intronic
1153010256 18:532196-532218 GTGGGGCTGGGGATGGAGGCAGG + Intergenic
1153429343 18:4999080-4999102 CTGCTGCTGGGGATGAAGGAGGG - Intergenic
1153586487 18:6626059-6626081 CTCTGGATGGAGATGGTGGATGG + Intergenic
1154133582 18:11757389-11757411 CTCTGGCTGTGGATGGAGAACGG + Intronic
1154204672 18:12326775-12326797 AGGTGGCTGCGGATGGAGGAGGG - Intronic
1154336565 18:13470760-13470782 GTGTGGCTGAGGAGGGTGGCTGG - Intronic
1154336703 18:13471635-13471657 GTGGAGCTGGGGAGGGTGGAGGG + Intronic
1154460285 18:14576641-14576663 CTGTGGTGGGGGAGGGGGGAGGG + Intergenic
1155075729 18:22352593-22352615 CAGAGGCTGGGGAAGGTAGAGGG - Intergenic
1155407305 18:25503054-25503076 CTGAGGCTGGGAAGGGTGGGAGG + Intergenic
1155526508 18:26721314-26721336 CTGGGGATGGGGATGGAGGCAGG + Intergenic
1156292401 18:35759450-35759472 CAGAGGCTGGGGAGGGGGGAGGG + Intergenic
1156493700 18:37511939-37511961 CTGGGGGTGGGGATAGAGGAGGG + Intronic
1156516055 18:37681567-37681589 TTGTGGCTGGGGATTGGTGAGGG + Intergenic
1156541317 18:37913738-37913760 CTGTGGCTGAAGGAGGTGGATGG - Intergenic
1157293704 18:46427144-46427166 CTGGGGATGGAGATGGTGGAGGG + Intronic
1157294301 18:46431514-46431536 CTGGGGCTGTGGAGGGTGCAGGG + Intronic
1157335430 18:46734031-46734053 CTGGACCTGGGGATGGTGGAGGG - Intronic
1157518021 18:48324782-48324804 GTTGGGCTGGGGATGGTGGCAGG + Intronic
1157619029 18:49004673-49004695 GTGTAGCTGGGCATGGTGGCAGG + Intergenic
1157754547 18:50206256-50206278 AAATGGCTGGGGCTGGTGGAGGG - Intergenic
1158468369 18:57712280-57712302 CTGGTGCTGGGGCTGGGGGAGGG - Intronic
1158478877 18:57803357-57803379 CTGGGGCTGGGGCTGGAGGCGGG + Intergenic
1158570197 18:58591629-58591651 GTGTGCCTGTGGTTGGTGGAGGG + Intronic
1158920434 18:62186563-62186585 CTGTGGGTGGGGACGGGGGCTGG - Intronic
1159038140 18:63297062-63297084 ATTTAGCTGGGGATGGTGGCGGG + Intronic
1159905162 18:74083246-74083268 CTATGCCTGGGGAGAGTGGAAGG - Intronic
1160321451 18:77900076-77900098 CTGAGGCTGGGGAGGGTCTAAGG - Intergenic
1160390103 18:78523622-78523644 CTGTGGCTGCACATTGTGGAGGG - Intergenic
1160404823 18:78638146-78638168 CTGGGGCTGGGGAGGGCGGCTGG + Intergenic
1160665328 19:325487-325509 CTGTGGCTGGAGGAGGTGGGAGG - Intronic
1160733226 19:650240-650262 CCCAGGCTGGGGATGGTGGCGGG + Exonic
1160963260 19:1734201-1734223 GTGTGGCTGGGGGTTGTGGGGGG - Intergenic
1160983468 19:1827149-1827171 CTGAGGCTGGGGAGGGCAGAGGG + Exonic
1161054202 19:2181757-2181779 CTGGGGCTGGGGCTGGTGCTGGG - Intronic
1161311285 19:3595584-3595606 CAGGGGCTGGGGGTGCTGGATGG - Intronic
1161322750 19:3648873-3648895 TTGAGGCTGGGGGTGATGGAGGG - Intronic
1161448266 19:4329817-4329839 TTGGGGCTGGGGGTGGGGGAGGG - Intronic
1161803016 19:6426205-6426227 CTGAAGCTGGGGTTGGTGGTGGG - Exonic
1161845452 19:6709613-6709635 CTGGGGCTGGGGGAGGTGGGTGG - Intronic
1161846389 19:6713831-6713853 CTGGGGGTGGGGAAGGTGGGGGG - Intronic
1161928963 19:7323408-7323430 CAGGGGCTGGGGAGGGGGGATGG - Intergenic
1161937835 19:7382968-7382990 CTGTGACTGGGGCTGGTGGTGGG + Intronic
1161972241 19:7588986-7589008 TTGAGGCTGGGCATGGTGGCTGG + Intergenic
1162184833 19:8896813-8896835 GTGGGGCTGGGGACGGGGGATGG + Exonic
1162185255 19:8899974-8899996 GTGGGGCTGGGGAGGGAGGATGG + Exonic
1162186055 19:8905986-8906008 GTGGGGCTGGGGAGGGAGGATGG + Exonic
1162187382 19:8916542-8916564 GTGGGGCTGGGGCTGGAGGATGG + Exonic
1162666907 19:12221007-12221029 CTGTTGCTGGGGGTGGGAGAGGG + Intergenic
1162899789 19:13787917-13787939 CGGTGGCTGGGGGTGCTGCAGGG + Intergenic
1162958242 19:14111810-14111832 CAGTGGGTGGGGAGGGTGGAGGG + Intronic
1162986996 19:14277324-14277346 CTGTGCCTGGGGTTGCTGGCGGG + Intergenic
1163283925 19:16334424-16334446 CAGTGGCTGGGGAGGGAGAATGG - Intergenic
1163441199 19:17323554-17323576 CTGGGGCTGGGGCTAGGGGAGGG + Exonic
1163499797 19:17669510-17669532 CTGGGGCTGGGGCTGGGTGAAGG + Intronic
1163565370 19:18048081-18048103 ATGTAGCTGGGCATGGTGGCAGG - Intergenic
1163598458 19:18233815-18233837 TTGTTGCTGGGGAAGGTTGAGGG - Intronic
1163628678 19:18405244-18405266 AGGTGGCTGGGGAAGGGGGAGGG - Intergenic
1163633411 19:18428036-18428058 CTGTGGCTGGGGAGGTGGGGTGG + Intronic
1163699013 19:18777839-18777861 CACGGGCTGGGGATGGCGGATGG - Exonic
1164823766 19:31269062-31269084 GTGTGGCTGGAGATAGAGGAAGG - Intergenic
1165071861 19:33260531-33260553 CTGAGGCTGGGACTGGAGGAAGG + Intergenic
1165098209 19:33421906-33421928 TGGTGGCTGGGGATGGTGAATGG + Intronic
1165258777 19:34596246-34596268 CTGTGGCTGAGCAGGGAGGATGG + Exonic
1165709938 19:38003892-38003914 CTGGGGGTGGGGGTGGGGGATGG - Intronic
1165749367 19:38250981-38251003 CTGGGACTGGGGATGGGGGTGGG + Intronic
1166117922 19:40667193-40667215 CTGTGTCTGGGGTTGGGGAAGGG + Exonic
1166317167 19:41995745-41995767 CTCTCCCTGGGGATGGTAGAAGG + Intronic
1166327736 19:42061655-42061677 GTGGGGCTAGGGATGGTGCAAGG - Intronic
1166877710 19:45907733-45907755 TTCTAGCTGGGGATGGTGGATGG + Intergenic
1166943616 19:46383907-46383929 CTGCGGCTGGGGGTGGAGGTGGG - Intronic
1167042731 19:47032261-47032283 CTGGGGCTGGGGCAGATGGAAGG - Exonic
1167254536 19:48419369-48419391 CCGAGGCGGGGGATGGAGGAAGG - Intronic
1167477515 19:49709468-49709490 TTGGGGATGGGGATGGAGGAGGG - Intronic
1167499263 19:49836257-49836279 TGGTGGCTGGAGGTGGTGGAGGG - Exonic
1168509788 19:56965378-56965400 CAGGGGCTGGGGAAGGGGGACGG - Intergenic
1168591001 19:57634102-57634124 ATCTGTCTGGGGAGGGTGGAGGG - Intronic
1168672137 19:58248660-58248682 CAGGGGCTGGGGATGAGGGAGGG - Intronic
1168715303 19:58523513-58523535 CTCTAGCTGGGCATGGTGGCGGG + Intronic
924999312 2:392429-392451 CTGTGGCTGGTGGAGGTGGGAGG + Intergenic
925004242 2:428828-428850 CTGGGGCTGGGCATGGCTGAGGG - Intergenic
925156103 2:1649864-1649886 CTGTGTTTGGGGCTGGAGGAGGG - Intronic
925178412 2:1800663-1800685 TTGAGGCTGGGGAAGGTTGAGGG - Intronic
925398884 2:3557999-3558021 CTGTGGCTGTGGGTGGTCGGGGG - Intronic
925751110 2:7091076-7091098 CTCTGCCTGGGGATGATGCAGGG + Intergenic
926045054 2:9704081-9704103 CTGTTGTGGGGGATGGTGGCTGG + Intergenic
926145497 2:10394717-10394739 CTGTGGCCGGGAGTGGTGTAAGG + Intronic
926165860 2:10521932-10521954 CTGTGACTGGGTGTGGGGGAGGG + Intergenic
926701531 2:15807427-15807449 GTGGGGGTGGGGATGGTGGTAGG - Intergenic
