ID: 1092800809

View in Genome Browser
Species Human (GRCh38)
Location 12:12164241-12164263
Sequence AGAATTGGAATATTAAAGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 350
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 328}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092800809_1092800812 17 Left 1092800809 12:12164241-12164263 CCTAGCTTTAATATTCCAATTCT 0: 1
1: 0
2: 2
3: 19
4: 328
Right 1092800812 12:12164281-12164303 ATATATCAGTCCAATAAATTCGG 0: 1
1: 0
2: 1
3: 18
4: 246

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092800809 Original CRISPR AGAATTGGAATATTAAAGCT AGG (reversed) Intronic
901247825 1:7746930-7746952 AGAATAGGAAAATCAAGGCTGGG - Intronic
902064972 1:13677464-13677486 ACAATTTGAAAATAAAAGCTTGG - Intergenic
903898246 1:26622884-26622906 AATAATGGAATATTAAGGCTGGG - Intergenic
904589346 1:31601401-31601423 AGGGTTGGAATATTAAATTTAGG - Intergenic
906182312 1:43832740-43832762 AGAATAGGATTACTCAAGCTAGG + Intronic
906913115 1:49977878-49977900 AGAATTGGAAGATAATGGCTAGG - Intronic
906923246 1:50087199-50087221 AGAAATGGAATTTTAAAACATGG + Intronic
907010225 1:50956248-50956270 AGATTTGGAATATTATAGATGGG - Intronic
907393398 1:54173633-54173655 AGAATTGGAATATTAAGCCATGG - Intronic
908312932 1:62903581-62903603 TGGTTTGGAATATTAAAACTAGG + Intergenic
909473505 1:76056242-76056264 AGAATCGGAATCTCAAGGCTAGG - Intergenic
909580265 1:77225226-77225248 AGAAATAGAATATTTCAGCTGGG + Intergenic
910191985 1:84604267-84604289 AGATTTGCAATAGGAAAGCTTGG - Intergenic
910763689 1:90759684-90759706 AGAATTAGAATCTTGTAGCTAGG + Intergenic
910803156 1:91165103-91165125 AGACTTGGAAAATTCAAGCCTGG + Intergenic
910973080 1:92876536-92876558 AGAATTGCCATATAAAAGCCTGG - Intronic
911253121 1:95601901-95601923 AGAATGGAAATAATAAAGGTAGG - Intergenic
915679567 1:157567496-157567518 AGATTTGGAAAATTAAATCATGG + Intergenic
917402405 1:174665116-174665138 AGAATTGGCATTTTATAGTTAGG + Intronic
918170094 1:181988349-181988371 AGAACTGGGATCTTAGAGCTGGG - Intergenic
918639495 1:186822116-186822138 GGAAATGGAAAATAAAAGCTAGG - Intergenic
918954504 1:191188108-191188130 AGTATGAGAATAATAAAGCTGGG - Intergenic
919290083 1:195618905-195618927 AGCATTGGTCTATGAAAGCTAGG - Intergenic
919443459 1:197669459-197669481 AAAATTGGAAAATTATAGATAGG - Intronic
920024274 1:202981472-202981494 AGAAATGGAATAACAAAGCCTGG - Intergenic
923272317 1:232368871-232368893 AAAACTGGAACATGAAAGCTGGG + Intergenic
924499729 1:244625995-244626017 ATAAGTGGAATAACAAAGCTTGG - Intronic
924759301 1:246969128-246969150 GGAAATGGAGTATTAAAGTTTGG - Intronic
1065205453 10:23353422-23353444 AGATTTGAAATATTACATCTAGG + Intergenic
1067221426 10:44346938-44346960 ACAATTGGAATATTTGAGGTCGG + Intergenic
1067270756 10:44789505-44789527 ATAATTGGTAAATTAAAGGTAGG - Intergenic
1067404379 10:46007967-46007989 AGAAATGGAACAACAAAGCTTGG + Intronic
1067492394 10:46723277-46723299 AAAACGGGAATTTTAAAGCTGGG - Intergenic
1067602271 10:47617105-47617127 AAAACGGGAATTTTAAAGCTGGG + Intergenic
1068358790 10:55948242-55948264 AGAGTTGGTGTAATAAAGCTGGG + Intergenic
1069736507 10:70658878-70658900 AGAAGTGGAACAACAAAGCTTGG + Intergenic
