ID: 1092799883

View in Genome Browser
Species Human (GRCh38)
Location 12:12153963-12153985
Sequence CAGTTCCTACTCAATGCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 158}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092799883_1092799888 21 Left 1092799883 12:12153963-12153985 CCAGGGGCATTGAGTAGGAACTG 0: 1
1: 0
2: 1
3: 7
4: 158
Right 1092799888 12:12154007-12154029 AGCCACGCCATACACCTGTAGGG 0: 1
1: 0
2: 0
3: 3
4: 46
1092799883_1092799887 20 Left 1092799883 12:12153963-12153985 CCAGGGGCATTGAGTAGGAACTG 0: 1
1: 0
2: 1
3: 7
4: 158
Right 1092799887 12:12154006-12154028 TAGCCACGCCATACACCTGTAGG 0: 1
1: 0
2: 0
3: 2
4: 25

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092799883 Original CRISPR CAGTTCCTACTCAATGCCCC TGG (reversed) Intronic
900516585 1:3085096-3085118 TAGTTACTTCTCACTGCCCCAGG + Intronic
901873103 1:12149996-12150018 CAGTTTCTACTTCCTGCCCCCGG - Intergenic
902070721 1:13733706-13733728 GAATTCCTACGCAATACCCCAGG - Intronic
905252131 1:36656291-36656313 CAGTTCCTATGCATAGCCCCAGG + Intergenic
905468804 1:38176105-38176127 CAGTGCCTCCTGAATGCTCCTGG - Intergenic
907681810 1:56571218-56571240 CACATCCTAGTCAATGCCCTTGG - Intronic
908002633 1:59695517-59695539 GAGTTCCTACTCAATGAGTCAGG + Intronic
908267733 1:62395454-62395476 CAGGTCCTACTCCAGGGCCCCGG + Intergenic
912978271 1:114348852-114348874 CAGTGCCTGCTCTCTGCCCCTGG + Intergenic
917606831 1:176640089-176640111 CAGTTCCTATGCCATCCCCCAGG + Intronic
918413869 1:184287641-184287663 CAGTGCCTTCTCCATGCCCAGGG - Intergenic
919936251 1:202252591-202252613 CAGGTTCTTCTCCATGCCCCTGG - Intronic
922818158 1:228465840-228465862 CAGAGCCTGCTCTATGCCCCGGG + Intergenic
924195034 1:241597693-241597715 CATTTCCAACTCTATGCCCAGGG + Intronic
1063482112 10:6385163-6385185 CACTTCCTGGTCAAGGCCCCAGG - Intergenic
1065980129 10:30886702-30886724 CAGTTTCTACTGAATGCACATGG + Intronic
1067877502 10:50018903-50018925 CAGTGCCAGCTCAATGCCCTGGG + Intergenic
1070988300 10:80707660-80707682 CTGTTCCTCCTCACAGCCCCAGG - Intergenic
1073291747 10:102416659-102416681 CAGCTCCGACTCAAGCCCCCTGG + Exonic
1074128953 10:110556133-110556155 CAGTTCCTATTCAATTCTCATGG - Intergenic
1075440340 10:122475216-122475238 CAGTTACTGCTCAAGGCACCCGG + Intronic
1076796326 10:132800063-132800085 CACTTGCCCCTCAATGCCCCAGG - Intergenic
1078428354 11:11269029-11269051 CAGTTGCTCCTGAATGCCCCTGG - Intergenic
1080112389 11:28582629-28582651 CAGTTCCTGCTCACAGCCCTAGG + Intergenic
1083125893 11:60565333-60565355 CTCTTCCTAGTCAATGCCCAGGG + Intergenic
1089132591 11:116224254-116224276 CAGTGCCCGCTCCATGCCCCTGG + Intergenic
1089260620 11:117221540-117221562 CAGTTTCTAGTCAATGACCAGGG - Intronic
1092615760 12:10213966-10213988 CTGTTCCTACTCACTGCCTGCGG - Intronic
1092799883 12:12153963-12153985 CAGTTCCTACTCAATGCCCCTGG - Intronic
1094832778 12:34308089-34308111 CAGCTCCTACATCATGCCCCTGG + Intergenic
1096003399 12:48148496-48148518 CAGTCCCTTCCAAATGCCCCAGG + Exonic
1098260204 12:68661894-68661916 CAGTTCCTACTATATGCCTTTGG + Exonic
1100013073 12:89976923-89976945 CATTTCCTACTCATTGCTCAAGG - Intergenic