926703502 2:15819885-15819907 CTGTGGCTGGGGCTGTGGGAGGG + Intergenic
927153476 2:20208930-20208952 CTGTGGGTGGGGAAGGGGCAAGG - Intronic
927177672 2:20421963-20421985 CTGGGCCTGGGGATGGTGGAGGG - Intergenic
927186088 2:20483687-20483709 CTGTGGCTGAGGCTGGCTGAGGG - Intergenic
927315242 2:21674207-21674229 CAGTGGCTGTGAATGCTGGAAGG - Intergenic
927920357 2:26967513-26967535 CTGGGGCTGGGTGTGGTGGGTGG + Intergenic
928096975 2:28410695-28410717 CTCTGGCTGGGGATGAAAGAAGG + Intronic
928260087 2:29758632-29758654 CAGTGCCTGGGGAGGGAGGAGGG - Intronic
928275682 2:29898149-29898171 CTGGGGCTGGGGAAGGTGGCAGG - Intronic
928780808 2:34818181-34818203 CTGTGGCAGGGGAGGGAGCAAGG - Intergenic
928845759 2:35669862-35669884 CTGTGGCTGGGAAGGGTAGTTGG - Intergenic
929300970 2:40303370-40303392 CACTGGCTGGGGAAAGTGGAAGG + Intronic
929536583 2:42787933-42787955 TTGTGGCTGGGGCAGGTGGGAGG - Intronic
929552082 2:42900773-42900795 CTGTTGCTGGGGCCTGTGGATGG + Intergenic
929935144 2:46289230-46289252 CTCTGCCTGGGGATGGAGGTGGG - Intergenic
930024864 2:47023873-47023895 TAGGGGCTGGGGATGGTGGAAGG - Intronic
930052325 2:47225956-47225978 CTTTGGGTGGTGATGGTGGGTGG + Intergenic
930198180 2:48529734-48529756 CTCTGGGTGGGGATGATGGAGGG - Intronic
930614524 2:53579486-53579508 CTGAAGCTGGGGATGGGGTAGGG - Intronic
930878424 2:56245411-56245433 CTCTGCCAGGGGATGGAGGAGGG + Intronic
930902141 2:56520700-56520722 CTTTGTCTTGGCATGGTGGAAGG + Intergenic
931137575 2:59421102-59421124 ATGTAGCTGGGCATGGTGGCGGG + Intergenic
931147514 2:59535247-59535269 CTGTGGGTGGGGTTGGAGGCTGG + Intergenic
931327756 2:61244464-61244486 AATTGGCTGGGGATGGTGGCAGG + Intronic
932376947 2:71245006-71245028 CTGTGGCTGTGTGTGGTGGGGGG - Intergenic
932425530 2:71631973-71631995 TTGGGGCAGGGGGTGGTGGAGGG - Intronic
932617659 2:73244963-73244985 CTGTGTCAGTGGGTGGTGGAGGG + Intronic
932618433 2:73251098-73251120 TTGGGGCTTGGGATGGAGGAAGG + Intronic
932767099 2:74477634-74477656 CTATGGCTGGAGATGGTGGCTGG - Intronic
932930308 2:76028760-76028782 CAGAGGCTGGGGATGGTGGTGGG - Intergenic
933174128 2:79157601-79157623 CCGGGGCTTGAGATGGTGGAGGG + Exonic
933695326 2:85213140-85213162 CTGTGGCTGGGGTGGGGGGAGGG + Intronic
934527728 2:95062026-95062048 CCGTGGCTGGGGAGGAAGGAAGG - Intergenic
934712967 2:96527656-96527678 CTGGGGGTGGGGAGGGGGGAGGG - Intergenic
934781216 2:96970950-96970972 CTGGGGGTGGGGATGGGGGCAGG - Intronic
934858708 2:97745702-97745724 CTGTGGGTGGGGATGTGAGATGG + Intergenic
935185757 2:100731337-100731359 CTCTTGCTGGGTATGGTGCAGGG - Intergenic
935334603 2:102004887-102004909 CCTTGGCTGGAGATGGTGGTGGG + Intronic
935580618 2:104753067-104753089 CTGTGGCTGGGAAGGGTAGAGGG + Intergenic
935796294 2:106644603-106644625 CTGTGGCTGAGTGTGGTGGTGGG + Intergenic
935945619 2:108283722-108283744 CTGTGGGTGGGAATGGGGGAAGG - Intergenic
935954586 2:108363044-108363066 CTGTGGGTGGGGTTTGGGGATGG + Intergenic
936644624 2:114354819-114354841 ATGTGTGTGGGGTTGGTGGATGG - Intergenic
936770843 2:115911250-115911272 CTGTGAGTGGGGAAGGTGAAAGG + Intergenic
936963055 2:118097052-118097074 CTGAGGCTGGGGGTGGGGAATGG - Intronic
937018066 2:118624429-118624451 ATGTTGTTGGGGGTGGTGGATGG - Intergenic
937054217 2:118918027-118918049 CTGTGGCCAGGGGTGGTAGAAGG - Intergenic
937102382 2:119281914-119281936 GTGGGCCTGGGGATGGTTGAGGG - Intergenic
937144812 2:119635499-119635521 CTGTGGATGGGTTGGGTGGATGG + Intronic
937414604 2:121704356-121704378 CTGCAGCTGGGAATGGGGGAAGG + Intergenic
937675839 2:124589194-124589216 CAGGGGCTGGGGGTGGTGGAGGG - Intronic
938082009 2:128375032-128375054 CTGGCGCTGGGGAGGGTGGCAGG + Intergenic
938341197 2:130537746-130537768 CTGTAGCTGGGAATGGAGGATGG - Intergenic
938348634 2:130582963-130582985 CTGTAGCTGGGAATGGAGGATGG + Intronic
938562789 2:132489410-132489432 CTGTGACTGGGGCTGGCGGCAGG + Intronic
939609167 2:144289180-144289202 CTCTAGCTGGGTATGGTGGCAGG - Intronic
939678677 2:145104123-145104145 CTGGGGGTGGGGAAGCTGGATGG - Intergenic
939712614 2:145541765-145541787 GGGTGGTTGGGGATGGGGGATGG + Intergenic
939998062 2:148938660-148938682 CTGTGGCTGGGGAGGGTGAAGGG + Intronic
940144499 2:150532031-150532053 TAGTGGCTGGGGTTGGTGGGGGG + Intronic
941711084 2:168714106-168714128 CTGTGTCTTCGTATGGTGGAAGG + Intronic
941867663 2:170351436-170351458 TTCTGGCTGAGGATGGTAGAAGG + Intronic
942365305 2:175219950-175219972 CTAAGGCTGGGGTTGGGGGATGG + Intergenic
942505199 2:176634550-176634572 CTGGGGGTGGGGATGGTTGAAGG + Intergenic
942786583 2:179708331-179708353 ACATGGCTGGGGAGGGTGGAAGG - Intronic
942848159 2:180451056-180451078 CTGAGGCTGGGAAGGGTAGAAGG - Intergenic
944318271 2:198306858-198306880 CTGTGCCTGGGGAGTGTGTAGGG - Intronic
944822046 2:203441026-203441048 CTGGGGTTGGGGGTGGAGGAGGG + Exonic
945226590 2:207537201-207537223 CTTTAGCTGGGCATGGTGGCAGG - Intronic
945676219 2:212858449-212858471 CTTTGGCTGGGGATGATGAGTGG + Intergenic
946375111 2:219303096-219303118 ATGAGGCTGGGGATGGAGAAGGG + Intronic
946425493 2:219593375-219593397 CTTTAGCTGGGCATGGTGGTGGG - Intergenic
946919691 2:224566065-224566087 CTGTAGATGGGGAAGGTGGGGGG - Intronic
947114903 2:226759090-226759112 CTGTGTCCGGGGCTGGTGCAAGG + Intronic
947743686 2:232496882-232496904 CTGAGGCTGGGGGCGGTGGGTGG - Intergenic
947820946 2:233069020-233069042 CTGGGGCTGAGGACGATGGAAGG + Intronic
948088118 2:235267500-235267522 CTGTGGCAGGAGAGGTTGGAAGG - Intergenic
948384452 2:237572927-237572949 CCCTGGCAGGGGATGGGGGAGGG - Intergenic
948465061 2:238148295-238148317 CTGGGGCTGGGGGTGGGGGTGGG + Intronic
948800202 2:240430022-240430044 CTGGGGAGGGGGATGGGGGAAGG - Intergenic
948807306 2:240458628-240458650 CTGAGGATGGGGAAGGAGGAAGG - Intronic
948840214 2:240645068-240645090 GTGGGACTGGGGATGGTGGTCGG + Intergenic
948861784 2:240756113-240756135 CCTTGGGTGGAGATGGTGGAAGG - Intronic
949062989 2:241972155-241972177 CTGTGGCCTGGGAAGGTGGGTGG + Intergenic
1168932181 20:1632742-1632764 CTGGGGCTGGTGTTGGGGGATGG - Intronic
1169042827 20:2509634-2509656 CTGAGGCTGAGGCTGGAGGATGG + Intronic
1169074201 20:2751563-2751585 CTTGGGCTGGGCCTGGTGGAGGG + Intronic
1169084970 20:2820917-2820939 GTGGGGCTGGGGGTGGGGGAGGG + Intergenic
1169270516 20:4195698-4195720 CTGTGGCTGGGCAGGGTAGGGGG + Intergenic
