ID: 1092801102

View in Genome Browser
Species Human (GRCh38)
Location 12:12167730-12167752
Sequence GTGCACTATCTGGTAAACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 77}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092801102 Original CRISPR GTGCACTATCTGGTAAACAC TGG Intronic
903984056 1:27212181-27212203 GTGCACTATTTGGGATGCACCGG - Intergenic
906843779 1:49168303-49168325 TGGCATTATCTTGTAAACACTGG - Intronic
909442393 1:75712161-75712183 GTACACTACATGGTAAAGACTGG + Intergenic
915070716 1:153263485-153263507 GTGCCCAATGTGGGAAACACAGG - Intergenic
916475912 1:165168839-165168861 GTACACTGACTGGCAAACACTGG + Intergenic
918373729 1:183887509-183887531 GTGTACTCACTTGTAAACACTGG + Intronic
922377127 1:224979983-224980005 GTGTACTACCTGGTTAACACTGG - Intronic
923151605 1:231238440-231238462 GTGCAGGGTTTGGTAAACACAGG - Intronic
923305246 1:232682398-232682420 GTGCTGTAGGTGGTAAACACAGG + Intergenic
1064774039 10:18755641-18755663 GTGCAATTTCTGGTAAACTTGGG - Intergenic
1070204274 10:74240929-74240951 TTTCACTATCTGGGAAACTCCGG + Intronic
1079406825 11:20155247-20155269 GTACACTATTTTGTACACACAGG - Intergenic
1081967733 11:47179644-47179666 TGGCAGTGTCTGGTAAACACTGG - Intronic
1087979766 11:104596964-104596986 GTTGACTATCTGGTAATCAAAGG - Intergenic
1091004490 11:131940467-131940489 TTGCACCATCTGTAAAACACTGG - Intronic
1092801102 12:12167730-12167752 GTGCACTATCTGGTAAACACTGG + Intronic
1101733663 12:107446719-107446741 GTGGATTATCTGGTAGACACAGG + Intronic
1105361392 13:19720766-19720788 GTGCACTATGTGTCAAACCCTGG - Intronic
1105399915 13:20081699-20081721 ATGCACTATATAATAAACACGGG + Intronic
1108822218 13:54367646-54367668 GTGCAGTTTCTGAGAAACACAGG - Intergenic
1115490420 14:33952852-33952874 ATTCACTATGTGCTAAACACTGG - Intronic
1124926054 15:34071690-34071712 GTGCACTATATGGTATACTAGGG - Intergenic
1132539310 16:501051-501073 GTGCACCAGCTGGAACACACCGG - Intronic
1132831836 16:1932273-1932295 GTCCACTCTCGGGGAAACACTGG + Intergenic
1142324855 16:89408159-89408181 CTGCACTATGTGGCAAGCACTGG + Intronic
1149474549 17:56948774-56948796 CTGCATTATCAGGTAACCACAGG - Intronic
1150753880 17:67892852-67892874 GTGGACTATCAGATAAACAGTGG - Intronic
1151129047 17:71876707-71876729 TTGCCCTATGTGGAAAACACAGG - Intergenic
1153884687 18:9453946-9453968 TGGCAGTATCTGGTAAACAAAGG - Intergenic
1156142358 18:34130731-34130753 GTTCATTATGTGGTAAACATTGG - Intronic
1165879076 19:39030295-39030317 GAGCCCTATCTTGTAAACAGGGG + Intronic
928073123 2:28237590-28237612 GTGCAAGATCTGGCAAAAACTGG - Intronic
929874162 2:45782597-45782619 GTACATTATCTTGGAAACACTGG - Intronic
931476843 2:62596648-62596670 GTGAACTAGCTGGTAATGACGGG - Intergenic
932096401 2:68853461-68853483 TTGGAATATCTGGTACACACAGG + Intergenic
943235452 2:185312954-185312976 GTGCACTGTCAGTTATACACAGG + Intergenic
944719501 2:202408792-202408814 TTGAACTATCTTGGAAACACAGG + Intronic
1173268251 20:41506723-41506745 GTTCAAAATCTGGCAAACACTGG + Intronic
1183509957 22:38228934-38228956 CTGCACCAACTGGTAAACAATGG + Intronic