1100657109 12:96659136-96659158 CAGTTTCTACACAATGTACCTGG + Intronic
1101209051 12:102518018-102518040 CAGTTCATTCTCAATACACCAGG - Intergenic
1103616927 12:122159815-122159837 AATTTCCTATTCAATGGCCCTGG - Intergenic
1104719351 12:131036434-131036456 CAGGTCTCACTCACTGCCCCAGG + Intronic
1104804477 12:131576380-131576402 CAGTTCTGACTCACTGCACCGGG - Intergenic
1107106408 13:36648021-36648043 CAGTTCCTGGTCCATGGCCCAGG + Intergenic
1108077838 13:46700132-46700154 CAGTCCAAACTCAATTCCCCTGG - Intronic
1113315198 13:109172352-109172374 CAGGGCTTACTCGATGCCCCAGG - Intronic
1115363522 14:32530631-32530653 CAGTTCCTGCTAATTGTCCCTGG - Intronic
1118839542 14:69500474-69500496 CAGTTCCTGCCAAGTGCCCCAGG - Intronic
1119730971 14:76950958-76950980 CACTTCCTGCTCTATGGCCCTGG - Intergenic
1120607847 14:86601977-86601999 CATTTCATAATCAATGACCCTGG + Intergenic
1127217674 15:56841344-56841366 CAGTTTCTACTAAATGCCTGGGG - Intronic
1130313535 15:82775057-82775079 CATTTCCTACTCAAAGCTCAGGG + Intronic
1132997142 16:2829339-2829361 CAGTTCCTTCCCAGTGCCCTGGG + Intergenic
1134074897 16:11283799-11283821 CAGTCCCTACTCAATCCCTTTGG - Intronic
1138502905 16:57459495-57459517 CAGTTCCTACCCAAGGCCATGGG - Intronic
1139827737 16:69770730-69770752 CAGTTCCTACACTATCCACCTGG - Intronic
1141320961 16:83008433-83008455 TAGTTCTTCCTCAATCCCCCAGG - Intronic
1141947996 16:87323445-87323467 CAGTTCCTACTGCTTGGCCCTGG + Intronic
1142884297 17:2903274-2903296 CAGCTCCTCCTCAATGGGCCTGG - Intronic
1145123209 17:20279093-20279115 CTGTTCCTTCTCCATCCCCCAGG + Intronic
1145836663 17:27959415-27959437 CAGGTCCTATGCAATGCCCTGGG + Intergenic
1145889398 17:28404562-28404584 CAGTTCTTACCCAGTGCCTCTGG + Intronic
1147194273 17:38754874-38754896 CAGTTCCATCTCAGAGCCCCAGG - Intronic
1147966514 17:44197152-44197174 CTGTACCTTCCCAATGCCCCCGG + Intronic
1148541826 17:48487052-48487074 GAGTTCCCACTCCATGCACCTGG - Intergenic
1148699447 17:49578938-49578960 CACTTCCAACACAATGCCACAGG + Exonic
1149191070 17:54063161-54063183 CCAGTCCTACTCAATGGCCCTGG + Intergenic
1149560459 17:57604683-57604705 CTGTTCCGAGTCAATCCCCCAGG - Intronic
1152376502 17:79921359-79921381 CAGTGCCTTCTCAATGCCAACGG + Intergenic
1152918648 17:83054587-83054609 CAGCACCTACTCCAGGCCCCTGG - Intergenic
1153199702 18:2635558-2635580 AAGTTCCTTCTCTTTGCCCCAGG - Intergenic
1162157995 19:8692841-8692863 CCTTTCCTTCTCAATGCCCCTGG - Intergenic
1162468648 19:10858716-10858738 CAGTTTCTAAAGAATGCCCCTGG + Intronic
1162624559 19:11874261-11874283 CAGATGCCACTCAAAGCCCCAGG - Intronic
1163302559 19:16457192-16457214 GATTTCCACCTCAATGCCCCTGG - Intronic
1166566027 19:43766176-43766198 TGGTTCCTACTAAATGCCTCTGG + Intergenic
1168461416 19:56562139-56562161 CAGTTCCTACTCTATAACTCAGG - Intergenic
927208166 2:20623055-20623077 CAGCTCCCACTCCATGCTCCAGG - Intronic
927949945 2:27160586-27160608 CTGTTCCTTCTCAAGGACCCCGG - Intergenic
930479186 2:51925811-51925833 TAGGACCTACTCAATGACCCAGG - Intergenic
930878740 2:56248500-56248522 CAGTTTCCACTCAAAGTCCCTGG + Intronic
931685073 2:64785610-64785632 CAGTGCCCACTCAGAGCCCCAGG + Intergenic
932144832 2:69307687-69307709 AACTTCCTAATCAATGCACCTGG + Intergenic