1169369130 20:5015203-5015225 CTTTGGCTGGGGAGGGAGAATGG + Intergenic
1170446550 20:16433954-16433976 CTGTGTCTGGAGTTGGGGGAGGG - Intronic
1170848509 20:19982458-19982480 TGGTGGCTGAGGAGGGTGGAAGG - Intronic
1170884225 20:20325136-20325158 AAGTGGCTGGGGGTGGAGGAGGG - Intronic
1171175951 20:23050737-23050759 CTGTGGATGGGCAGGGTGGGGGG + Intergenic
1171524280 20:25797188-25797210 CTGTGGCTGGGGCTGGGGCTGGG - Intronic
1171531558 20:25856711-25856733 CTGGGGCTGGGGCTGGTGTTGGG - Intronic
1171543495 20:25984255-25984277 CTGGGGCTGGGGCTGGTTGCAGG + Intergenic
1171552547 20:26058695-26058717 CTGTGGCTGGGGCTGGGGCTGGG + Intergenic
1171806936 20:29688915-29688937 CTGTGGCTGGGGCTGGGGCTGGG + Intergenic
1172186604 20:33034923-33034945 CTGTGGCTGGGGAGGAAGGCCGG + Intronic
1172247565 20:33456437-33456459 TTTTGGCTGGAGATGGTGAAAGG + Intergenic
1172247677 20:33457120-33457142 TTTTGGCTGGAGATGGTGAAAGG + Intergenic
1172569546 20:35958781-35958803 CTGTGGTTAGGGATAGGGGAAGG - Intronic
1172647143 20:36477652-36477674 CTGAGGCTGAGGCAGGTGGAGGG - Intronic
1172841723 20:37906039-37906061 CTGTGTCTGGGGGTGGGGGGTGG + Intronic
1172966934 20:38842690-38842712 CTGTGCCTGGGGGTGGGGGAGGG - Intronic
1173347663 20:42215771-42215793 CACTGGCTGGGGATGCTGCAAGG - Intronic
1173400825 20:42724472-42724494 TTGGGGTAGGGGATGGTGGAGGG - Intronic
1173504121 20:43573771-43573793 CTGTGTTTGGGTATGGTGGGTGG + Intronic
1173590117 20:44218178-44218200 CTGTGGATGGGGCTGGAGGTGGG + Intergenic
1173736265 20:45363625-45363647 CTGTGGCTGGCGCTGGTGGACGG + Exonic
1174054427 20:47788223-47788245 CTGGGGCCTGGGGTGGTGGAGGG + Intergenic
1174368599 20:50071359-50071381 CCGAGGCTGGGGCTGGAGGAGGG - Intergenic
1174394372 20:50237580-50237602 CTGTGGGTATGGATGGTGGCTGG + Intergenic
1174665528 20:52254347-52254369 CTGTGGCTGGGGCAGAAGGATGG - Intergenic
1174791915 20:53486841-53486863 CTGGGGCTGGGGAGGGAGGAAGG - Intronic
1175146195 20:56898006-56898028 CTCTTTCTGGTGATGGTGGAGGG + Intergenic
1175166295 20:57047094-57047116 CTGAGGCTGGGGGTGGTCAACGG - Intergenic
1175263137 20:57687270-57687292 CTGTGCCTGGGGCTGGTCCAAGG + Intronic
1175332511 20:58175214-58175236 CTGGGGCGGGGGATGGAGGTGGG - Intergenic
1175408198 20:58748787-58748809 CTGTGGTTGGGGAGGGAGGGAGG - Intergenic
1175554997 20:59845318-59845340 TTGTGGCGGGGGACGGGGGAAGG - Intronic
1175643505 20:60651330-60651352 CTGTGCCTTGGGTTGGAGGAGGG - Intergenic
1175679921 20:60978557-60978579 CTGTGGCTGGGGGTGGGCGTAGG - Intergenic
1175681654 20:60993814-60993836 CTGTGGCTGTGTGTGGTGTATGG - Intergenic
1175751329 20:61499902-61499924 CTGTGGCAGGGGTGGTTGGAAGG + Intronic
1175788644 20:61727829-61727851 TTGTGGCTGGGGGTGGTCGGGGG - Intronic
1175876546 20:62232899-62232921 CTGGAGCTGGGGATGGGGGTTGG - Intronic
1176132893 20:63503729-63503751 CTGTGGGAGGCGATGGTGGGCGG - Intergenic
1176182638 20:63758123-63758145 CTCTGGATGGGGCGGGTGGAGGG - Intronic
1176232408 20:64039054-64039076 CGGTGGCGGGGGGCGGTGGAGGG + Intronic
1176363467 21:6017950-6017972 CCCTGGCTGAGGGTGGTGGAGGG - Intergenic
1176678172 21:9800780-9800802 ATTTGTGTGGGGATGGTGGAAGG + Intergenic
1177148673 21:17432933-17432955 TTGGGGCGGGGGATGGGGGATGG - Intergenic
1178013369 21:28313453-28313475 CTGGGGCTAGGGAAAGTGGAAGG - Intergenic
1178151940 21:29805140-29805162 CTGTGGCTGCAGGGGGTGGAGGG - Intronic
1178360868 21:31947726-31947748 CACTGACAGGGGATGGTGGAGGG - Intronic
1178804010 21:35823693-35823715 CTGAGGCTGGAGACGGTGGCGGG - Intronic
1178981244 21:37267204-37267226 CTGGGGGTGGGGATGGAGGTGGG - Intronic
1179060641 21:37975840-37975862 TGGTGGCTGGGCATGGTGGCAGG + Intronic
1179409874 21:41154220-41154242 CTGTGGCAGGTGAGGGAGGATGG + Intergenic
1179493716 21:41758246-41758268 CTGAGGATGGGGATGAGGGAAGG - Intronic
1179562958 21:42228380-42228402 CTGTGGCTGGGGAGGGCAGTGGG - Intronic
1179623291 21:42632752-42632774 AGGTGGTTGGGGATGGTAGAGGG + Intergenic
1179633168 21:42691152-42691174 CTTTGGATGGTGATGGTGAAGGG - Intronic
1179633204 21:42691342-42691364 CTTTGGATGGTGATGGTGAAGGG - Intronic
1179633317 21:42691954-42691976 CTTTGGATGGAGATGGTGAAGGG - Intronic
1179719411 21:43306784-43306806 TTCTGGGTGGGGCTGGTGGAGGG - Intergenic
1179760051 21:43520595-43520617 CCCTGGCTGAGGGTGGTGGAGGG + Intergenic
1179934376 21:44592882-44592904 CTGTGTCCGGTGATGGGGGAAGG - Intronic
1180035318 21:45245404-45245426 CTGGGGATGGAGATGGTGTACGG - Intergenic
1180439523 22:15351370-15351392 CAGTGTGTGGGGATGGGGGAGGG - Intergenic
1180884593 22:19232220-19232242 CTTTGGGTGGTGATGGTGTAGGG - Intronic
1181031419 22:20150296-20150318 CTGCGGCTGGGGCTGGGGCAGGG + Intronic
1181050533 22:20236378-20236400 CAGTGGCTGGGCTCGGTGGAGGG - Intergenic
1181079139 22:20402203-20402225 CAGTGGAGGGGGATGGAGGAGGG - Intronic
1181387817 22:22558141-22558163 CAGTGGGGGGGGATGGAGGAAGG + Intronic
1181511912 22:23393100-23393122 CTGGGGCTGGGGCTGGGGCAGGG - Intergenic
1181635117 22:24170877-24170899 CTGGTGCTGGGGAGGGTTGAAGG + Intronic
1181833979 22:25587031-25587053 CTGTAGCTGGGCGTGGTGGCAGG - Intronic
1181917299 22:26291631-26291653 CTCTGGCTGGGCTTGGGGGATGG - Intronic
1182273418 22:29170049-29170071 GGGTGGCTGGGGAGTGTGGAGGG + Intergenic
1182302129 22:29342860-29342882 ATGTGGCAGGGGCCGGTGGAGGG - Intronic
1182548405 22:31088619-31088641 CTGGGGCAGGGGATGGGGGCAGG + Intronic
1182950781 22:34373739-34373761 ATATGGCTGGGGAGGGGGGAAGG + Intergenic
1183024286 22:35052426-35052448 CTGGGGATGGGGATGGTGGATGG - Intergenic
1183034908 22:35134232-35134254 GTGGGACTGGGGAGGGTGGAGGG - Intergenic
1183107140 22:35622721-35622743 CCAAGGCTGGGGAGGGTGGAGGG - Intronic
1183142114 22:35952091-35952113 TTTTGGCTGGGGATGGTGAAGGG - Intronic
1183177902 22:36237888-36237910 CTGAGGCTGGGGATGGGAGTGGG - Intronic
1183314734 22:37130540-37130562 ATGTGGCTGGGGGTTGGGGATGG - Intronic
1183603073 22:38851202-38851224 CTGTGGCTAGTGCTGGTGGCAGG - Intergenic
1183668016 22:39256308-39256330 CTGTGGCTGGGGAGGATTGTGGG - Intergenic
1184032341 22:41902525-41902547 CTGTCGATGGGGCTGGGGGAAGG - Intronic
1184105597 22:42365867-42365889 CTGGGGGTGGGGATTGTGGTAGG - Intergenic
1184421865 22:44386825-44386847 CTGGGGCTGTCCATGGTGGATGG - Intergenic
1184423027 22:44392774-44392796 CTGGGGCTGGGGCTGGGGGTTGG - Intergenic
