ID: 1092803181

View in Genome Browser
Species Human (GRCh38)
Location 12:12191933-12191955
Sequence AACAAGGAAATGACTCCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 449
Summary {0: 1, 1: 0, 2: 5, 3: 53, 4: 390}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092803181 Original CRISPR AACAAGGAAATGACTCCAGA TGG Intronic
900682621 1:3925207-3925229 ACTTAGGAAAGGACTCCAGATGG - Intergenic
901082356 1:6590704-6590726 ACAAAGGCAATGACTCCAAATGG + Exonic
902254930 1:15182253-15182275 AGCAGGGATTTGACTCCAGAAGG - Intronic
903386088 1:22927834-22927856 AACAAAGAAATGACTGAAGGGGG + Intergenic
903493935 1:23751704-23751726 AACAACCTAAAGACTCCAGAAGG + Exonic
903611875 1:24620788-24620810 AACAAGAAGATAATTCCAGAAGG - Intergenic
903726939 1:25455101-25455123 AATCAGGTAATGATTCCAGAAGG + Intronic
905229243 1:36503542-36503564 AAAAGGGAAATTACCCCAGAAGG - Intergenic
905532947 1:38696459-38696481 AGCAATGAAAGAACTCCAGAAGG + Intergenic
905640155 1:39583730-39583752 AACAAACAAATGATGCCAGAAGG - Intergenic
905870572 1:41401867-41401889 AACAAGGAAAAGTTTGCAGAAGG - Intergenic
907723111 1:56992318-56992340 AACAGGGAAATGAATACAGAAGG + Intergenic
910604607 1:89069103-89069125 AGAAAGCAGATGACTCCAGATGG + Intergenic
910981948 1:92966679-92966701 GACAAAGAAATTACTCCAGTGGG + Intergenic
911436033 1:97859059-97859081 AAGAAGGAAATGATTCAAAAAGG - Intronic
912746033 1:112246159-112246181 AATAAGCAAATGCCTCCAGGAGG + Intergenic
912994177 1:114516779-114516801 ACCAAGGAAGTGATTCCAGAAGG - Intergenic
914453878 1:147817297-147817319 AATAAGGAGATGATTACAGATGG - Intergenic
915169195 1:153965986-153966008 AACAAGCAGATGACTGCAGAGGG + Intronic
915256877 1:154638955-154638977 GAGAAGGAAATGATTTCAGATGG + Intergenic
916055946 1:161069100-161069122 GACAGGGAAATGGCCCCAGAAGG - Intronic
916591692 1:166197202-166197224 AAAAGGCAAATGACTCCAGGTGG - Intergenic
916977409 1:170095686-170095708 CACAATGAAATCACACCAGAAGG - Intergenic
919342379 1:196328794-196328816 AACAGGAAAATGAATCCAGAAGG + Intronic
922010894 1:221585795-221585817 AAAAAGGGAATGGCTTCAGAAGG + Intergenic
922624000 1:227018888-227018910 AACAAGAATATGACTCATGAAGG - Intronic
923260203 1:232261129-232261151 AATAGGTAAATGACTCCAGAAGG + Intergenic
924184563 1:241474766-241474788 CACAGGGAAATGAAGCCAGAGGG - Intergenic
1064345958 10:14533081-14533103 AACCTGGAAATGACTCCCCATGG - Intronic
1064514696 10:16133918-16133940 AAAAAGGAAATGACAACAAATGG + Intergenic
1065031613 10:21592275-21592297 AATAGGAAAATGATTCCAGAAGG - Intronic
1065557585 10:26931887-26931909 AATAGGGAAATGACTCTAAATGG + Intergenic
1066754276 10:38694829-38694851 TAAAAGGATATGACACCAGATGG + Intergenic
1067542593 10:47166557-47166579 AGAAAGGAAAAGAATCCAGAAGG - Intergenic
1067981349 10:51089076-51089098 AAAATGGAAATGCCTTCAGAGGG - Intronic
1070319749 10:75345673-75345695 AAAAAAGAAAGGACCCCAGAGGG + Intergenic