1070975177 10:80600684-80600706 AGAATGGTAAGATTAGAGCTGGG + Intronic
1071249655 10:83804036-83804058 AGAAGTGAAATATAAAAGCCTGG + Intergenic
1072308306 10:94129829-94129851 AGACCTGGAATGTTAAAGCAAGG - Intronic
1073598917 10:104827547-104827569 ATAAATGGAATAACAAAGCTTGG - Intronic
1074087291 10:110218153-110218175 AGAATTGGAATCTGGAGGCTGGG + Intronic
1074936113 10:118182936-118182958 TAAATTGGAATCTTAAAGCATGG - Intergenic
1075905663 10:126079629-126079651 AGCATTTGAATTTTAAATCTAGG - Intronic
1076393068 10:130118398-130118420 ACAATTGGAATAATAAAACCTGG + Intergenic
1077278003 11:1725924-1725946 AGAAAGGGAATAATAAAGTTAGG + Intergenic
1078111186 11:8394307-8394329 TGAATTGAAATTTTAAAGATAGG - Intronic
1078389171 11:10921131-10921153 AGAATTGTAAGAGTAAAGTTAGG - Intergenic
1079890380 11:26045036-26045058 AGAATTGAAAAATAAAATCTAGG + Intergenic
1080308993 11:30867849-30867871 AGAATCAGACTTTTAAAGCTGGG + Intronic
1080544037 11:33298225-33298247 AGAAATGGAATACCAAAGCCTGG + Intronic
1081043561 11:38242363-38242385 AGAAGTGGAATAATAAGGTTTGG - Intergenic
1084297458 11:68222203-68222225 AGATTTGGAATTTTAACTCTTGG - Intergenic
1085930308 11:81074218-81074240 AGAATTCAAATAATAAAACTAGG - Intergenic
1086146932 11:83562180-83562202 AGAATAGGAATACTAAGGCCAGG - Intronic
1086273298 11:85094182-85094204 AGAATTGGAAGAACAAAGCCTGG - Intronic
1086858692 11:91898772-91898794 ATAATTGGAATGTAAAAGTTTGG - Intergenic
1087038584 11:93776950-93776972 TGAAATGGAATATTATAACTTGG - Intronic
1087339180 11:96880705-96880727 AAAATTGAAACACTAAAGCTAGG - Intergenic
1087500576 11:98947791-98947813 AGAAATGGAAGTTTAAAACTTGG - Intergenic
1090996200 11:131868135-131868157 AGAATTAGAATTTTAAAGTCTGG + Intronic
1091569162 12:1669520-1669542 AGATTAGGAATATTATAACTAGG - Intergenic
1092495513 12:8989860-8989882 AGAGTTGGAATATGAAAAGTTGG + Intronic
1092800809 12:12164241-12164263 AGAATTGGAATATTAAAGCTAGG - Intronic
1093486496 12:19658439-19658461 AGAATTGAAAAGGTAAAGCTAGG - Intronic
1093526634 12:20111162-20111184 AGAACTGATACATTAAAGCTTGG - Intergenic
1093617917 12:21250670-21250692 AAAAATGGAATTTTAAATCTTGG + Intergenic
1096452755 12:51757999-51758021 AGAATTACAATAATATAGCTAGG + Intronic
1096579290 12:52574108-52574130 AGCACTGGAAAAATAAAGCTAGG - Intergenic
1097686985 12:62700292-62700314 AGAATTGGAATCTCAGAGGTGGG - Intronic
1098256743 12:68624454-68624476 AGAATAGGAATATTATAAATAGG + Intronic
1098494024 12:71113853-71113875 ACAATATGTATATTAAAGCTTGG - Intronic
1098885098 12:75953016-75953038 AGAATTGGAAAACTAAACCTAGG - Intergenic
1099437955 12:82666201-82666223 AGAATTGGAAAATGAAAGCTTGG + Intergenic
1099507271 12:83494780-83494802 AGATTTAGAACATTAAAGTTAGG - Intergenic
1100338413 12:93655082-93655104 AGAATTGAAAAATTAAGGCTGGG - Intergenic
1100340045 12:93670129-93670151 ATAATGGGAATATGAATGCTGGG - Intergenic
1100629062 12:96368633-96368655 ACAATTGGAATATTAAAAGGAGG - Intronic
1101220038 12:102629297-102629319 AGAATTGTGATATTCAGGCTGGG + Intergenic
1103657258 12:122481954-122481976 AGATTTGGAAGATTCAAGCCAGG - Exonic
1104026560 12:125031821-125031843 AGAATAGGATTTTTAAGGCTGGG - Intergenic