1184765313 22:46569204-46569226 CAGAGGCTGGGGAGGGAGGATGG + Intergenic
1185079812 22:48703494-48703516 GTGGGGCTGAGGATGGGGGAGGG - Intronic
1185088165 22:48751975-48751997 CTGTGGCTGGTGAGGCTGGTGGG + Intronic
1185411175 22:50683795-50683817 TGGTGGAGGGGGATGGTGGAGGG + Intergenic
949258979 3:2083773-2083795 CAGCGGCTGCGGATGGTGTACGG + Intergenic
949410206 3:3755242-3755264 CTCTGACTGGGTATGGAGGATGG + Intronic
949491212 3:4590874-4590896 TTGTGGAGGGGGAGGGTGGAAGG - Intronic
949775693 3:7630189-7630211 CTGGGGATGGTGATGGTGGTGGG + Intronic
950107537 3:10397774-10397796 CTGCAGGTGGGGATGTTGGAGGG - Intronic
950158826 3:10743753-10743775 CAGTGGCGGGGGAGGGTGGAGGG - Intergenic
950194824 3:11001595-11001617 CAGGGGCAGGGGATGGTTGATGG + Intronic
950329322 3:12143989-12144011 CTGGGGCTGGAGGTGGTGGGCGG + Intronic
950520115 3:13493160-13493182 CTGTGGGTGGGGCAGGTGGGGGG - Intronic
950539994 3:13606451-13606473 TTGTGACTGGGGAGGCTGGAAGG - Intronic
950695781 3:14700112-14700134 CTGCTGCTGGGGATGGGGAAGGG + Intronic
950786993 3:15445183-15445205 ACGTGGCTGGGCATGGTGGCAGG - Intronic
950941667 3:16898908-16898930 CTGTGGCAGGGGTTGGAGGGTGG + Intronic
951368858 3:21818180-21818202 ATGGGGGTGGGGATGGGGGAGGG + Intronic
952460621 3:33521883-33521905 AAGGGGCTGGGGCTGGTGGAGGG - Intronic
952494637 3:33905018-33905040 ATGGGGCTGGGGAGGGTGGCAGG + Intergenic
952743790 3:36759752-36759774 CTGTGTCTGGGATTGGAGGAGGG - Intergenic
952816339 3:37451261-37451283 CTGGGGGTGGGGATGGGGGTAGG + Intergenic
953222897 3:40989551-40989573 CTGGGGCTGGGGTTGCTGAAAGG - Intergenic
953390777 3:42532484-42532506 CTGGAGCAGGGGATGGTGGTGGG - Intronic
953556793 3:43952404-43952426 CAGTGGCTTGGGATGGGGCAGGG - Intergenic
953978304 3:47399227-47399249 CTGGTGCTGGGGGTGGGGGATGG + Intronic
953999919 3:47548237-47548259 ATGTAGCTGGGCATGGTGGTGGG + Intergenic
954036878 3:47855592-47855614 CTGTGGCATGGGGTGGTGGAAGG - Intronic
954380796 3:50218005-50218027 CTGTGGCTGGGAGTGGGGGTGGG + Intronic
954381328 3:50220736-50220758 CTGAGGGTGGGGCTGGTGTAGGG + Exonic
954461363 3:50628845-50628867 CTGGGGCTTGGGAAGGTGAAAGG + Intronic
954787909 3:53108535-53108557 CATTAGCTGGGGATGGTGGCGGG - Intronic
954791348 3:53135700-53135722 CAGAGGCTGGGCATGGTGGCTGG - Intergenic
954854082 3:53627597-53627619 CTGTGGCTGTGGATGGGTGGGGG + Intronic
954902544 3:54032129-54032151 CTGGGGCAAGGGATGATGGATGG + Intergenic
954922370 3:54202985-54203007 CTGTGTCTGGGGATCATGGCTGG + Intronic
955439202 3:58937354-58937376 ATCTGACTGGGGATGGGGGAAGG - Intronic
955989633 3:64612580-64612602 CTGTGGCTGGTCAGGGTGAAGGG + Intronic
956730386 3:72190992-72191014 CTGTAGCCGGGCATGGTGGCGGG - Intergenic
956737247 3:72247271-72247293 GCGTGGGTGGGGAGGGTGGAAGG - Intergenic
957094727 3:75768174-75768196 CTTTAGATGGGGTTGGTGGAAGG - Intronic
958147605 3:89646664-89646686 TTGGGGCAGGGGATGGAGGATGG - Intergenic
958744208 3:98113471-98113493 ATGTGTCTTGGGAAGGTGGAGGG - Intergenic
959433308 3:106282674-106282696 CTGTGGCTTCCAATGGTGGAAGG - Intergenic
959991750 3:112638828-112638850 TTGTGGCTGGGGCAGGAGGAAGG + Exonic
960360252 3:116702492-116702514 CTGTCTCTGGGGATGCTGGTTGG - Intronic
960439167 3:117665672-117665694 ATGTGGCTGGGGGTGGTTGTAGG + Intergenic
960593845 3:119390711-119390733 CTGTGGATGGGGAATCTGGATGG + Intronic
960868968 3:122230526-122230548 CTGTTGCAGGGGGTGGGGGATGG - Intronic
961391604 3:126555650-126555672 CTGTGGCAGGGAGTGGTGGCTGG - Intronic
961746095 3:129064312-129064334 CTGTGGGTGGAGAGGGTGGAGGG + Intergenic
961810845 3:129520928-129520950 GTGGGGCTGGGGAAGGTGGATGG - Intergenic
962016692 3:131448358-131448380 CATTAGCTGGGCATGGTGGAGGG - Intergenic
962488362 3:135866557-135866579 ATGTAGCTGGGGATGGGGGTTGG - Intergenic
962667395 3:137668897-137668919 CTGTGGCTGGGGACAGTTAAAGG + Intergenic
962702845 3:138016171-138016193 CTGAGGCTGGGGGTGAGGGAAGG + Intronic
962708463 3:138066940-138066962 CTGTGGCTGGGGTTGGAGCCTGG + Intronic
962886221 3:139630383-139630405 CTGGGACTTGGGAGGGTGGAAGG + Intronic
962973310 3:140424872-140424894 CTGTGGTAGGGGAGGGTGGGTGG + Intronic
962980955 3:140489553-140489575 CTGGGCCTGGGGGTAGTGGAAGG + Intronic
963088024 3:141456236-141456258 CTGTGGATGGGGCTGGGGTAGGG - Intergenic
963740908 3:149079879-149079901 TTGTGGCTGGGCATGGGGCATGG - Intronic
963810154 3:149768546-149768568 CTCTGTCTGGGGAGGGGGGATGG - Intronic
964294607 3:155219719-155219741 CTGTTGTGGGGGATGGGGGAGGG - Intergenic
964542646 3:157796718-157796740 CTGTGGGTGAGTATGGTGGAAGG - Intergenic
964812882 3:160684535-160684557 GTGTAGCGGGAGATGGTGGAGGG - Intergenic
964995554 3:162874779-162874801 CTCAGGATGGGGGTGGTGGATGG - Intergenic
965271637 3:166623421-166623443 CTGGGGGTGGGGGTGGGGGAGGG + Intergenic
965297572 3:166969307-166969329 CTTTCGCTGGGGATGTTGGGCGG + Intergenic
965530930 3:169769274-169769296 CTGGGGCTGGGGAGGGTGGGTGG - Intronic
965704925 3:171496599-171496621 CTGGTGCTGGGGGTGGTGAAGGG + Intergenic
965871401 3:173269534-173269556 ATGTGGAAGGGGATGGTTGAAGG + Intergenic
966678365 3:182613737-182613759 CTTTGGCTGGGGTAGGTGGGAGG - Intergenic
967042408 3:185705753-185705775 CTGTGTCTCTGGATGGAGGAAGG + Intronic
967872876 3:194246734-194246756 CTGGTGATGGTGATGGTGGAGGG - Intergenic
968137226 3:196228140-196228162 CTGATGCTGGTCATGGTGGAAGG + Exonic
968264262 3:197350497-197350519 CAGGGGCTGGGGAGGGAGGAAGG - Intergenic
968470379 4:779174-779196 CTGAGGCCGAGGCTGGTGGATGG - Intergenic
968586199 4:1417200-1417222 CTGTCTCTGGGCATGGTGGCCGG + Intergenic
969263267 4:6046895-6046917 CTGGGGCAGGGGGTGTTGGAGGG - Intronic
969276910 4:6141995-6142017 CAGTGGGTGGGGGTGGGGGATGG - Intronic
969345394 4:6566769-6566791 TTGTGGCTAGGGTTGGGGGAGGG - Intergenic
969449088 4:7262838-7262860 CTGTGTCTGGTGAAGGTGGAGGG + Intronic
969509721 4:7610838-7610860 CTGTGGACGGGGATGGGGAAGGG + Intronic
969522171 4:7684817-7684839 CTGGGGCTGGTGGTGGTGGTGGG - Intronic
969534533 4:7747726-7747748 CTGTGGCTGTGGATGGTTTTGGG + Intergenic
969542692 4:7803535-7803557 CTGTGGTTGGGGATCGGGGCCGG - Intronic
969573224 4:8022328-8022350 CTGTGGCTGGGAACTGGGGAGGG - Intronic
969622004 4:8283375-8283397 GAGAGGCTGGGGATGGTGGCAGG - Intronic
969703816 4:8781550-8781572 TTGTGGATGGGGCTGGCGGAAGG - Intergenic