1070774539 10:79102100-79102122 AACAAGCTGGTGACTCCAGATGG - Intronic
1070836890 10:79453178-79453200 AGCAAGGGAGTGATTCCAGATGG - Intergenic
1070936630 10:80303471-80303493 AACAAAGAAAAGCCTGCAGATGG + Intergenic
1071928180 10:90435599-90435621 AACAAGGTGGTGCCTCCAGAAGG + Intergenic
1072084265 10:92063190-92063212 AATAACAAAATGACTGCAGACGG - Intronic
1072718219 10:97765529-97765551 CTCAGGGAAATGACTCCAGAGGG - Intergenic
1072881063 10:99230441-99230463 AACAAGAAAAGGATTCCATATGG + Intronic
1073165480 10:101445633-101445655 AGCAAGAAAATAACTCCAGGAGG - Intronic
1073451731 10:103613626-103613648 GAGAGGGAATTGACTCCAGAAGG + Intronic
1073451975 10:103615425-103615447 GAGAATGAAATGACTCCAGCGGG + Intronic
1075134107 10:119767153-119767175 AAAAGGAAAATGATTCCAGATGG + Intronic
1075215872 10:120533841-120533863 ACTAAGGAAATGAAACCAGATGG - Intronic
1076021409 10:127076824-127076846 AACATGGAAATGCCACCAGGAGG - Intronic
1077662694 11:4083671-4083693 AACAAGGAAAGAACACCAAAAGG - Intronic
1077966905 11:7144501-7144523 AAGAAGGAAAAGAGTGCAGAGGG + Intergenic
1078407450 11:11082743-11082765 ACCAAGCAAATCACTCTAGAAGG + Intergenic
1078500241 11:11866614-11866636 AAAAAGAAAGTGACCCCAGAAGG - Intronic
1079165603 11:18039410-18039432 AGCAAGGATATGAATCCAGGTGG + Intronic
1079377022 11:19902242-19902264 ATCAAGAAAATGACTCCCAAAGG - Intronic
1079942732 11:26701846-26701868 AACAAAGTAATGCCTCGAGAAGG - Intronic
1081004637 11:37719952-37719974 ATCAAGGAAATCAATCCAGATGG + Intergenic
1081239779 11:40690888-40690910 AAAGAAGAAAGGACTCCAGAAGG + Intronic
1084924126 11:72498194-72498216 AGCAAGGAGATGACTCTAGATGG - Intergenic
1084985003 11:72861569-72861591 TACAAGGAAATGAATGGAGATGG + Intronic
1085919526 11:80935520-80935542 AACAAGGAAAAGATTCATGAAGG + Intergenic
1085920954 11:80956702-80956724 AACAAGGTAATATCTTCAGAAGG - Intergenic
1085934926 11:81129696-81129718 AACAAGGAAATAACCCCAACAGG - Intergenic
1085957181 11:81413639-81413661 AATAAATAAATGACTTCAGATGG + Intergenic
1087859312 11:103134013-103134035 AACAAGGAAAAGACTGAGGAGGG - Intronic
1089088268 11:115842615-115842637 CACAAGGAAATAAATACAGATGG + Intergenic
1089843571 11:121440392-121440414 AACAAATAAAGAACTCCAGAGGG + Intergenic
1090447947 11:126780182-126780204 AAACAGGAAAAGACTGCAGAAGG + Intronic
1090814274 11:130277476-130277498 GCTAAGGAAATGACTACAGATGG - Intronic
1090992949 11:131837408-131837430 TACAAAGAAATCACTCCAGCAGG - Intronic
1092574556 12:9765780-9765802 ACCTAGGAAATGCCTCCAGGTGG + Intergenic
1092803181 12:12191933-12191955 AACAAGGAAATGACTCCAGATGG + Intronic
1093087335 12:14881104-14881126 AGAAAGGAAGTGACACCAGATGG + Intronic
1093721585 12:22448656-22448678 AACAAGGAAATGACTCTTAAGGG + Intronic
1094255418 12:28419640-28419662 AATAAGTAAATGTCTCCAGGTGG - Intronic
1094264786 12:28544271-28544293 CACAAGGAAAAAACTCCAAAAGG - Intronic
1094606283 12:31951944-31951966 AAAAAAGAAATAACTCCTGAGGG - Intergenic