1106053604 13:26216544-26216566 ATAAATGGAAAATTTAAGCTTGG - Intronic
1107283969 13:38768570-38768592 AGAGTTGGAAAAATAAGGCTGGG - Intronic
1107620138 13:42218886-42218908 AGAATTGGTAGATAAATGCTTGG + Intronic
1108133066 13:47324240-47324262 AAAGTATGAATATTAAAGCTTGG - Intergenic
1108234218 13:48385550-48385572 AAAACTGGAAAATTGAAGCTAGG + Intronic
1111191356 13:84811331-84811353 AGAATTGGGATTTTAAAGACAGG + Intergenic
1111832457 13:93346447-93346469 AGAATAGGGATTTTAAAGCATGG - Intronic
1111872482 13:93850286-93850308 AGAATGGGAATTCTAAGGCTGGG - Intronic
1112088738 13:96058773-96058795 AGAAATGTAATTTTATAGCTGGG + Intergenic
1112418220 13:99222918-99222940 AGAATTGGTATTTAAATGCTTGG + Intronic
1114754837 14:25247242-25247264 ATAATTGGAACATGAAATCTTGG - Intergenic
1114866654 14:26602833-26602855 ACAATTGGAATATTAAGATTTGG - Intergenic
1115089893 14:29561648-29561670 AGAAAGGGAATAATAAAGCTTGG + Intergenic
1115103319 14:29729661-29729683 AGAATGGAAATAATAAAGATAGG - Intronic
1119221405 14:72910842-72910864 AGAATTGGAACAATATGGCTGGG + Intergenic
1119256150 14:73199185-73199207 AGAAATGAAATACTAGAGCTTGG + Intronic
1120167572 14:81217987-81218009 AGAATTAGAATGTTAAAGTAGGG - Intronic
1120263897 14:82224671-82224693 AAAATTGAAATATTCAGGCTGGG - Intergenic
1120398666 14:84000823-84000845 ACCAATGCAATATTAAAGCTGGG + Intergenic
1126907786 15:53386119-53386141 AGAATTGGAATATTAGTACCAGG - Intergenic
1127414090 15:58740115-58740137 AGAACAGCAATATCAAAGCTCGG + Intronic
1127443798 15:59039257-59039279 AGAATTAGAATATCAAGGCCGGG - Intronic
1127625226 15:60773967-60773989 ACAATTAGCATCTTAAAGCTGGG - Intronic
1127949239 15:63788327-63788349 AGAATTGGGATAATATAGTTGGG + Intronic
1130292422 15:82614298-82614320 AGAAATAGAATATTACAGCTGGG - Intronic
1131857122 15:96609446-96609468 AGAATTGTCATCTTATAGCTAGG + Intergenic
1132267434 15:100486718-100486740 ACACTTGAAATAGTAAAGCTAGG - Intronic
1133602631 16:7354652-7354674 AGAATTAGGATATTTTAGCTGGG + Intronic
1134811426 16:17170244-17170266 AGAATTGAAATGTCACAGCTTGG - Intronic
1135118552 16:19745056-19745078 AATATTGGAATATTAAATATAGG - Intronic
1135144730 16:19951258-19951280 AGAAATGGAATCTAAAAGCCTGG + Intergenic
1136645045 16:31606730-31606752 AGAATTAAAATTTAAAAGCTGGG + Intergenic
1137915888 16:52429479-52429501 AGACTTGGAACATTAAGTCTTGG + Intergenic
1138409488 16:56827237-56827259 TGAATTGGACTATTTAATCTTGG + Intronic
1139833508 16:69819942-69819964 AGAAATGGAATCATACAGCTGGG + Intronic
1140300419 16:73752153-73752175 GGAATTGGAAGCTGAAAGCTGGG - Intergenic
1140383053 16:74507913-74507935 AGATGTAGAATATTAAAGCTAGG + Intronic
1142734366 17:1886283-1886305 ATAAATAGAATATCAAAGCTTGG - Intronic
1144150262 17:12436253-12436275 CGAAATGGAATATGAAAGCCAGG + Intergenic
1149432032 17:56602009-56602031 AGAATCACAATATTTAAGCTGGG + Intergenic
1149473648 17:56940470-56940492 CGCATTGGAAAATTAAACCTTGG - Intronic
1151435094 17:74090322-74090344 ATTATTGGAATTTAAAAGCTTGG - Intergenic
1151446571 17:74169770-74169792 AGAATTGGACTTTTTAGGCTGGG + Intergenic
1155428671 18:25732836-25732858 AGACTTGTAATACTAAACCTTGG + Intergenic
1155555046 18:27009547-27009569 AGAATTAAAATATTATAGATAGG + Intronic