932716523 2:74103964-74103986 CAGCTCTTACTCAAGGCACCCGG - Exonic
933715323 2:85355562-85355584 CTGTCCCTACTGAAGGCCCCAGG + Intronic
935140712 2:100350623-100350645 CAGCTCCCACTCAGTCCCCCTGG + Intergenic
935745303 2:106185179-106185201 AAATGCCAACTCAATGCCCCAGG + Intronic
936574335 2:113641061-113641083 CATTTCCTCCTCCATTCCCCGGG + Intronic
936684319 2:114810050-114810072 CGGTTCATACTCAATGACCTTGG + Intronic
940015469 2:149099890-149099912 CACTTCCTAACCAAAGCCCCTGG - Intronic
940146726 2:150552948-150552970 CTGTTGCTTCTCAATGCCCAGGG + Intergenic
943876477 2:193073103-193073125 CAGTTCCCACCCACTGGCCCAGG - Intergenic
947104180 2:226650923-226650945 CAGGTCCTTCTCAGTGACCCAGG - Intergenic
1171526349 20:25814604-25814626 CAGTCCCTACTCTAAGCCCATGG - Intronic
1171550478 20:26041281-26041303 CAGTCCCTACTCTAAGCCCATGG + Intergenic
1173165564 20:40684898-40684920 GAGATCCTACTCCATGTCCCAGG + Intergenic
1173809632 20:45948103-45948125 CAGCTCCTTCTCATGGCCCCTGG + Intergenic
1175465154 20:59185720-59185742 CAATTCCTGCTCCATTCCCCAGG - Intergenic
1177194286 21:17886189-17886211 AAGTTCCTTCTCAAAGACCCAGG + Intergenic
1177490147 21:21813364-21813386 AAGATCCTACTCAATGTTCCTGG - Intergenic
1178274489 21:31224553-31224575 CAGTTGCTCCTCTCTGCCCCCGG - Intronic
1183389814 22:37539150-37539172 CAGTTCCTACTCAAGGAGGCTGG + Intergenic
1183398679 22:37588289-37588311 CAGTTCCTTCTCCCTGGCCCAGG + Intergenic
1183715356 22:39530069-39530091 CAGGTCCTGCTGAAAGCCCCAGG + Intronic
1185425837 22:50769827-50769849 CATTTCCTCCTCCATTCCCCGGG - Intronic
951140876 3:19157351-19157373 AAGCTCCTTCTCATTGCCCCAGG - Intronic
957120373 3:76082918-76082940 CAGTCTCTACTCTATGCCCATGG - Intronic
958556841 3:95689993-95690015 CAGTTCCAACTCAATGGTCTGGG - Intergenic
963450089 3:145468358-145468380 CAGTTCCTTCTCCATGACACTGG + Intergenic
969454657 4:7294501-7294523 GAGCTCCTCCTCCATGCCCCAGG + Intronic
969454665 4:7294524-7294546 GAGCTCCTCCTCCATGCCCCAGG + Intronic
969655826 4:8497942-8497964 CAGCTCCTGCTCCCTGCCCCTGG - Intergenic
969699553 4:8760726-8760748 CAGCCCCTCCCCAATGCCCCTGG + Intergenic
969978538 4:11130230-11130252 CAGGTCCTACCCAAAGTCCCAGG + Intergenic
972198062 4:36678095-36678117 CACTTCCTACTCTGAGCCCCTGG + Intergenic
972521451 4:39861036-39861058 AAGTTCTTACTCTATCCCCCGGG - Intronic
973101150 4:46272734-46272756 CTGTTCCTCCTAAATGCCCTGGG - Intronic
985916352 5:2921705-2921727 CAGTTTCTACTGAAGGCGCCAGG - Intergenic
994891979 5:105647781-105647803 CAGTTCCTACTCAGTGGCCCAGG + Intergenic
995331058 5:110946570-110946592 CAGCTCTTACCCAATGTCCCTGG + Intergenic
997487831 5:134246618-134246640 CAGCTCCTACTCACTCCCTCAGG + Intergenic
998093972 5:139386939-139386961 CAGTTCCAACTCCAGGCCTCTGG - Intergenic
1001677501 5:173530767-173530789 CAGTTCCTACTGAATGCTGAGGG - Intergenic
1005399673 6:25418665-25418687 CAGTGCCTTCTCAATGCTACAGG - Intronic
1005579290 6:27218122-27218144 AAGTTCCTCCACGATGCCCCAGG - Intergenic
1005639743 6:27784743-27784765 CAGTTAGTACACTATGCCCCCGG + Intergenic
1006368800 6:33632183-33632205 CAGTTTCTCCTCCATGCCCCAGG + Intronic