1095224137 12:39659024-39659046 AAACAGAAAATGACACCAGATGG - Intronic
1095520644 12:43060917-43060939 TAAAAGGAAATGATACCAGATGG - Intergenic
1095659582 12:44715458-44715480 AACAAGGAAATGATTTCTGTTGG - Intronic
1095662124 12:44749056-44749078 AACAAAAAGATGACTCCAAAAGG + Intronic
1095671728 12:44869332-44869354 AGCATGGAGCTGACTCCAGAGGG - Intronic
1096282019 12:50264219-50264241 GACAAGGAACTGACTGCTGATGG + Intronic
1098057182 12:66520311-66520333 AACAGGGAAAATCCTCCAGATGG + Intronic
1098172258 12:67758851-67758873 AAAAAAGAAAAGACTCCAGATGG - Intergenic
1098633123 12:72749057-72749079 CAAAAGGAAATGATTCAAGATGG - Intergenic
1099865235 12:88271967-88271989 AAAAGAGAAATGTCTCCAGATGG - Intergenic
1099983113 12:89629767-89629789 TAAAGGGAAAAGACTCCAGAGGG + Intronic
1101188059 12:102302283-102302305 ATTAAGGAAATGACTTCAGATGG - Intergenic
1101560352 12:105851593-105851615 AACAGGGTAATGATTCCATAAGG + Intergenic
1102215239 12:111156571-111156593 AACATGGGAAAGACTCCTGAAGG + Intronic
1102341778 12:112127061-112127083 AAAAGGGGAATGACTCAAGAAGG - Intronic
1103268748 12:119654354-119654376 TACAGGGAAATGAAACCAGATGG + Intergenic
1103425960 12:120834152-120834174 AAAAAGGAAACCACTACAGATGG + Intronic
1105556596 13:21452482-21452504 CAGAAGGAAATGACACTAGATGG + Intronic
1106580240 13:31011440-31011462 AAAGAGAAAGTGACTCCAGAAGG - Intergenic
1106638972 13:31562848-31562870 AAAAGGAAAATGATTCCAGAAGG - Intergenic
1107977033 13:45699802-45699824 AACAAGGAAATAACTTAAAATGG - Intergenic
1108496779 13:51033456-51033478 CCCAAGGAAAGAACTCCAGAAGG + Intergenic
1108718819 13:53109057-53109079 AATTAGGAGATTACTCCAGAAGG + Intergenic
1108729454 13:53219112-53219134 CAGAAGAAAATGACCCCAGATGG - Intergenic
1108822373 13:54368936-54368958 AAGAAAGAAATGACTCCTAAAGG + Intergenic
1108993694 13:56697380-56697402 AAAAATGAAATCACTCCAAATGG + Intergenic
1109053913 13:57521172-57521194 AGTAAGGAAATGATACCAGATGG + Intergenic
1109287991 13:60434738-60434760 AAGAAGAAACTGACACCAGAGGG - Intronic
1110317469 13:74127390-74127412 AACAAGCAATTAACACCAGAAGG + Intronic
1110341352 13:74394762-74394784 TAAAAGAAAATGACACCAGATGG - Intergenic
1110655923 13:77998916-77998938 TAAAAGGAATTGACTGCAGAGGG - Intergenic
1111309105 13:86458093-86458115 AATAAAGGAATGACCCCAGATGG + Intergenic
1112666032 13:101574645-101574667 AACAAGGAAATTTCTCAAGTGGG + Intronic
1113283592 13:108819189-108819211 AACAAATAAATGACTGCAAATGG + Intronic
1113406499 13:110045784-110045806 AACAAGGGAATGACTTGAGGAGG - Intergenic
1113982884 13:114290697-114290719 AAAAAGAAAATGACTCCATATGG - Intronic
1115476387 14:33817947-33817969 AAAAGAGAAATGACCCCAGATGG + Intergenic
1117163590 14:53012501-53012523 AACAATGAAATAAATGCAGAAGG + Intergenic
1117349138 14:54863717-54863739 AACAAGAAAACGAATCCATAGGG + Intronic
1117809153 14:59527832-59527854 AAGAAAGAAAAGATTCCAGAAGG - Intronic
1117941706 14:60973681-60973703 AAAAAGGAAATGATTCTGGATGG - Exonic