1155790261 18:29958619-29958641 TGATTTGGAATACTAATGCTAGG + Intergenic
1156181866 18:34614120-34614142 ATAAATGGAATAACAAAGCTTGG + Intronic
1156524600 18:37754902-37754924 AGAACTGGAAGATAAAAGCCTGG - Intergenic
1156546575 18:37969574-37969596 AGGACTGGAATATTAAAGGAGGG - Intergenic
1157470507 18:47984514-47984536 TGACTTGGAATATAAAAGCTGGG + Intergenic
1157706307 18:49810194-49810216 TAAATTTGTATATTAAAGCTTGG + Intronic
1157866038 18:51185641-51185663 TGAATTGGGATTTAAAAGCTAGG - Intronic
1158093470 18:53742974-53742996 TGAATTGGAATATTCAAGAATGG + Intergenic
1161758581 19:6153280-6153302 ATAATTGGTATATTAATGGTTGG - Intronic
1164035717 19:21452542-21452564 AGAATTGGATTATAAAACATAGG + Intronic
1164491891 19:28722477-28722499 ACAGTTTGAATTTTAAAGCTGGG + Intergenic
1165035116 19:33027349-33027371 AGAAATGGATGATTATAGCTGGG + Intronic
1165210129 19:34228805-34228827 AGAATTGGAATATTTAAGGCTGG + Exonic
1165528111 19:36373676-36373698 ATAATTTTAATACTAAAGCTCGG + Intronic
1167508843 19:49885141-49885163 AGAATAAAAATGTTAAAGCTGGG - Intronic
1168161353 19:54512367-54512389 ACAAATAGAAAATTAAAGCTCGG - Intergenic
926417003 2:12659417-12659439 AGAAATGGCAGATTCAAGCTGGG + Intergenic
928095301 2:28401057-28401079 AGAAATGGAATTTAAAAGTTGGG + Intronic
928736826 2:34300957-34300979 AGAATTGGAAATTTAAGGCTGGG + Intergenic
930527423 2:52547326-52547348 AGAAAAGGAATAATAAAGATTGG - Intergenic
930920538 2:56748286-56748308 GGAATTGGAATTTTAAAAATGGG - Intergenic
932388374 2:71359905-71359927 AGAATTTTAATATTAAAAATAGG + Intronic
933165284 2:79068715-79068737 GGAATTGGAACATGATAGCTTGG - Intergenic
933465899 2:82651133-82651155 ATAAATAGAATAATAAAGCTTGG - Intergenic
933572322 2:84028071-84028093 AGAAGTGAAATATTATAGATAGG + Intergenic
933901698 2:86854823-86854845 AGAAAAGAAATATTAAGGCTGGG + Intronic
934617947 2:95786703-95786725 AGAATGGGAACATTGATGCTGGG - Intergenic
934642946 2:96037856-96037878 AGAATGGGAACATTGATGCTGGG + Intronic
935778850 2:106494441-106494463 AGAAAAGAAATATTAAGGCTGGG - Intergenic
937720527 2:125090148-125090170 AGAAGTGGAATATGAAAGTGAGG + Intergenic
938574817 2:132594060-132594082 AGAAGTGGAAAATTACAGCCAGG + Intronic
939295607 2:140260257-140260279 AGCAATGTAATATTAAAGTTAGG + Intronic
939761065 2:146180257-146180279 AGAATTGGATTATAAAACATTGG + Intergenic
941080251 2:161052360-161052382 AGAAGTGCAGTATCAAAGCTGGG + Intergenic
941415929 2:165221470-165221492 TGGATTGGAATATCAGAGCTTGG - Intergenic
942634497 2:177988375-177988397 TGTCTTAGAATATTAAAGCTAGG - Intronic
943043678 2:182832640-182832662 AGAATTGGAATTGTAATTCTGGG + Intergenic
943114857 2:183655901-183655923 AAACTTGGAATATTAGAGTTGGG - Intergenic
943200085 2:184811550-184811572 AGAATTTAAATATTGAAGCCAGG + Intronic
943838674 2:192549784-192549806 AGACTAGGAAAATTAAAACTGGG - Intergenic
943870038 2:192983186-192983208 AAAAATAGAATATTATAGCTAGG - Intergenic
943888400 2:193252917-193252939 AGTATTTGAATATGAAAGGTAGG - Intergenic
944037258 2:195309743-195309765 AGATTTGTAATATAAAAACTGGG - Intergenic
944453063 2:199863097-199863119 AGAAAGAGAATATTAAAGTTGGG - Intergenic
944518380 2:200536747-200536769 AGAAAAAGAATTTTAAAGCTTGG - Intronic
