ID: 1092797398

View in Genome Browser
Species Human (GRCh38)
Location 12:12126210-12126232
Sequence CCTTATTAGCACATGAAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 102}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092797392_1092797398 28 Left 1092797392 12:12126159-12126181 CCAAGCTTAAAACTTCTGGCTAC 0: 1
1: 0
2: 1
3: 4
4: 109
Right 1092797398 12:12126210-12126232 CCTTATTAGCACATGAAGTCAGG 0: 1
1: 0
2: 0
3: 4
4: 102
1092797393_1092797398 -4 Left 1092797393 12:12126191-12126213 CCTAAACTAGCCCTTTGTCCCTT 0: 1
1: 0
2: 1
3: 6
4: 216
Right 1092797398 12:12126210-12126232 CCTTATTAGCACATGAAGTCAGG 0: 1
1: 0
2: 0
3: 4
4: 102
1092797391_1092797398 29 Left 1092797391 12:12126158-12126180 CCCAAGCTTAAAACTTCTGGCTA 0: 1
1: 0
2: 0
3: 13
4: 151
Right 1092797398 12:12126210-12126232 CCTTATTAGCACATGAAGTCAGG 0: 1
1: 0
2: 0
3: 4
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092797398 Original CRISPR CCTTATTAGCACATGAAGTC AGG Intronic
907065154 1:51474403-51474425 CCATATTGGTAGATGAAGTCAGG + Intronic
911666543 1:100559283-100559305 CTTTATTTGCAGATGAAGCCTGG - Intergenic
911685295 1:100768974-100768996 CCTTATTAGCATCTTAAATCAGG + Intergenic
915115452 1:153596007-153596029 CCTTATGAGCTTATGAAGTAAGG - Intergenic
918066016 1:181102216-181102238 CCTCATTAGGACTTGAACTCTGG - Intergenic
921875045 1:220186332-220186354 TCATATTAGCACATTAAGTTGGG + Intronic
923083613 1:230684090-230684112 CCTTATTAAAAAAAGAAGTCAGG - Intronic
1066326592 10:34366327-34366349 CCTTCTGAGCACATGAGGTAGGG + Intronic
1067787701 10:49262689-49262711 CCTTACTAGCATATGGACTCTGG - Intergenic
1073002003 10:100292866-100292888 GCTTATAAGCAAATGAAGTATGG + Intronic
1075393486 10:122110505-122110527 ACTCATTAGAAGATGAAGTCAGG - Intronic
1080157147 11:29124933-29124955 CCTTTTTACAAAATGAAGTCAGG - Intergenic
1083074607 11:60023247-60023269 GCTTTTGAGCACATGAAGTGTGG + Intergenic
1084938957 11:72602176-72602198 CCTTACAAGCACAAGAAGACAGG + Intronic
1085193279 11:74647967-74647989 CTTTATTTACACATGAAGACAGG + Intronic
1086666163 11:89485911-89485933 TCTGATTAGCACATTAACTCAGG + Intronic
1088589090 11:111387295-111387317 CCATATTTGCAGATGATGTCTGG - Intronic
1091076519 11:132623082-132623104 CCTTATTAGCAAATGACCTGAGG - Intronic
1092797398 12:12126210-12126232 CCTTATTAGCACATGAAGTCAGG + Intronic
1093184496 12:16004046-16004068 ACTTACTACCACATGAAATCTGG + Intronic
1093491790 12:19713301-19713323 CCTTATTAGCACCAGAATTTAGG - Intronic
1093765018 12:22952800-22952822 GCTTATTGGCACCTAAAGTCTGG + Intergenic
1094349229 12:29504743-29504765 CTTTATTAGCACTTCAAGTAAGG + Intronic
1097951367 12:65432566-65432588 CCTTTTTAGCAGATGAAGATAGG + Intronic
1104255211 12:127130154-127130176 CCTAATTAGCATAGGATGTCCGG + Intergenic
1108006067 13:45947871-45947893 CCTCCTTAGCACATGCAGGCAGG - Intergenic