1118120831 14:62840322-62840344 AAGAAGAAAATGCCTCCTGAAGG + Intronic
1119938599 14:78616528-78616550 AACAAAGAAAAGCCTACAGATGG - Intronic
1123914412 15:25007563-25007585 AACACTGAAAAGACTCCTGAAGG - Intergenic
1123950855 15:25273156-25273178 ACTAAGGAAATGACTACAGATGG + Intergenic
1125509436 15:40284860-40284882 AAAAAGGAAGTAATTCCAGACGG + Intronic
1126381651 15:48054182-48054204 TTCATGGAAATGACTCCAAAAGG + Intergenic
1127668767 15:61174291-61174313 AACTAGGAAATGGCTCCCTATGG - Intronic
1128586589 15:68857489-68857511 AAAAAGGAAATGACAAAAGAAGG - Intronic
1128778613 15:70342876-70342898 AAAAAGGGAATGACTCCAAGAGG + Intergenic
1128904732 15:71456813-71456835 AAGAAGGGAATGCCTCAAGATGG - Intronic
1129056994 15:72827097-72827119 AACAAGGAGAGAACTACAGAAGG - Intergenic
1129103290 15:73286344-73286366 AAGAAGAAAATGTTTCCAGAAGG - Intronic
1129543113 15:76367458-76367480 CACAAGAAAATGAGGCCAGAAGG - Intronic
1129557344 15:76526127-76526149 AACAAGAAAATGAGCTCAGAGGG - Intronic
1129560963 15:76568011-76568033 AACAAAAAATTGATTCCAGATGG - Intronic
1130262034 15:82362798-82362820 ATCAAAGTAATGACCCCAGAAGG - Intergenic
1130279198 15:82506209-82506231 ATCAAAGTAATGACCCCAGAAGG + Intergenic
1130622935 15:85482861-85482883 ATCAAAGTAATGACCCCAGAAGG - Intronic
1131185683 15:90272109-90272131 AAGAAGGAAATGAGGTCAGAAGG - Exonic
1131643085 15:94313366-94313388 ACCCAGGAAATGAGTCCACAGGG - Intronic
1131678889 15:94701132-94701154 AACAAGCACATAACACCAGAGGG + Intergenic
1131798658 15:96046842-96046864 CACAAGGAAATACCTCCAAAAGG + Intergenic
1133162408 16:3920721-3920743 AACGAGGAACTGCCTGCAGAAGG - Intergenic
1134123724 16:11602001-11602023 ACAATGCAAATGACTCCAGAAGG + Intronic
1134262025 16:12658904-12658926 AAAAAGGAATTGACTCCAGCTGG - Intergenic
1134516313 16:14889932-14889954 AGCACGCAAATGACTCCACAGGG + Intronic
1134703987 16:16288584-16288606 AGCACGCAAATGACTCCACAGGG + Intronic
1134963556 16:18423530-18423552 AGCACGCAAATGACTCCACAGGG - Intronic
1134967851 16:18506129-18506151 AGCACGCAAATGACTCCACAGGG - Intronic
1135298751 16:21306050-21306072 AACAAGAAATTAACTCGAGATGG - Intergenic
1135720602 16:24814373-24814395 AAGAAAAAAATGACACCAGAAGG - Intronic
1136405086 16:30040635-30040657 AAAAAGAAAATAACTGCAGAGGG - Intronic
1136728458 16:32382295-32382317 TAAAAGGATATGACACCAGATGG - Intergenic
1137321641 16:47389444-47389466 ACCAAGAAAATGACACCAGATGG + Intronic
1138020678 16:53477685-53477707 GCAAAGGAAATTACTCCAGATGG - Intronic
1138463035 16:57164509-57164531 AAGAAAGAAATGATCCCAGAAGG + Intronic
1138800882 16:60027611-60027633 AGCAATGAAATGAGTCCTGAGGG + Intergenic
1139216206 16:65126017-65126039 AACAAGGAACTGACTCAGCAGGG - Intronic
1140269461 16:73451706-73451728 AACTGGGAAATGACCCCAGATGG + Intergenic
1140315484 16:73892211-73892233 AATAAGGGACTGACTCGAGATGG + Intergenic
1140625937 16:76794341-76794363 AAGAAGGAAAGCACTCCACAGGG - Intergenic