945270823 2:207938082-207938104 GGAATGTGAATATTCAAGCTAGG + Intronic
945840253 2:214879379-214879401 ATAATTGGAATAGAAATGCTTGG + Intergenic
1169600536 20:7255047-7255069 AGAAATGAAAGATGAAAGCTTGG - Intergenic
1169878371 20:10322047-10322069 AGCATTTGAAAATTAAAGATTGG - Intergenic
1172818176 20:37707089-37707111 AGAAATGGAATAACAAAGCCTGG - Intronic
1179106717 21:38407117-38407139 AGAAATGGAATTTTTAAGCCAGG - Intronic
1182065415 22:27428150-27428172 AGAATTAGATGATCAAAGCTAGG - Intergenic
1184672014 22:46018166-46018188 AGAATTGGAGTAAAAAGGCTGGG - Intergenic
949203678 3:1412075-1412097 ATAAATGGATTATGAAAGCTGGG - Intergenic
949223716 3:1668141-1668163 TTAATTGTAATAATAAAGCTTGG + Intergenic
949337507 3:2992007-2992029 AGAATTGGATTTTGAAAGCATGG - Intronic
949852656 3:8434491-8434513 AGGATTGAAAAATTGAAGCTAGG - Intergenic
951155260 3:19344925-19344947 TGAATTAGAAGATTAAAGGTTGG - Intronic
951289011 3:20852990-20853012 AGAATAGGAAGACTAAAACTTGG + Intergenic
951661549 3:25072225-25072247 ACAATTTGAATCTTAAAACTGGG + Intergenic
951901535 3:27662452-27662474 AGAATTGGATTTTTACAGTTGGG - Intergenic
953090051 3:39715156-39715178 AGAATTATAATATTAAAGCAAGG + Intergenic
953174555 3:40538122-40538144 AGAAATGGAAGATCAAAGCCTGG + Intronic
955236748 3:57146317-57146339 AGTCTAGAAATATTAAAGCTAGG - Intronic
956059482 3:65335187-65335209 AAAATTGGAAGAAGAAAGCTAGG + Intergenic
956315205 3:67927760-67927782 AACATTGGAATATTAAAGCATGG - Intergenic
956362767 3:68466851-68466873 AAAATAGAAATTTTAAAGCTGGG + Intronic
956395238 3:68818973-68818995 AAAATTGCAATATTTAGGCTGGG + Intronic
956794055 3:72702327-72702349 AGAAGTGGAATTTTTAACCTAGG - Intergenic
957241142 3:77662710-77662732 AGAATTGGAAAATTAAGAATAGG - Intergenic
957731155 3:84138631-84138653 AGAACTGAAATATTAAGGGTGGG + Intergenic
958543797 3:95513685-95513707 CTAATTGAAATATTAAAGCATGG + Intergenic
959866100 3:111272016-111272038 AGAATTGGAATATTAAAATTGGG - Intronic
960080553 3:113535762-113535784 AGCATTTGCATATTAAAGATTGG - Intronic
960179733 3:114561662-114561684 ATAAATGGAATAATAAAGCCAGG - Intronic
960204017 3:114873108-114873130 AGAAATGAAATACAAAAGCTTGG + Intronic
960356705 3:116662698-116662720 TGTATTGGAATTGTAAAGCTAGG + Intronic
960777838 3:121280582-121280604 ATAATTGGCATATCAAAGTTTGG - Intronic
961498307 3:127310765-127310787 AGAATTAGAATGTAAAAGTTTGG - Intergenic
963273873 3:143311416-143311438 TGAATTGGAATAAGAATGCTGGG - Intronic
963707476 3:148705418-148705440 AGAGTTAGATTATTAAAGCTGGG - Intronic
964180105 3:153873408-153873430 AAAATTGGATTATTAAGGCCAGG - Intergenic
965151928 3:164988720-164988742 AGAATTTGAATGTCAAAGCAAGG + Intronic
965305606 3:167059738-167059760 GGAATTGGAGCATTAAAGTTTGG - Intergenic
967012512 3:185449783-185449805 AGTATTAGAATTTTAAAACTGGG + Intronic
967354535 3:188553372-188553394 AGATTTGGAAGACTGAAGCTTGG + Intronic
967575697 3:191088909-191088931 AAAATTGGAATATTTAGTCTAGG - Intergenic
969200624 4:5601977-5601999 AGAAGAGGATTAATAAAGCTGGG + Intronic
970457101 4:16235733-16235755 TGAGGTGGAATATTAGAGCTGGG - Intergenic
970955603 4:21807325-21807347 AGAATTGGACTTTTAATGCAGGG - Intronic