969783972 4:9437420-9437442 CAGAGGCTGGGGATGGTAAAGGG + Intergenic
970346987 4:15161930-15161952 GTGTGGCAGGGGGTGGGGGAAGG + Intergenic
970720378 4:18981215-18981237 GTGTGGCAAGGGATAGTGGATGG + Intergenic
970920091 4:21383985-21384007 ATGTGGCTGGGGATGGGGTGAGG - Intronic
971451516 4:26805668-26805690 CTCTGGCTGGGAATGGAGAATGG - Intergenic
972484952 4:39532217-39532239 TTCTGGCTGGGCATGGTGGTGGG + Intergenic
972715434 4:41641258-41641280 GTGTGTCTGGGGATGGGGGTTGG - Intronic
973795802 4:54425154-54425176 TTGTAGCTGGAGATGGTGGTTGG + Intergenic
974064599 4:57065951-57065973 CTGGGGCTGGAGATGGGGGTAGG - Intronic
974300977 4:60067051-60067073 CTCTGCCTGGGGTTGGGGGAGGG - Intergenic
974499690 4:62684149-62684171 CTGTAGCTGGGGAGACTGGATGG + Intergenic
975652772 4:76610987-76611009 CTGTGGATAGGGATGGGGGAGGG + Intronic
976269071 4:83212435-83212457 GTGTGGGTGGGGGTGGTGGAGGG + Intergenic
976670236 4:87644260-87644282 AAGTGGCTGGGTATGGTGGCAGG - Intergenic
976883203 4:89955517-89955539 ACGTGGCTGGGGGAGGTGGAAGG + Intergenic
978165784 4:105604813-105604835 TTGTGGCTGGGCATGATGAATGG - Intronic
978742686 4:112155035-112155057 TTGTGGCGGGGGAGGGTGGTGGG - Intronic
979312539 4:119220865-119220887 ATGTGGGTGTGGTTGGTGGATGG + Intronic
981348136 4:143699444-143699466 CTGGAGCTGGAGGTGGTGGACGG - Exonic
982008275 4:151083432-151083454 ATGTAGCTGGGCATGGTGGTGGG + Intergenic
982062784 4:151621543-151621565 GTGTGGCAGGGGGTGGTGGGGGG + Intronic
982361941 4:154527700-154527722 CTGTGGCTGGGGCTTGGGGGCGG + Intergenic
982452237 4:155566805-155566827 CTGTGGGTGGGGAGTGTGGCTGG - Intergenic
982526151 4:156482008-156482030 CGGTGGGTGGGGCCGGTGGATGG + Intergenic
983694537 4:170511802-170511824 TTGTAGCTGGGCATGGTGGCAGG - Intergenic
984267728 4:177514320-177514342 CTTTAGCTGGGCATGGTGGTGGG + Intergenic
984624188 4:181987254-181987276 CAGGGGCTTGGGATGATGGAAGG - Intergenic
985397351 4:189558016-189558038 ATTTGGGTGGGGATGGTGGAAGG - Intergenic
985665684 5:1180605-1180627 CTGAGGCGGGGGATGGGGGTGGG + Intergenic
985708459 5:1414895-1414917 CTGTGTCTGGGGAAGGGGGCGGG + Intronic
985771140 5:1812143-1812165 CTGTGTCTGGTGAGGGTGGAAGG + Intronic
986125897 5:4882222-4882244 CAGGGGCTGGGGGTTGTGGAAGG - Intergenic
986205417 5:5620527-5620549 CTGTGTCTTGGGATGTAGGAGGG - Intergenic
986310025 5:6544785-6544807 CTGAGGGTGGGGACGGTGGGGGG - Intergenic
986725742 5:10595098-10595120 CTGTGACTGTGGAGGGTGGAGGG + Intronic
987077540 5:14398096-14398118 CTGTTCCTGGGGCTGGGGGATGG + Intronic
987616776 5:20284092-20284114 CAGGGGCTGGGGATGGTAGCGGG + Intronic
988184150 5:27837701-27837723 GTGAGGCTGGGGATGCAGGAAGG + Intergenic
988395313 5:30690623-30690645 CTTTCACTGGGGCTGGTGGAGGG - Intergenic
988600781 5:32637821-32637843 ATTTAGCTGGGGATGGTGGCAGG + Intergenic
989178418 5:38553095-38553117 CTGTGGCTGGAGTTGGTGAAAGG - Intronic
989396607 5:40963718-40963740 CTGAGCCTGGGGATGGATGAAGG - Intronic
989437267 5:41429320-41429342 CTGCTACTGGGGATGGGGGAAGG + Intronic
989578442 5:43010303-43010325 GTGAGGGTGGGGATGTTGGAGGG - Intergenic
989651735 5:43697712-43697734 ATGTGGATGGTGATGGTGGAAGG + Intronic
990287213 5:54311662-54311684 CTGAGGGTGGGGATGGGGGGGGG - Intergenic
990350227 5:54908741-54908763 GTTTGGGTGGGGACGGTGGATGG - Intergenic
991974006 5:72168208-72168230 CTGTTGCTGGAGAAGCTGGAAGG - Intronic
992070080 5:73140253-73140275 TGGTAGCTGGGGATGGTGGCAGG - Intergenic
992477974 5:77122214-77122236 CCATGACTGGTGATGGTGGATGG - Intergenic
992484429 5:77181092-77181114 GTGAGGGTGGGGATGGTGGTGGG - Intergenic
992626964 5:78645089-78645111 CTGGGGCTGGGGGTGGTAGCAGG - Intronic
993188989 5:84656930-84656952 CTGGGGGTGGGGAGGGAGGATGG + Intergenic
994307835 5:98227820-98227842 CTGTAGCTAGGGATGCTGGTTGG - Intergenic
994335720 5:98563477-98563499 CTGTGTTTGGGGATGGAGAAAGG - Intergenic
994533633 5:100999613-100999635 CTCTGCCTCGGGTTGGTGGAGGG - Intergenic
995039016 5:107567554-107567576 CTGGGGCAGGGGTGGGTGGATGG - Intronic
995368344 5:111389176-111389198 CTGTGTCTGCACATGGTGGAAGG + Intronic
995539301 5:113169024-113169046 CTGGGGCTGGGGATTGGTGATGG - Intronic
995685440 5:114766806-114766828 CCTTGGCTGGGGATGGGGGCGGG + Intergenic
995751072 5:115453799-115453821 CTGAGGCTGGGCAGGGTGGAAGG - Intergenic
996808699 5:127488871-127488893 CCATGGATGGGGATGGGGGATGG + Intergenic
996811440 5:127519972-127519994 CAGTGACTGGGTATGGAGGAAGG - Intronic
996819012 5:127605156-127605178 CTGGTGCTGAAGATGGTGGAAGG - Intergenic
997056674 5:130452208-130452230 CTGTGGCTTTAGAGGGTGGAAGG - Intergenic
997096394 5:130918213-130918235 CAGAGGCTGGGAATGGTAGAGGG + Intergenic
997111413 5:131078969-131078991 CTCTGGCAGGGGATGGGGGCAGG - Intergenic
997382788 5:133449487-133449509 CTGTGGCTGGGGTTGGGGCCTGG + Intronic
997500136 5:134367273-134367295 CTGTGCTTGGGAATGGGGGAGGG + Intronic
997659145 5:135576747-135576769 CTGAGGCTGGGGGTGGGGGCAGG - Intronic
997698642 5:135880932-135880954 GTGTGGGTGGGGGTGGGGGATGG - Intronic
997700180 5:135892052-135892074 CTGTGGCTGGAGCTGCAGGAGGG - Intergenic
997895963 5:137717379-137717401 ATTTGGCTGGGCATGGTGGCAGG + Intronic
998137596 5:139682314-139682336 CTGGGGCTGGGGTTGGGGGAGGG - Intronic
998138654 5:139687915-139687937 CTGAGCCTGGGAATGGTGGCTGG - Intergenic
998188325 5:140000365-140000387 CTGCGGCAGGGGAAGCTGGAAGG - Intronic
998367006 5:141638153-141638175 CTGCAGCTGGGAATGGGGGAGGG - Exonic
998501506 5:142636835-142636857 CTGTGGCTGGGGAAGCTGGCAGG + Intronic
998822616 5:146070304-146070326 ATGGGGCTGGAGATGGAGGAGGG + Intronic
999075463 5:148791398-148791420 CTGTGGATGTGGGTGGGGGATGG - Intergenic
999190406 5:149742886-149742908 GTGTGGCTGGGGTGGGTGGTGGG + Intronic
999745595 5:154589605-154589627 CTCTGGGTGTCGATGGTGGAAGG - Intergenic
1000145948 5:158453473-158453495 CTGAGGCTTAGGAGGGTGGAGGG + Intergenic
1000289919 5:159860712-159860734 CTGTGTCTGTAGATAGTGGAAGG - Intergenic
1000574374 5:162958449-162958471 CTTTGGCAGAGTATGGTGGAGGG + Intergenic
1001012541 5:168111426-168111448 CGGTGGCAGGGGTTGGGGGAGGG + Intronic
1001226982 5:169953182-169953204 GTGTGGCTGGGTGTGGTGGTGGG + Intronic
1001269739 5:170302305-170302327 CTGTGTGTGGGGCTGGGGGAAGG + Intergenic