1109014952 13:56997193-56997215 CATTTTTAGCTCTTGAAGTCAGG - Intergenic
1111712025 13:91829125-91829147 CCTTCTTAGTACATCATGTCAGG - Intronic
1118311381 14:64696054-64696076 CCTTAATGCCACATCAAGTCAGG - Intergenic
1126289918 15:47062754-47062776 CCTTATGAACAAATGAAGTTGGG + Intergenic
1128458738 15:67850017-67850039 CCTTATTAGAAGAGGAAATCTGG + Intergenic
1128690300 15:69719552-69719574 TCTTATTTGCTCATTAAGTCAGG - Intergenic
1129023703 15:72548419-72548441 ACTCTTTAGCCCATGAAGTCTGG - Intronic
1131338729 15:91575729-91575751 CTTTATGAGAAAATGAAGTCTGG + Intergenic
1131941310 15:97569180-97569202 CCTTATTAGCACATGCCATGTGG - Intergenic
1133067943 16:3223048-3223070 CCTTCGTAGCACATGAGATCTGG + Exonic
1134570734 16:15288737-15288759 CCTCATTAGCACATGAATGCTGG - Intergenic
1134731647 16:16467337-16467359 CCTCATTAGCACATGAATGCTGG + Intergenic
1134935805 16:18244666-18244688 CCTCATTAGCACATGAATGCTGG - Intergenic
1135203744 16:20464083-20464105 CCTTATTTGCATTTGAAATCTGG + Intronic
1141287315 16:82684546-82684568 GCTTAATAGACCATGAAGTCAGG + Intronic
1143064001 17:4229126-4229148 CCTTATTAGAAAATGAGGCCAGG + Intronic
1146489785 17:33272139-33272161 GCTCATTAGCTCATGTAGTCAGG - Intronic
1151361514 17:73592086-73592108 CGTTATTGACAGATGAAGTCCGG - Intronic
1157144741 18:45150334-45150356 ACTTATTAGCACATAACCTCAGG + Intergenic
1159169886 18:64752251-64752273 CCTTATTGGCTCAAGAGGTCAGG + Intergenic
1166010884 19:39941778-39941800 CCTTGTTAACACATGATGACAGG - Intergenic
926848051 2:17163748-17163770 ACTTATTAGCAGATGACCTCGGG - Intergenic
931317484 2:61146340-61146362 CCTTATTTCCACATAAATTCTGG + Intronic
933472956 2:82750330-82750352 CCTTATTTGCTTATGAAGTTTGG - Intergenic
938296931 2:130184335-130184357 CCTTATCTGGACAGGAAGTCTGG + Intronic
939346725 2:140975511-140975533 CATTCTTAGAACCTGAAGTCTGG + Intronic
942395227 2:175540004-175540026 ATTTATTGGCACATAAAGTCAGG - Intergenic
948262662 2:236615514-236615536 CCTCATTAGAGAATGAAGTCAGG - Intergenic
1170269812 20:14512900-14512922 TGTTATTTGCACATGATGTCAGG - Intronic
1170387154 20:15831894-15831916 ACATATCAGCACATGAAATCAGG - Intronic
1172909835 20:38399798-38399820 CCTTATAAGAACAGGAAATCTGG + Intergenic
1182585001 22:31339874-31339896 CCTTAGTAGCCCTTGAACTCAGG + Intronic
1184956599 22:47891122-47891144 TCTTATTAGAACTTGAAGGCTGG + Intergenic
951118797 3:18898574-18898596 CCTTATTTGGAGATGAAGTATGG + Intergenic
952792283 3:37209490-37209512 TCTTATTAATACATGAAGACAGG + Intergenic
953376229 3:42430785-42430807 CCTTACTTGCACATGACGTTTGG + Intergenic
958493492 3:94810181-94810203 CCTTATAAGCACAATGAGTCTGG + Intergenic
960168884 3:114435542-114435564 CATGAAAAGCACATGAAGTCTGG - Intronic
964702683 3:159586356-159586378 CCTTATTTTCATATGCAGTCAGG + Intronic
969836212 4:9843957-9843979 CCTTAGTAGCACATGCACTGTGG + Intronic
970802714 4:19993807-19993829 CTTTATTAAAACATGCAGTCTGG + Intergenic