1140634792 16:76899205-76899227 AACAAGGATATGGATCCACATGG - Intergenic
1141226173 16:82118075-82118097 AACAAAGAAATGAATGCAAAGGG - Intergenic
1202997981 16_KI270728v1_random:135460-135482 TAAAAGGATATGACACCAGATGG + Intergenic
1142594286 17:1022123-1022145 AAACAGAAAATGACTCCAGAAGG + Intronic
1142911388 17:3095856-3095878 ACTAAGGAAATGACTACAGAAGG + Intergenic
1144592596 17:16537022-16537044 ATCAAGGAAATGTCGACAGAGGG + Intergenic
1145069038 17:19787510-19787532 AGTAAGGAAGTGACACCAGATGG + Intronic
1145929360 17:28673889-28673911 AACCACGAAATGACTTCAAAGGG + Intronic
1146142664 17:30380799-30380821 AAGAGGGAACTCACTCCAGATGG + Intronic
1146665198 17:34697092-34697114 AAAAAGAAAATGATTCCAGAAGG + Intergenic
1146780782 17:35670085-35670107 GACAAGAAAATAACTCCACATGG - Intronic
1147060849 17:37877011-37877033 AATAGGAAAATGATTCCAGAAGG + Intergenic
1147467637 17:40623016-40623038 AAGAAGGAAAGGATTCCACAAGG + Intergenic
1147976649 17:44251686-44251708 AAAAAAGAAATGGCTCCATATGG - Intronic
1148018077 17:44536586-44536608 AGCAAGGAAATGAGGACAGAGGG - Intergenic
1148410195 17:47459792-47459814 AATAGGAAAATGACTCCAGAAGG + Intergenic
1151672458 17:75578942-75578964 GAGAAGGAGATGGCTCCAGAGGG + Intergenic
1153354036 18:4115763-4115785 AGTAAGAAAATGACACCAGATGG - Intronic
1153456104 18:5283659-5283681 AACAAGGAAATGATTCATGAAGG + Intergenic
1153793751 18:8603845-8603867 AAAAGGGAAATGAAACCAGATGG + Intergenic
1155123967 18:22852621-22852643 AGATAGGAAATGACACCAGAAGG - Intronic
1156279603 18:35623180-35623202 AAAAGGGAAATGACACCAGATGG - Intronic
1157124286 18:44940840-44940862 CAAAAGGAAATGACACCAGATGG - Intronic
1159000522 18:62970860-62970882 CACAAGAAAATGACACTAGATGG - Intronic
1160209403 18:76863851-76863873 AGAAAGGAAATGACACCAGAAGG + Intronic
1164188295 19:22892605-22892627 GACGAGGACATGACTCTAGACGG - Intergenic
1165548225 19:36560463-36560485 GCTAAGGAAATGAATCCAGATGG + Intronic
1166519055 19:43467461-43467483 AAAAGGAAAATGACTCTAGAAGG + Intergenic
924983155 2:242150-242172 AGTAAGGAAATGACACCAGATGG + Intronic
925144224 2:1570158-1570180 AAAAAGGAAAGGGCTGCAGAGGG + Intergenic
926002490 2:9345037-9345059 AACAAGGACAAGACTCCATCTGG - Intronic
928675125 2:33643522-33643544 AAAAAGGAAATAATACCAGATGG - Intergenic
929713927 2:44292120-44292142 GGCAAGGAAGAGACTCCAGATGG + Intronic
930583414 2:53241420-53241442 AAGAAGAAAATGAACCCAGAAGG - Intergenic
930731836 2:54735222-54735244 CACGATGCAATGACTCCAGAAGG - Intronic
931041016 2:58300420-58300442 AATAAGGAAATGATTCAGGATGG + Intergenic
931149893 2:59561173-59561195 CACAAGGAAACTACTACAGAAGG + Intergenic
933073797 2:77896637-77896659 AAAAATGAAATGACTGAAGATGG - Intergenic
933295292 2:80483345-80483367 AACAACAACATGACTCTAGATGG - Intronic
933556877 2:83841417-83841439 GCTAAGGAAGTGACTCCAGATGG + Intergenic
933889157 2:86750239-86750261 CAGAAGAAAATGACACCAGAAGG - Intronic