1001430744 5:171660040-171660062 CTGCAGCTGGGGATGGGGGGTGG - Intergenic
1001933392 5:175688392-175688414 CTGGGGCAGAGGATGGTGGCTGG - Intergenic
1002105702 5:176878577-176878599 CTGTGGGTGTGGCAGGTGGAGGG + Exonic
1002106510 5:176881884-176881906 CCGGTGCTGGGGATGGTGGCTGG - Intronic
1002300643 5:178255703-178255725 CTGTGACTGGGGACGGGGGAGGG - Intronic
1002330024 5:178434748-178434770 CTGAGGCCTGGGATGGTGGAGGG + Intronic
1002466625 5:179411931-179411953 CGGTGGGGGGGGAGGGTGGAAGG - Intergenic
1002466717 5:179412141-179412163 CGGTGGGGGGGGAGGGTGGAAGG - Intergenic
1002466977 5:179412739-179412761 CGGTGGGGGGGGAGGGTGGAAGG - Intergenic
1002599361 5:180345550-180345572 ATGTGGCTGGAGAAGGTGGTGGG - Intronic
1002910968 6:1490800-1490822 CTGTAGATGGGGTGGGTGGAGGG - Intergenic
1002954891 6:1852668-1852690 CTGTCCCTGGCAATGGTGGAAGG + Intronic
1004164962 6:13249004-13249026 CTGTGGCTGGCAAGGGAGGACGG - Intronic
1005343185 6:24862806-24862828 CAGTGGCTGTGGGTGGTGGGGGG - Intronic
1005492782 6:26361920-26361942 CTGTGGGTAGGGGTGGTGGATGG + Intergenic
1005496947 6:26396041-26396063 CTGTGGGTAGGGGTGGTGGATGG + Intergenic
1006167270 6:32072272-32072294 CTGTGGCTGGGGCTGGTGGGAGG + Intronic
1006269404 6:32952244-32952266 TTGTGTCTGGGGATAGTGGGAGG - Intronic
1006606714 6:35262666-35262688 ATGTGGCTGAGGATGGCAGAAGG - Intronic
1006830637 6:36965894-36965916 TTGGGGCTGGGGAGGTTGGAGGG - Intergenic
1006984039 6:38166157-38166179 CTGTGCGTGGGGGAGGTGGAGGG - Intergenic
1006984047 6:38166185-38166207 CTGTGCGTGGGGGAGGTGGAGGG - Intergenic
1006984135 6:38166462-38166484 CTGTGCGTGGGGGAGGTGGAGGG - Intergenic
1007208196 6:40169875-40169897 CTATGGCTGGGGCTGGGGTAGGG - Intergenic
1007226169 6:40316376-40316398 CTGTGGCTGGAGTTGGGGTATGG + Intergenic
1007241744 6:40431657-40431679 GTCTGGCTGGGGAAGGAGGAGGG - Intronic
1007282131 6:40720520-40720542 CTGTGGGTGGAGTTGGGGGAGGG - Intergenic
1007835779 6:44672524-44672546 CTGTGGGAGAGGATGGGGGATGG + Intergenic
1008177739 6:48288971-48288993 CTGCTGCTGGGGGTGGGGGAGGG + Intergenic
1008518082 6:52337074-52337096 CTCAGGCTGGGGATGAGGGATGG - Intergenic
1008605665 6:53137107-53137129 CTGTGGTTTGGGAAGGGGGAAGG + Intronic
1009312245 6:62169892-62169914 CTTTGTCTGGTGAGGGTGGATGG - Intronic
1009437649 6:63636195-63636217 GTGTGGAAGGGGATGGGGGAGGG - Intronic
1009593852 6:65709179-65709201 AATTGGCTGGGCATGGTGGAGGG - Intergenic
1010561257 6:77353456-77353478 CTGTTGCTGGGGATGAAGGAGGG + Intergenic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1013743604 6:113318769-113318791 CTGGGGCTGGGGAGGAAGGAAGG - Intergenic
1013792700 6:113855194-113855216 CGGGGGCTGGGAGTGGTGGAGGG - Intergenic
1015037208 6:128670132-128670154 CTGAGGGTGGTGATGGTGGATGG + Intergenic
1017227096 6:152034140-152034162 GTGTGGTTGGGGAGGGGGGAGGG + Intronic
1017718188 6:157226715-157226737 CTGGGGCTGGGGGTGGGGGTGGG - Intergenic
1017870726 6:158484229-158484251 CAATGGGTGGGGGTGGTGGAGGG - Intronic
1017912460 6:158805859-158805881 CTGTGGGCAGGGATGGGGGAAGG - Intronic
1017988214 6:159463201-159463223 CTGTGGCTGGCGAAGGTAGACGG - Intergenic
1018061921 6:160096839-160096861 CTGCTGCTGGGGGTGGTGGGAGG - Intronic
1018415781 6:163601080-163601102 CTGTTGATGGGGGTGGGGGATGG - Intergenic
1018472133 6:164106536-164106558 CTGTGTCTGAGGATGCTGCAGGG + Intergenic
1018657392 6:166051526-166051548 CTGGGGTTAGGGATGGTGGGGGG - Intergenic
1018914560 6:168125172-168125194 CTGTGGCTGGAGCTGGCGGGAGG + Intergenic
1019057935 6:169236346-169236368 GTGTGGATGGGGAGTGTGGATGG - Intronic
1019057942 6:169236375-169236397 GTGTGGATGGGGAGTGTGGATGG - Intronic
1019407973 7:893824-893846 TTGGGGCTGGGGAGGGAGGAGGG + Intronic
1019486035 7:1289576-1289598 CTGTGGGTTTGGAGGGTGGAAGG - Intergenic
1019639654 7:2096729-2096751 CTGTGGCTGGGCCTCGTGAAGGG - Intronic
1019776582 7:2915193-2915215 CTGTGGCTGGGAGTGGTGGGAGG + Intronic
1019795820 7:3047583-3047605 GTGAAGCTGGGGATGGTGGCAGG + Intergenic
1019925334 7:4187944-4187966 ACGTGGCTGGGGAAGGTGAAAGG + Intronic
1019978462 7:4603284-4603306 CTGTGGCTTGGGCTGCTAGAAGG - Intergenic
1020132933 7:5569842-5569864 CTGGGGTGGGGGATGGGGGATGG - Intergenic
1020180408 7:5918012-5918034 CGGAGGCTGTGGCTGGTGGAAGG + Intronic
1020278062 7:6636840-6636862 TTGTGGGTGGGGAGGGAGGAGGG - Intergenic
1020302523 7:6806870-6806892 CGGAGGCTGTGGCTGGTGGAAGG - Intronic
1020356301 7:7279434-7279456 GTGAGGCTTGGGATGGTGGTGGG + Intergenic
1021506317 7:21389404-21389426 CTGAGGCCGGGCATGGTGGCGGG + Intergenic
1021549796 7:21858703-21858725 CTGGGGCTGGCGATGGTGGTGGG + Intronic
1021655538 7:22870230-22870252 ATGAGACTGGGGATGGTTGAGGG - Intergenic
1022419493 7:30207096-30207118 CTGTGCCTGGGGAATGTGAAAGG - Intergenic
1022536205 7:31100231-31100253 CTGTGGCCGGGAATCCTGGAGGG + Intronic
1022553324 7:31263306-31263328 CAGAGGCTGGGAAAGGTGGATGG - Intergenic
1022830323 7:34059387-34059409 CTGGGGGAGGGGATGGTGGGGGG + Intronic
1023168707 7:37369208-37369230 CAGTGGCTGGGGGAGATGGAAGG + Intronic
1023522815 7:41065845-41065867 CTGTGGGTGGGGAAGGCGGGAGG + Intergenic
1023582948 7:41701219-41701241 CTGTGGCTTGGCTGGGTGGAGGG - Intronic
1023710642 7:42988728-42988750 CTCAGGCTGGGGCTGGGGGAAGG - Intergenic
1024063970 7:45717966-45717988 CTCTGGCTTGGGGTGGTGGGAGG + Exonic
1024285957 7:47757734-47757756 CTCTGGCTTGAGATGTTGGATGG + Intronic
1024545266 7:50512523-50512545 ATGGGCCTGGGGGTGGTGGATGG - Intronic
1025294870 7:57769334-57769356 CTGGGGCTGGGGCTGGTTGCAGG + Intergenic
1026621280 7:71952002-71952024 ATGCGGCTGCTGATGGTGGAGGG + Intronic
1026807263 7:73436133-73436155 CTCTGGCTGGGAAGGGGGGAAGG + Intergenic
1026995004 7:74609948-74609970 CTGGGGCTGAGGTTGGGGGAAGG - Intergenic
1027443893 7:78249691-78249713 CAGTGGCTGGGGAGGGTAGTGGG + Intronic
1027836502 7:83250870-83250892 TAGTGGGTGGGGATGGGGGAGGG - Intergenic
1028332482 7:89611673-89611695 CTGGGGGTGGGGCTGGGGGAGGG + Intergenic
1028622096 7:92836368-92836390 CTGTGGGTGGGGTAAGTGGAGGG - Intronic
1028849467 7:95520640-95520662 GTGTGGATGGGGATGGGGGGTGG - Intronic
1029113090 7:98223343-98223365 CTGGGGCTGGGGGTGGGGGTGGG - Intronic
1029152115 7:98488052-98488074 CTGAGGCTGAGGATTGTGCAGGG - Intergenic
1029335990 7:99899733-99899755 CTGTGTCTGTGTATGGTGGGTGG + Intronic