971553643 4:27984179-27984201 AGAATTGAAATTTTAAAATTAGG - Intergenic
971957551 4:33441229-33441251 GGAACAGCAATATTAAAGCTTGG - Intergenic
972125322 4:35758405-35758427 AGAAATGAAATCTTAAAGCTAGG + Intergenic
974960911 4:68698832-68698854 ATTAATGGAATATCAAAGCTTGG + Intergenic
977860048 4:101946444-101946466 AGAATTAGAATAATAAAGAATGG + Intronic
978194857 4:105959261-105959283 AGAAATGAAATATAAATGCTAGG - Intronic
978399722 4:108317677-108317699 TGAATTTGAACATTAAAGATGGG + Intergenic
979848364 4:125545531-125545553 AGAATGGGAAAAGTAATGCTGGG + Intergenic
980751120 4:137090378-137090400 AGAATTGGAATAAAGAAGGTGGG + Intergenic
981065463 4:140479455-140479477 AGAATTGGAAAATTAAATAAAGG - Intronic
981441009 4:144781894-144781916 AGACTTAGAATATTAAACTTGGG + Intergenic
981617926 4:146662070-146662092 AGAATTAGAAAATTTAAGCGAGG - Intergenic
982347417 4:154376013-154376035 AAAATTGGTATACTAATGCTTGG + Intronic
982446041 4:155491849-155491871 ACAGTTGGAATATTCAAACTTGG + Intergenic
982841833 4:160197806-160197828 AGAATTGAAATAGTAAAAGTAGG + Intergenic
983048517 4:163015319-163015341 ATAAATGGAATAACAAAGCTTGG + Intergenic
984676500 4:182554295-182554317 AAAGTTGGAATATTTAAACTGGG - Intronic
984791113 4:183615942-183615964 AGAAATGGAATATTGAGGCTGGG - Intergenic
985244452 4:187965889-187965911 ACAATCGGAATGTTACAGCTGGG - Intergenic
986016656 5:3763608-3763630 ACAATTGGAATATAAAAGAAAGG + Intergenic
986870367 5:12037860-12037882 AGAATTGAAATCTAAAAGTTTGG + Intergenic
987287519 5:16472183-16472205 AGAATGAGAATATTCAAGCCTGG + Intergenic
987567847 5:19616470-19616492 AGCATTGCAATAGTTAAGCTAGG - Intronic
988000284 5:25339172-25339194 AGATGTGGAATTATAAAGCTGGG + Intergenic
989080744 5:37617774-37617796 AAAATTAGACTATGAAAGCTAGG - Intronic
989454542 5:41627543-41627565 AAAATTGGAATAATAAAGTCTGG - Intergenic
990393406 5:55351776-55351798 AGAAATGGGATATTAAAAATGGG + Intronic
990620437 5:57553454-57553476 AGAATTGGAAGATTAACTTTAGG - Intergenic
991140453 5:63234857-63234879 AAAAGTGGAATTTTCAAGCTGGG - Intergenic
991171567 5:63632469-63632491 ATAAATGGAATAACAAAGCTTGG - Intergenic
991225720 5:64269069-64269091 AGATTTAGACTATTAAAGATGGG - Intronic
992597877 5:78364416-78364438 AGAATTAGAATTTCACAGCTGGG + Intronic
993274590 5:85840897-85840919 AGAAATAGAAAATTAAGGCTGGG + Intergenic
993382371 5:87222446-87222468 AAAATAGGGAGATTAAAGCTGGG + Intergenic
994691776 5:103028434-103028456 AGAATGGGAAAAATAAAACTGGG - Intronic
995431766 5:112087297-112087319 AGTATTTGAACATAAAAGCTAGG - Intergenic
997192743 5:131953770-131953792 AGACTTCAAAAATTAAAGCTAGG - Exonic
997577170 5:134989170-134989192 AGAAATGGAATAACAAAGCCCGG - Intronic
999897172 5:156047554-156047576 AGAAATGGAACAACAAAGCTTGG + Intronic
1001067953 5:168554665-168554687 ACAATGGAAATATTAAAGCAAGG - Exonic
1001125924 5:169019143-169019165 AGAATTGGGATCTTCCAGCTGGG + Intronic
1001183321 5:169541663-169541685 AGAAATGGAACAATAAAGCCTGG + Intergenic
1001509652 5:172310945-172310967 AGAACTGGAATATAAATGGTAGG + Intergenic
1003663294 6:8085446-8085468 AGATTAGCAATATTAAGGCTGGG - Intronic
1003843091 6:10142773-10142795 TGAACTGGAATATTATAGTTTGG + Intronic