1006964378 6:37967636-37967658 CAGTTCCAACTCAATACCTCAGG + Intronic
1007737210 6:43989419-43989441 CAGTCCCTACTCCATGTCACGGG + Intergenic
1008003432 6:46384950-46384972 CAGTCCCTCCTCATTTCCCCTGG - Intronic
1008125542 6:47664185-47664207 CACATCCTACTCTCTGCCCCAGG - Intronic
1009215213 6:60912972-60912994 CAGTGTTTACTCAATGCCCAAGG + Intergenic
1009317929 6:62245980-62246002 CAGTTCCTGCTGCATGGCCCAGG - Intronic
1011597145 6:89026732-89026754 CAGTTCCTTCTGAAGGCTCCAGG - Intergenic
1015044070 6:128758255-128758277 CAGTTCCTGCTCATGGCACCTGG + Intergenic
1017480567 6:154850362-154850384 CAGTTCCTTCTTCATGCCTCAGG + Intronic
1017786448 6:157760847-157760869 CAGGTCCTTCCCATTGCCCCAGG + Intronic
1018325931 6:162668785-162668807 CTGTTCCTACTTTATGTCCCTGG - Intronic
1023923054 7:44644995-44645017 CAGTTCCTATTCACTGGGCCTGG - Intronic
1025299308 7:57805318-57805340 CAGTCCCTACTCTAAGCCCATGG + Intergenic
1027023542 7:74833981-74834003 CAGTTCTTAAACAATGTCCCTGG + Intronic
1027064389 7:75111339-75111361 CAGTTCTTAAACAATGTCCCTGG - Intronic
1033218207 7:139509429-139509451 CAGCTCCTGCTCTAGGCCCCTGG + Intergenic
1034400183 7:150856960-150856982 CAGTTCTTCCTCAATACCACAGG + Exonic
1034450210 7:151133229-151133251 CAATTCCTAGCCAATGCCCTTGG - Intronic
1035137938 7:156725819-156725841 CATTTCCTATTCCAGGCCCCTGG + Exonic
1037498554 8:19463818-19463840 CTTTTCCTACTCAATGGGCCAGG + Intronic
1041399894 8:57431107-57431129 CAATTCCAATTCAATGCCACAGG + Intergenic
1041486999 8:58390298-58390320 CAGTTTCTACTGAATGCCTATGG + Intergenic
1044648842 8:94473916-94473938 CAGTTTCTACTGAATGCTCATGG - Intronic
1047209377 8:122828654-122828676 CAGTCCCTTCTCAGTGCCCATGG - Intronic
1048875869 8:138836880-138836902 CTGTTCCTACTCAAAGCCATGGG + Intronic
1049502970 8:142977595-142977617 CAGTTCCAACCCAACACCCCAGG - Intergenic
1053794270 9:41710706-41710728 CAGTCCCTACTCTAAGCCCATGG - Intergenic
1054150903 9:61604117-61604139 CAGTCCCTACTCTAAGCCCATGG + Intergenic
1054182678 9:61922750-61922772 CAGTCCCTACTCTAAGCCCATGG - Intergenic
1054470680 9:65535228-65535250 CAGTCCCTACTCTAAGCCCATGG + Intergenic
1054655829 9:67665729-67665751 CAGTCCCTACTCTAAGCCCATGG + Intergenic
1054817235 9:69486821-69486843 CAGCTCCTACTCTCTGCCCCGGG + Intronic
1058447242 9:105064836-105064858 CAGGTCCTCCTAAAGGCCCCTGG + Intergenic
1185530484 X:814491-814513 CAGTTCCTTCTGGAGGCCCCAGG - Intergenic
1185530545 X:814830-814852 CAGTTCCTTCTGGAGGCCCCAGG - Intergenic
1185616858 X:1427249-1427271 CAGTTCCTTCTGGAGGCCCCAGG - Intronic
1189839958 X:45064901-45064923 CATTTCCTACTCAAGGCTCTGGG + Intronic
1194117815 X:89924242-89924264 CACTTCCTTCTAAATGCCCCTGG - Intergenic
1196374130 X:115013049-115013071 CTGTGTCTACTCATTGCCCCAGG - Intronic
1196695281 X:118604918-118604940 CTGTTCCTCCCCACTGCCCCAGG + Intronic
1198808230 X:140509529-140509551 GGGTTCCTACTGAATGCTCCAGG - Intergenic
1198911771 X:141623015-141623037 CAGTCCCTACTCTATGCACTAGG + Intronic
1199448385 X:147953119-147953141 CAATTCCTACCAAAGGCCCCTGG - Intergenic
1200470594 Y:3581395-3581417 CACTTCCTTCTAAATGCCCCTGG - Intergenic
1200933820 Y:8721076-8721098 CAGCTCACACTCAATGTCCCTGG + Intergenic