1029851805 7:103469381-103469403 CTGGGGATGGGGATGGGGGTGGG - Intergenic
1030234343 7:107242476-107242498 CTCTGGCTGGGGATGGCTGGAGG - Intronic
1030619566 7:111774317-111774339 CTTTAGCTGGGCATGGTGGCAGG + Intronic
1031527935 7:122844064-122844086 CTGTGGCTGGGGCTTGTGTTTGG - Intronic
1032023184 7:128421448-128421470 CTATGCCTGGGGATGGAGGGAGG - Intergenic
1032168786 7:129566908-129566930 CTGTGGTAGGGGATGGTGGGGGG - Intergenic
1032470112 7:132172127-132172149 CTTGGGCTGGGGAGGGTGGCAGG - Intronic
1032485696 7:132285920-132285942 TTGTGGGTGGGGGTGGTGGGTGG - Intronic
1032548338 7:132762024-132762046 TTGGGGCTGGGGATGGGGAAGGG + Intergenic
1032581195 7:133105138-133105160 CTGGGGCGGGGGTGGGTGGAGGG - Intergenic
1033005525 7:137557816-137557838 CTGTTGATGGGCATGGTGGGAGG - Intronic
1033220260 7:139522981-139523003 TTGGGGCTGAGAATGGTGGAGGG + Intergenic
1033648288 7:143321558-143321580 CTGTGGGTGGGGCTGGATGATGG - Intronic
1034030002 7:147750889-147750911 ATTTGGCTGGGCATGGTGGTGGG + Intronic
1034081990 7:148287703-148287725 CTGTGTCATGGCATGGTGGAGGG + Intronic
1034383701 7:150720611-150720633 CAGCTGCTGGGGATGGTCGAGGG + Exonic
1034469542 7:151248117-151248139 CTGGGGGTGGGGGTGGGGGATGG - Intronic
1034936715 7:155204703-155204725 CTTTGGGATGGGATGGTGGAGGG - Intergenic
1034979649 7:155467827-155467849 CTGGGGCTGGGGCTGGAGAAGGG - Intergenic
1035021606 7:155804021-155804043 CTGGGGGTGGGGTTGGAGGAAGG - Intronic
1035057136 7:156043267-156043289 CTGTGGCTGGGAAGTTTGGAAGG - Intergenic
1035225106 7:157428398-157428420 CTGTGGCTGGGAGTGAGGGAGGG + Intergenic
1035267667 7:157700610-157700632 CCGAGGCTGAGGGTGGTGGATGG - Intronic
1035289949 7:157831465-157831487 CTGGGGCTGGGGCTGGGAGACGG + Intronic
1035293892 7:157857111-157857133 GTGGAGCTGGGGATGCTGGAGGG + Intronic
1035479208 7:159168658-159168680 CAGGGGCTGGGGAAGGAGGAAGG + Intergenic
1035835662 8:2749169-2749191 CTGAGGCTGGGTTTGGTGGAAGG + Intergenic
1036759336 8:11496568-11496590 CTGTGGCAGGGGCTGCAGGACGG + Intronic
1036835069 8:12056711-12056733 CAGAGGCTGGGGATGGTAAAGGG - Intergenic
1036856913 8:12303275-12303297 CAGAGGCTGGGGATGGTAAAGGG - Intergenic
1037374992 8:18217829-18217851 CTGTTGCAGGGGCTGGTGCAGGG + Intronic
1037637197 8:20710715-20710737 CTGGGGGTGGGGGTGGTGGCTGG + Intergenic
1037668808 8:20996979-20997001 CTGGGGCTGGAGACGGGGGATGG - Intergenic
1037811755 8:22090485-22090507 TTTTGACTGGGGATGGGGGAAGG - Intronic
1039444538 8:37620686-37620708 CTGGGGGTGGGGAGGGTGAAGGG - Intergenic
1039978557 8:42387504-42387526 CATTAGCTGGGCATGGTGGAGGG - Intergenic
1041134991 8:54748707-54748729 CTGATACTGGGGATGGTGGATGG - Intergenic
1041747694 8:61226735-61226757 CTGAGGCTGGGGAGGGAAGAGGG + Intronic
1041983601 8:63893317-63893339 GTGAGGCTGAGGCTGGTGGATGG + Intergenic
1042178387 8:66060018-66060040 TTGAGGCTGGGCATAGTGGATGG + Intronic
1042976127 8:74471671-74471693 CTGGGGATGGGGATGGAGAAAGG - Intronic
1043760717 8:84063947-84063969 CTGCTGCCGGGGATGGAGGAGGG + Intergenic
1043776772 8:84279063-84279085 ACATGGCTGGGGATGGTGGAAGG + Intronic
1043845941 8:85164207-85164229 CAGTGGCTGGGGATGGTTTTGGG + Intergenic
1045282130 8:100758366-100758388 CTGTGTCTGGTGATGGAGCAAGG - Intergenic
1045797445 8:106062457-106062479 GTGTGGCTGGGGAGGATTGAGGG + Intergenic
1045811490 8:106225148-106225170 CAGAGGCTGGGAAGGGTGGAGGG + Intergenic
1048274610 8:133056918-133056940 CAGAACCTGGGGATGGTGGAAGG - Intronic
1048447904 8:134505660-134505682 CTGGCTCTGGGGATGGAGGAAGG + Intronic
1048812767 8:138303694-138303716 ATGTGGCAGGGGGTGGTGCAAGG + Intronic
1048881678 8:138877109-138877131 TTGTGGCTGGGGGTGGGGGAGGG - Intronic
1049049486 8:140183242-140183264 CTGGGGATGGGGATGGTTGGTGG + Intronic
1049174377 8:141182646-141182668 CTGTGGCTGCCGATTCTGGAAGG + Intronic
1049211970 8:141391143-141391165 CTCTGGCTGCTGAGGGTGGATGG + Intergenic
1049252722 8:141597753-141597775 CTGGGGCGGGGGGTGGGGGAAGG + Intergenic
1049264736 8:141661555-141661577 CTGTGACTGGTGGTGGTGCAGGG + Intergenic
1049353577 8:142177061-142177083 CAGAGGCTGGGCAGGGTGGAAGG - Intergenic
1049354816 8:142182438-142182460 CTGTGGCTGTGGACGGTGAGAGG + Intergenic
1049710857 8:144062746-144062768 GGGTGGCTGGGGATGGTGGAGGG - Intronic
1049711963 8:144068849-144068871 CTGTGGCAGGTGTTGGGGGACGG - Intergenic
1049958666 9:716980-717002 CTGTGGGTGGGGGTGGTGGGGGG + Intronic
1050483153 9:6106850-6106872 CTGGGGCTGGGGATAGCAGAGGG + Intergenic
1050538558 9:6650625-6650647 CAGTAGCTGGGCATGGTGGCGGG - Intergenic
1050995594 9:12213242-12213264 CTGTGGCTGAGAATGCTTGAGGG + Intergenic
1051370583 9:16355671-16355693 CTGTGGCTTGGGATGGGGAGAGG - Intergenic
1051416850 9:16850624-16850646 CTGTGGAAGGTGAAGGTGGAAGG + Intronic
1051585930 9:18726889-18726911 CTGGGGCTGGGGCAGGGGGAGGG - Intronic
1052311624 9:27074804-27074826 CTGTGGCAGGGGATGGCTGGAGG + Intergenic
1052821158 9:33138809-33138831 CTGTAGGTGGTGATGGTGGTGGG - Intronic
1052910478 9:33876765-33876787 ATGTAGCCGGGCATGGTGGAGGG + Intronic
1053396278 9:37777322-37777344 CTGTGGCCTGGGATGGGGAAGGG - Intronic
1054161545 9:61674943-61674965 CTGGGGCTGGGGCTGGTTGCAGG - Intergenic
1054172634 9:61855669-61855691 CTGGGGCTGGGGATGGGGCTGGG + Intergenic
1054447485 9:65384680-65384702 CTGGGGCTGGGGATGGGGCTGGG + Intergenic
1054664906 9:67725132-67725154 CTGGGGCTGGGGATGGGGCTGGG - Intergenic
1054998408 9:71420259-71420281 CTGAGGCTGGGGATGCTACATGG + Intronic
1055564707 9:77556725-77556747 GTGTGTCTGGGGGTGGTGGTAGG - Intronic
1056387248 9:86107257-86107279 CCGAGGCTGGGAAGGGTGGAGGG + Intergenic
1056879828 9:90380517-90380539 CTGGGGGTGGGGAAGTTGGAAGG - Intergenic
1056939921 9:90946234-90946256 CTGTGGCTGGACATGGTGCCTGG + Intergenic
1057142634 9:92736883-92736905 CTGTAGCGTGGGATGGTGCAGGG + Intronic
1057171974 9:92968472-92968494 CTGTGGGAGTGGATGGAGGAGGG - Intronic
1057270052 9:93645503-93645525 CTGTGGCTGTGGGAGGTGGGTGG + Intronic
1057641780 9:96830583-96830605 CTGTGGCAGGGGAGGTTGGGGGG - Intronic
1057815444 9:98290627-98290649 CTGTGGCGGGGGCTGGCGGTGGG + Exonic
1057848309 9:98543205-98543227 CTGTGGCTGAGGCTGAGGGAAGG - Intronic
1057909478 9:99006522-99006544 GTGTGGCTGGGGGTGGAGGTGGG + Intronic
1058420641 9:104829984-104830006 CTGTGGTTGGTGGTGGTGGTGGG - Intronic