1003929084 6:10906076-10906098 AGTATTAGAATATTAAATATTGG + Intronic
1004419585 6:15456573-15456595 AAAAATGGTATTTTAAAGCTAGG - Intronic
1005468319 6:26137023-26137045 AGCATTAGAATATAAAAGCTGGG - Intronic
1005872125 6:29982435-29982457 AGACTTAAAATATTAAGGCTGGG - Intergenic
1006636891 6:35467599-35467621 AGAATGGGCATCTTAAAGGTGGG + Intergenic
1007222098 6:40286815-40286837 AGAACTGGAATCTTAGATCTAGG - Intergenic
1007917996 6:45578978-45579000 GGAATTAGAATGTTAAAGCCTGG - Intronic
1008142299 6:47846034-47846056 ATAATTGTACTATTAAAGTTAGG - Intergenic
1009743236 6:67775999-67776021 TGAGTTAGAATATTAAAGGTAGG + Intergenic
1010390421 6:75330815-75330837 AGAATAGGAATATTGATGATGGG + Intronic
1010785565 6:79995698-79995720 AGAATTGTGATATAAAATCTAGG + Intergenic
1012322210 6:97863571-97863593 GGAATTGGAATAATAAAGGGAGG - Intergenic
1012482059 6:99678124-99678146 AGAAGTGGATAAATAAAGCTTGG - Intergenic
1012653341 6:101784552-101784574 AGGATTGGAATGTTATGGCTTGG + Intronic
1012661251 6:101896606-101896628 AGAATTTGAAAAATAAAGATGGG - Intronic
1013789347 6:113818358-113818380 ATAACTAGAATATTACAGCTAGG - Intergenic
1014302674 6:119702047-119702069 AGAATGAGAATCTAAAAGCTAGG + Intergenic
1016946327 6:149537751-149537773 AGAAATGGAACAACAAAGCTTGG + Intronic
1017238342 6:152140536-152140558 ATAATTGGAACATGAGAGCTGGG + Intronic
1020041321 7:5004541-5004563 AGAATTAAAACATTTAAGCTGGG - Intronic
1020699720 7:11464494-11464516 AGAATTGAAACATTAATGTTTGG - Intronic
1020760059 7:12257908-12257930 ATAATTGGTAAATTTAAGCTGGG + Intergenic
1020944713 7:14588347-14588369 TGAAATTGAATATTAAAACTAGG - Intronic
1021221657 7:17981474-17981496 AGAATTGGAACAGCAAATCTTGG - Intergenic
1021316716 7:19157045-19157067 AGAAAAGGAATATTAGGGCTTGG + Intergenic
1023099905 7:36706417-36706439 AGAAATGGAACAATAAAACTTGG - Intronic
1023217096 7:37874419-37874441 ATAAATGGAGTATTAAAGTTGGG + Intronic
1024116602 7:46200018-46200040 AGATTTGGAGTAATAAAGTTAGG + Intergenic
1024839387 7:53567356-53567378 AGAATTGGAAAATCTAGGCTTGG + Intergenic
1025195989 7:56934122-56934144 AGAAATGGAATAATAAAGCCTGG + Intergenic
1025675959 7:63642814-63642836 AGAAATGGAATAATAAAGCCTGG - Intergenic
1027423887 7:78042818-78042840 AGATTTGGAGTATCAGAGCTGGG + Intronic
1027863613 7:83617013-83617035 TAAATTGGAATATTTAAGCACGG - Intronic
1028093960 7:86737392-86737414 AGCATCGGAATATTAGACCTAGG - Intronic
1030281499 7:107780380-107780402 AGAATTGGAAGTCTGAAGCTTGG - Intronic
1030625765 7:111844480-111844502 TGACTTGGAATATAAAATCTTGG + Intronic
1031270044 7:119636734-119636756 TGAAGTGAAATATAAAAGCTAGG - Intergenic
1031770520 7:125835557-125835579 CTAATTGGATTTTTAAAGCTAGG - Intergenic
1032753751 7:134868399-134868421 AGCATTGGCATATAAAACCTGGG + Intronic
1034022098 7:147655677-147655699 AGAAATGGAACAACAAAGCTTGG - Intronic
1034028225 7:147731404-147731426 AGAAATGGAATAACAAAGCCCGG + Intronic
1034037368 7:147838437-147838459 AGAATCAGAATATAAAAGTTTGG - Intronic
1034465484 7:151226223-151226245 AGAGTTGGAATCTTGATGCTGGG - Intronic
1036593876 8:10194662-10194684 TTACTTGGAATTTTAAAGCTGGG + Intronic
1038230307 8:25693278-25693300 TGACTTAGAATATCAAAGCTGGG - Intergenic