934317570 2:91939091-91939113 TAAAAGGATATGACACCAGATGG + Intergenic
935354922 2:102188818-102188840 AAGAGGGAAATCACTCCCGATGG + Intronic
935884442 2:107601005-107601027 AATAAGAAAATGACTATAGATGG - Intergenic
937232774 2:120408879-120408901 AACAAGGAAAAGTTTCAAGAGGG + Intergenic
937721471 2:125101787-125101809 AACACCGAGAAGACTCCAGATGG + Intergenic
937724227 2:125141764-125141786 AAAAAGTTAATGATTCCAGAAGG + Intergenic
938159180 2:128969563-128969585 AGTAAGGAAAGGACACCAGATGG + Intergenic
939228286 2:139391370-139391392 AAACTGGAAATAACTCCAGATGG - Intergenic
939326358 2:140694574-140694596 AAGAAAGAAATGTCTCTAGATGG - Intronic
939680159 2:145120802-145120824 AACCAGCAAATGGCTCCAAAGGG + Intergenic
940541694 2:155028485-155028507 ACAATAGAAATGACTCCAGAAGG - Intergenic
940550475 2:155149323-155149345 AAGAAGGAAAAGAATCCAGATGG - Intergenic
941247303 2:163115378-163115400 ACAAAGTAAATAACTCCAGATGG + Intergenic
942511023 2:176701030-176701052 AAAAAGGAAATGATAGCAGAAGG - Intergenic
942654613 2:178202255-178202277 AGAAAGAAAATGATTCCAGATGG - Intronic
943216716 2:185045953-185045975 AACAAAGAATGGACACCAGAAGG - Intergenic
943471828 2:188303997-188304019 AACAAGCAAAGGTCGCCAGAGGG - Intronic
944369604 2:198966424-198966446 AACAAGAAAAAGAGTACAGAGGG - Intergenic
945202725 2:207299315-207299337 GCAAAGGAAATGACTCCAGATGG + Intergenic
945277223 2:208000187-208000209 AACAAGGAAATGGCTGGGGAGGG - Intronic
946051567 2:216867036-216867058 AACAAGGAAAGGGCGCAAGATGG - Intergenic
948145075 2:235702567-235702589 ATCCTGGAAATGACTCCAGTTGG - Intronic
948765648 2:240217399-240217421 ACCAAGGACAGGACTCCAGGTGG + Intergenic
948770085 2:240247424-240247446 AACAAGTAAATGAAACCACATGG - Intergenic
1168823459 20:792859-792881 AACAAAGATATCCCTCCAGATGG + Intergenic
1169854270 20:10086513-10086535 AACAAGGGTTTGAGTCCAGATGG + Intergenic
1169900904 20:10550786-10550808 AACAGGGAAAGGAGTGCAGAAGG - Intronic
1171376278 20:24696234-24696256 AACCAGGAAATGCTTCCAGGAGG + Intergenic
1177145435 21:17402352-17402374 AAGAAGGAAATGACTTTTGAAGG - Intergenic
1178267608 21:31158465-31158487 CACAAGGAACTGAGTCCAGATGG + Intronic
1179110125 21:38439041-38439063 AACATGGCAATGGCTCCAGGTGG + Intronic
1179227796 21:39470773-39470795 AAGAAGAAAATAATTCCAGATGG - Intronic
1184199109 22:42952986-42953008 AAGAAGGAAATTATTTCAGATGG + Intronic
1185105039 22:48863894-48863916 TACAAGGAAACAACCCCAGACGG - Intergenic
1185174863 22:49320802-49320824 ACCCAGGAAATGACACTAGATGG - Intergenic
950102374 3:10365930-10365952 TTAAAGGAAATCACTCCAGATGG - Intronic
950441341 3:13012457-13012479 AAAGAGGAAATGACTACACATGG - Intronic
950560801 3:13721919-13721941 GATAAGAAAATGACTCCAGATGG - Intergenic
951550126 3:23868875-23868897 AGCAAGGAAAGAAATCCAGAAGG - Intronic
951697196 3:25457514-25457536 AACAAATGAATGAATCCAGAAGG - Intronic
951942721 3:28098279-28098301 AGTAAGAAAATGACACCAGATGG - Intergenic