1059093111 9:111382549-111382571 CTTTGGCTGGGCCTGGTGGCTGG - Intronic
1059250279 9:112881988-112882010 CTGTGGCTGAGGGTTGGGGAGGG + Intronic
1059322355 9:113479599-113479621 CTGGGGCTGGGGTTGGGGGATGG + Intronic
1059329715 9:113527176-113527198 CTATGGCAGGGAATGGTGGATGG - Intronic
1059699406 9:116760655-116760677 TTGTGCCTGGGGAAGGGGGAGGG + Intronic
1059874910 9:118623670-118623692 CTAGGGTTGGGGATGGGGGAAGG + Intergenic
1060047715 9:120353849-120353871 CAGTGGCTGGGAAGGGTGGGAGG + Intergenic
1060483049 9:124029210-124029232 CTGTGGCAGTGCATGCTGGAGGG + Intronic
1060828733 9:126700837-126700859 ATGTGTCTGGGGATGGCGGGTGG - Exonic
1060937938 9:127526812-127526834 CTGTGGCTGTCGAGGGTGGGAGG + Intronic
1061230268 9:129311921-129311943 CTGTGGCTGCTGTTGGTGGGTGG + Intergenic
1061320121 9:129823486-129823508 CTGGGGCTGGGGCTGGGGGATGG - Intronic
1061320203 9:129823694-129823716 CTGGGGCTGGGGCTGGGGGATGG - Intronic
1061320263 9:129823855-129823877 CTGGGGCTGGGGCTGGGCGATGG - Intronic
1061328758 9:129879509-129879531 CTGCTGCTGTGGAGGGTGGAGGG + Intronic
1061397028 9:130348922-130348944 CTGATGCTGGGGGTGGTGGCTGG + Intronic
1061550356 9:131331101-131331123 ATGTGGCTGGTGAAGGTGGCTGG - Intergenic
1061770232 9:132914045-132914067 AATTGGCTGGGGATGGTGGCGGG - Intronic
1062044883 9:134420361-134420383 CTGTGGCTGCTGCTGATGGAAGG + Intronic
1062134055 9:134915375-134915397 CAGTGGCTGGGGAGAGTGTATGG + Intronic
1062249900 9:135588748-135588770 CTGGGGCTGGGGCTGGTGGGGGG + Intergenic
1062263994 9:135678465-135678487 CTGTGGCTGTGGCTGGGGGGTGG + Intergenic
1062315909 9:135966953-135966975 CTGTGGTTGGGGCTGGGGTAGGG - Intergenic
1062315922 9:135966988-135967010 CTGTGGTTGGGGCTGGGGTAGGG - Intergenic
1062315971 9:135967128-135967150 CTGTGGTTGGGGCTGGGGTAGGG - Intergenic
1062324440 9:136005401-136005423 CTGGGGCTGGGCTTGGTGGTGGG + Intergenic
1062372752 9:136248557-136248579 CTGGGCCTGGGGGTGGTGGCGGG + Intergenic
1062735454 9:138134875-138134897 CTGTGGCCAAGGATGGGGGAAGG + Intergenic
1203654532 Un_KI270752v1:10101-10123 CTGGGGCTGGGGCGGGTGGGGGG + Intergenic
1203663322 Un_KI270754v1:3272-3294 ATTTGGGTGGGGATGGTGGAAGG + Intergenic
1186309475 X:8302150-8302172 CTCTGGAAGGGCATGGTGGATGG + Intergenic
1186389820 X:9147937-9147959 CTGTGGCTGGGGGTGGGGGAGGG - Intronic
1186506593 X:10098312-10098334 CCCTGGCTGGGGAGGGGGGAGGG - Intronic
1186741029 X:12518037-12518059 CTGAGGCTGGGGAGACTGGATGG - Intronic
1187359558 X:18612333-18612355 CGGTGGCAGGGAATGGTGGTAGG + Intronic
1187391122 X:18887208-18887230 GTGGGACTGGGGCTGGTGGAGGG + Intergenic
1188367081 X:29329984-29330006 CTGCTGCTGGTGGTGGTGGAGGG + Intronic
1188479302 X:30620957-30620979 ATGTAGCTGGGGGTGGTGGCAGG + Intergenic
1188668251 X:32851689-32851711 CTCTGCCAGGGGATGGGGGAGGG - Intronic
1189348251 X:40258671-40258693 CACTGGCTGGGGATGGGGCAGGG + Intergenic
1189538908 X:41965947-41965969 CTTTGGTTTGGGATGGTGAAAGG + Intergenic
1189975838 X:46460768-46460790 CTGTGGCTGGGTGTGGTGGCTGG - Intronic
1189983229 X:46530932-46530954 CTGTGGCTGGGTGTGGTGGCTGG + Intronic
1190176238 X:48152579-48152601 CAGGGGTTGGGGATGGTGGATGG + Intergenic
1190186904 X:48243294-48243316 CAGGGGTTAGGGATGGTGGATGG + Intronic
1190195050 X:48310082-48310104 CAGGGGTTAGGGATGGTGGATGG - Intergenic
1190202850 X:48378914-48378936 CAGGGGTTAGGGATGGTGGACGG + Intergenic
1190207688 X:48416499-48416521 CAGGGGTTAGGGATGGTGGACGG - Intergenic
1190339582 X:49286195-49286217 CTGTGGCTGCGGGTGGGGCAGGG + Exonic
1190661482 X:52658305-52658327 CAGGGGTTAGGGATGGTGGATGG - Intronic
1190929196 X:54933957-54933979 GTGTGGCTGGTGATGGGGGAGGG - Intronic
1192013238 X:67298817-67298839 GTGGGGTTGGGGATGGGGGAGGG - Intergenic
1192221235 X:69198703-69198725 CTGAGGTTGGGAATGGTGGAGGG - Intergenic
1192240460 X:69323985-69324007 CTGTCTCTGGGGACGGAGGATGG + Intergenic
1192469498 X:71385444-71385466 CTATGGCTGGGGACTGTAGATGG - Intronic
1192951932 X:76026425-76026447 CTGGAGCTGGGGAGGCTGGACGG + Intergenic
1194024534 X:88735640-88735662 CTGTGTCTGGGGAGGGTGGGTGG + Intergenic
1194445873 X:93986702-93986724 CTGGAGCAGGGGATGCTGGATGG + Intergenic
1194659041 X:96608359-96608381 CTGTGGCTTGGCATGGGGCAAGG - Intergenic
1194876956 X:99201183-99201205 CTGTGGCTTCAGAGGGTGGAAGG + Intergenic
1195068463 X:101258167-101258189 CTGGGGGTGGGGATGGGGGTGGG + Intronic
1195172501 X:102282403-102282425 CTGTGGCCAGGGGTGGGGGAGGG + Intergenic
1195186365 X:102404692-102404714 CTGTGGCCAGGGGTGGGGGAGGG - Intronic
1195339373 X:103891259-103891281 GTGTGGTGGGGGAGGGTGGAGGG - Intergenic
1196196895 X:112846278-112846300 GTGTGGTTGGGAAGGGTGGAAGG - Intergenic
1196362067 X:114873935-114873957 CTGGGGCTGGGGTTGGGGGTTGG - Intronic
1196730913 X:118940798-118940820 ATGTAGCTGGGCATGGTGGCAGG - Intergenic
1196865863 X:120070309-120070331 CTCTGGCTGGGCATTGTGGAAGG + Intergenic
1196877233 X:120165971-120165993 CTCTGGCTGGGCATTGTGGAAGG - Intergenic
1196881543 X:120202844-120202866 CTCTCTCTGGGGATGGCGGAGGG - Intergenic
1197617110 X:128705517-128705539 CTGAGGCTGGGGAGGGTTGGGGG - Intergenic
1197773813 X:130107354-130107376 CTGTGTGTGGGGAGGGTGGGAGG + Intronic
1198116128 X:133546539-133546561 CAGTGGCTGGGGGTAGGGGAAGG + Intronic
1198191860 X:134315399-134315421 CTGAGGCTGGGCAGGGTGGCTGG - Intergenic
1198322598 X:135533544-135533566 CTGTGAATGGGGGTGGGGGAAGG - Intronic
1199600572 X:149539335-149539357 CTGTGGGTGGAGCTGGGGGAGGG - Intergenic
1199650010 X:149940606-149940628 CTGTGGGTGGAGTTGGGGGAGGG + Intergenic
1199895097 X:152119869-152119891 ATGAGGGTGGGGATGGGGGAGGG + Intergenic
1200074930 X:153546170-153546192 CTGGGGGTGGGGCTGGTGGAGGG + Intronic
1200182771 X:154160973-154160995 CAGGGGCTGGGGGTGGGGGATGG + Intergenic
1200188425 X:154198087-154198109 CAGGGGCTGGGGGTGGGGGATGG + Intergenic
1200194075 X:154235227-154235249 CAGGGGCTGGGGGTGGGGGATGG + Intergenic
1200199830 X:154273031-154273053 CAGGGGCTGGGGGTGGGGGATGG + Intronic
1200359825 X:155592889-155592911 CTGAGGCTGGGCATGGAGGCTGG - Intronic
1200746768 Y:6910479-6910501 CTGGAGCTGGGGCTGGTGGGAGG + Intergenic
1201403017 Y:13623505-13623527 GTGTGGCTGGGGAAGGGGGGAGG - Intergenic
1202583281 Y:26403266-26403288 CTATGGCTGGGGCTGGGGCAGGG + Intergenic