1038249952 8:25894040-25894062 ATATTTGGAATATTAAAACCTGG - Intronic
1038856581 8:31339643-31339665 AGGCTTGCAAAATTAAAGCTAGG - Intergenic
1038986937 8:32821596-32821618 AGGAGTGTAATATTAAAGTTGGG + Intergenic
1039978515 8:42387160-42387182 AGAATCAGAATTTTAGAGCTGGG - Intergenic
1040033602 8:42847846-42847868 ATAAATGGAATAATAAAGCCTGG - Intergenic
1040926487 8:52689194-52689216 AGAAATGAAAAATTAAAGCAAGG - Intronic
1042448710 8:68920143-68920165 AGAATTGGAATCATATGGCTGGG + Intergenic
1043252568 8:78093550-78093572 AGAAGTGGAATACTAGAGTTAGG - Intergenic
1043540864 8:81260683-81260705 AGAATTAAAATATTTAAACTTGG + Intergenic
1044680733 8:94774870-94774892 AGAAATGGAAAATAAAGGCTGGG - Intronic
1047585463 8:126267786-126267808 AGAATTTGTCTATTGAAGCTAGG - Intergenic
1050520474 9:6492999-6493021 AGAATTTTAATATGAAAGCCAGG + Intronic
1051462698 9:17340262-17340284 AGAACTGGAATGGGAAAGCTAGG - Intronic
1051767717 9:20542641-20542663 AGAAGTGGAAGAGCAAAGCTTGG - Intronic
1053098319 9:35348293-35348315 AGCATTGGAAAAATAAAGCTTGG + Intronic
1053665884 9:40317284-40317306 GTAATTGGAATGTTAAAGGTGGG + Intronic
1053915463 9:42942329-42942351 GTAATTGGAATGTTAAAGGTGGG + Intergenic
1054377038 9:64457312-64457334 GTAATTGGAATGTTAAAGGTGGG + Intergenic
1054518727 9:66058999-66059021 GTAATTGGAATGTTAAAGGTGGG - Intergenic
1056185853 9:84134236-84134258 AAAATTGGAAATTTAAAGTTTGG - Intergenic
1059964061 9:119596294-119596316 AGAAATGGGATATTCCAGCTTGG - Intergenic
1060566857 9:124600495-124600517 AGAATTGGATTTTTAAAACCTGG - Intronic
1185970046 X:4652602-4652624 AGAGTTGGAAAATTAGGGCTGGG - Intergenic
1185971209 X:4666671-4666693 AGATTTGGAAGATAAATGCTGGG + Intergenic
1186573535 X:10741150-10741172 AACCTTGGACTATTAAAGCTAGG + Intronic
1186948924 X:14600289-14600311 TGATTAGGAATATTAAAGTTGGG + Intronic
1188082007 X:25854853-25854875 AGAATGGGAATATTTTAACTTGG - Intergenic
1189711778 X:43820286-43820308 TAAATTAGAATATTAGAGCTGGG - Intronic
1192749976 X:73979238-73979260 TAAAATGGAATATTAAAGCCTGG - Intergenic
1193283240 X:79681071-79681093 AGAATTGCAAAATTAAAGTATGG - Intergenic
1193297301 X:79848278-79848300 AGAATATGAATAGTCAAGCTGGG - Intergenic
1193677088 X:84467698-84467720 AGAATTTGAATAGCAGAGCTTGG - Intronic
1194070991 X:89325988-89326010 TGATTTGGAATATTCAAGCATGG - Intergenic
1194128499 X:90050002-90050024 AGAAGTGTAAATTTAAAGCTGGG + Intergenic
1194230234 X:91313427-91313449 AGAATTAAAACCTTAAAGCTAGG + Intergenic
1194657485 X:96590323-96590345 ATAATTAGAATATTAAAATTTGG - Intergenic
1194725825 X:97396115-97396137 AGAATTAGAATATTAAAATATGG - Intronic
1194862324 X:99015693-99015715 ATAAATGGAATAATAAAGCCTGG + Intergenic
1194889080 X:99355243-99355265 AGCATTTGCATATCAAAGCTTGG - Intergenic
1194928671 X:99861163-99861185 TGAATAGAAATATTAAAACTAGG - Intergenic
1196325623 X:114398903-114398925 ATAATTGGAATTGTAAATCTTGG - Intergenic
1196714967 X:118802004-118802026 AGAACTGGAAAAATAATGCTGGG + Intergenic
1199781281 X:151062269-151062291 AAAATTTGAATACCAAAGCTGGG - Intergenic
1200725221 Y:6661729-6661751 TGATTTGGAATATTCAAGCATGG - Intergenic
1201671969 Y:16532868-16532890 AGAATTTGAATATTACATATTGG + Intergenic