971460373 4:26889660-26889682 CCTCATTAGCACCTGTAGCCAGG + Intronic
973189106 4:47366846-47366868 ATTTAATAGCACATGAAATCAGG - Intronic
973387279 4:49521077-49521099 CCTTTTCAACACATGATGTCGGG - Intergenic
976111411 4:81677840-81677862 CCTTTTTAGCTCAGAAAGTCTGG + Intronic
977361803 4:96014973-96014995 CATTATTAGCATATGAAATAAGG + Intergenic
977736809 4:100426793-100426815 CCTCATGACCACATGAAGTGGGG - Intronic
979847820 4:125538750-125538772 CCTAGTTAGCACTTCAAGTCAGG - Intergenic
981055168 4:140352945-140352967 TCTTATTAGCTCATGAGCTCAGG - Intronic
991449957 5:66741289-66741311 CCTTATTACCACCTGAAGAAAGG + Intronic
998911878 5:146968741-146968763 TCTTATTTGCACATGAAGATTGG - Intronic
1005375483 6:25178078-25178100 GCTCATCAGCACATGAAGCCTGG + Intergenic
1010928488 6:81772201-81772223 CCTTATTTGAACATGAGGGCAGG - Intergenic
1010988186 6:82450134-82450156 CCTTTTTAGAAAATGAAGTCAGG - Intergenic
1013702425 6:112789295-112789317 TCTTATTAGCTCATGCAGTGGGG - Intergenic
1014571689 6:123016567-123016589 ACTTATTGGCAGATGGAGTCTGG - Intronic
1016519222 6:144928400-144928422 TCTTATTAGTACAAGAAGGCAGG + Intergenic
1017260921 6:152385874-152385896 CCTTTTGAGAACATGAACTCAGG + Intronic
1022717760 7:32914257-32914279 CCTTATTCTCACTAGAAGTCTGG + Intergenic
1026307760 7:69156646-69156668 CCTTCTTAGCCCATTAAGTTTGG - Intergenic
1026357107 7:69567851-69567873 CCTAATTAGCACATTAATTTAGG - Intergenic
1032334571 7:131013041-131013063 CCTTAATAGCACATGCTGTTTGG + Intergenic
1038278739 8:26143534-26143556 CCTAATTACCACATGAAAGCTGG - Intergenic
1045003683 8:97899596-97899618 CCTTATAAGAAGAGGAAGTCTGG - Intronic
1045396732 8:101768289-101768311 TCTTATTCTCACAGGAAGTCTGG + Intronic
1046967478 8:120183718-120183740 CCTTATAGGAACATGAAGCCTGG - Intronic
1053660775 9:40275965-40275987 CCTTATCTGCACATAACGTCTGG + Intronic
1053753123 9:41275308-41275330 CCTTTTCAACACATGAAGTTGGG - Intergenic
1054258648 9:62839670-62839692 CCTTTTCAACACATGAAGTTGGG - Intergenic
1054333125 9:63780384-63780406 CCTTTTCAACACATGAAGTTGGG + Intergenic
1054372897 9:64422181-64422203 CCTTATCTGCACATAACGTCTGG + Intergenic
1054523835 9:66100319-66100341 CCTTATCTGCACATAACGTCTGG - Intergenic
1054680527 9:67911958-67911980 CCTTATCTGCACATAACGTCTGG + Intergenic
1060371782 9:123080333-123080355 CCCTATTTGCACATGATTTCAGG + Intronic
1061324627 9:129856134-129856156 CCTAATTTGGACAGGAAGTCTGG + Intronic
1186925384 X:14328249-14328271 CCTTATAAGCACATGGAAGCTGG - Intergenic
1189547552 X:42057331-42057353 CCTTATTAGAAGAGGAAGTGAGG - Intergenic
1191923471 X:66282269-66282291 CTTTATTAGGCCATAAAGTCAGG + Intergenic
1193537573 X:82732493-82732515 TCTTATTAATACATGAAGACAGG + Intergenic
1198396881 X:136228381-136228403 CCTTAATGGCACATGATGTATGG + Intronic
1198766509 X:140085345-140085367 CATAATTAGAACAGGAAGTCAGG - Intergenic