958684960 3:97380412-97380434 GTGCACTATATTGTACACATAGG - Intronic
959086409 3:101855104-101855126 GTGCAGGATCTGGTGAACATCGG + Exonic
962849637 3:139298660-139298682 GTGCACCATCTGGGAAGCATGGG + Intronic
965012775 3:163116541-163116563 GTGGACTGCCTTGTAAACACTGG - Intergenic
965535823 3:169822771-169822793 CTGCTCTACCTGGGAAACACCGG + Exonic
967753508 3:193141808-193141830 GTGCAATATAATGTAAACACAGG + Intergenic
970389934 4:15598540-15598562 GCGCAGTATCTGGTAAATAATGG + Intronic
970969169 4:21961400-21961422 ATGCCCTAGCTGGTAAGCACAGG - Intergenic
972274441 4:37543890-37543912 GTGCCCTCTCTTGTATACACTGG + Intronic
973582055 4:52353762-52353784 ATTCAGTATCTGGTAAAGACTGG + Intergenic
978489214 4:109293381-109293403 GTGAACTCTTTGGTAAACAAGGG + Intronic
983293978 4:165842127-165842149 GTGCAATTCCTGGTATACACAGG + Intergenic
989548937 5:42709583-42709605 GTGCAATATCAGGTATACAGTGG - Intronic
989651155 5:43691910-43691932 ATGCACTGTTTGGTAGACACAGG - Intronic
990325479 5:54671173-54671195 GTGCACTTTCTGGAAAAGCCTGG - Intergenic
990865665 5:60377074-60377096 GCACACTTCCTGGTAAACACAGG + Intronic
990983535 5:61621879-61621901 GTGCACTATTTGGAAAACAAGGG - Intergenic
991973068 5:72159488-72159510 GTGGACTAGCAAGTAAACACTGG + Intronic
995715037 5:115073931-115073953 CTGCACTATCTTGAATACACTGG - Intergenic
998530210 5:142877363-142877385 GGACACAATGTGGTAAACACAGG - Intronic
1000877402 5:166657879-166657901 TTGCACTATCTGGTTAATAAAGG - Intergenic
1003463972 6:6359666-6359688 GTGAACTGTCTGGTAAACCAGGG + Intergenic
1005525672 6:26645506-26645528 CTGCAGTTTCTGGTATACACTGG + Intronic
1014101970 6:117520864-117520886 GAGCAATATATGGTGAACACTGG - Intronic
1016413836 6:143812572-143812594 GGGCACCATCTGGAAAATACTGG - Intronic
1021051019 7:15985000-15985022 GTGCAGTATCTGCTACACACTGG + Intergenic
1021391629 7:20100425-20100447 ATGCACTATGTGTTAAATACTGG + Intergenic
1026561335 7:71452747-71452769 GTGCAGTATCTGATAAAAAGGGG + Intronic
1034073977 7:148214137-148214159 GTGCAGGATCAGGTAGACACAGG - Intronic
1035913147 8:3591563-3591585 GTGTAATCTCTGGTAAACAGCGG - Intronic
1037143533 8:15546365-15546387 GTGTACTATCTGCAAAATACAGG - Intronic
1037988201 8:23302774-23302796 GTGCACTAACAGGTGATCACAGG + Intronic
1041645323 8:60245840-60245862 GTGCATTGCCTTGTAAACACAGG - Intronic
1045322803 8:101094809-101094831 GAGCGCTTGCTGGTAAACACTGG + Intergenic
1047101055 8:121676234-121676256 GTGCTCTTTCTGGGAAGCACCGG + Intergenic
1190384525 X:49872087-49872109 GGGCACTATGTGGTGAAAACTGG + Intergenic
1193330867 X:80233975-80233997 GTGAACTAACTGGTGAACTCTGG - Intergenic
1195657511 X:107346191-107346213 GTGCAGTTTCTGGGAAATACAGG - Intergenic
1197811386 X:130446846-130446868 TTGCACTGTCTGCTAAAGACAGG + Intergenic
1200361806 X:155614488-155614510 GTGCACTATATGCTAAACACTGG + Intronic
1202282039 Y:23199551-23199573 CTGCAGTACCTGGTAATCACAGG - Intergenic
1202283852 Y:23218968-23218990 CTGCAGTACCTGGTAATCACAGG + Intergenic
1202433711 Y:24813936-24813958 CTGCAGTACCTGGTAATCACAGG - Intergenic
1202435528 Y:24833354-24833376 CTGCAGTACCTGGTAATCACAGG + Intergenic