952053776 3:29418681-29418703 AATAAGGACATAACTCTAGAGGG + Intronic
952420713 3:33128796-33128818 TAGAAGCAAAAGACTCCAGAAGG - Intronic
953499217 3:43416946-43416968 AAATTGGAAATGACACCAGAAGG - Intronic
953714248 3:45303069-45303091 AATAAGGAAATGATACTAGATGG + Intergenic
953732010 3:45457742-45457764 AAGAAGGGAATGAGTACAGAGGG - Intronic
953866659 3:46589409-46589431 AAACAGGAAATAACTCCAAAAGG + Intronic
955256044 3:57332602-57332624 AACAAGAAAAAGACTACAAAGGG + Intronic
957857929 3:85903052-85903074 AATAAGGAAATGATTCTAGGTGG - Intronic
958459803 3:94380344-94380366 AAAAAGAAAATGATGCCAGATGG + Intergenic
958509880 3:95034535-95034557 AACTAGAAATTAACTCCAGAAGG - Intergenic
960361421 3:116716508-116716530 AACAAGCAAATATCTCCAGAGGG + Intronic
960657281 3:120019413-120019435 AACATGCAAATGATTCCTGATGG - Intronic
960771891 3:121202288-121202310 AACAAGGAAAAGATACCAGTTGG - Intronic
964191011 3:154001101-154001123 CACATACAAATGACTCCAGAGGG + Intergenic
964555687 3:157935671-157935693 AACAATGAAATGAAATCAGAGGG - Intergenic
966760682 3:183416367-183416389 AATAAAGAAATGACTCCAGAGGG - Intronic
966970081 3:185036847-185036869 GCTAAGGAAATGACTACAGATGG - Intronic
967572568 3:191047594-191047616 AACAAGAAAATGACACCAGACGG - Intergenic
967587062 3:191227631-191227653 AACAAAGAAATGACTCTTAAAGG + Intronic
968183679 3:196616046-196616068 AAGATGGAATGGACTCCAGAAGG - Intergenic
968588022 4:1442388-1442410 AGAATGGAAATGATTCCAGAAGG - Intergenic
968743776 4:2346386-2346408 AAAAAGAAAATGACACCAGATGG + Intronic
971006877 4:22384276-22384298 AACAAGGCAATTTCTCCTGAAGG - Intronic
971059344 4:22950061-22950083 ACCAAGGAAATTACTTTAGATGG + Intergenic
971876524 4:32316081-32316103 ACCAAGGAAATTACTACAGCGGG + Intergenic
973822352 4:54673631-54673653 AACAATAAAATCACGCCAGAAGG - Intronic
974382124 4:61154540-61154562 GACAATGAAATGAATTCAGAAGG + Intergenic
975474786 4:74811294-74811316 AAAAAGGAAATAACTAAAGATGG + Intergenic
975604711 4:76142980-76143002 AACAAATAAATGAATCCAGGTGG + Intronic
976819512 4:89189315-89189337 AAAAAATAAATGAATCCAGAGGG - Intergenic
977228825 4:94427357-94427379 AAGAAGAAAATGATACCAGATGG + Intergenic
977552802 4:98460016-98460038 AAAAAGAAAATGACTCTAAAGGG - Intergenic
977949807 4:102957673-102957695 TAAAAGGATATGACACCAGATGG + Intronic
979210278 4:118092495-118092517 AAAAAGATAATGACTCAAGAAGG - Intronic
979640666 4:123010013-123010035 AACAGGGAAAGGAAGCCAGAAGG + Intronic
980253244 4:130345546-130345568 TATAAGTAAATGTCTCCAGAGGG - Intergenic
981189126 4:141840377-141840399 ACCTAGGAAATTAATCCAGAGGG - Intergenic
981751556 4:148097258-148097280 TAAAGGGAAATGACTCCTGAAGG - Intronic
982165291 4:152608485-152608507 AAAAATAAAAAGACTCCAGAGGG + Intergenic
982436936 4:155390526-155390548 AACACCAAAATAACTCCAGATGG + Intergenic
982446750 4:155500048-155500070 AATTAAAAAATGACTCCAGATGG + Intergenic
982459057 4:155645179-155645201 AAAAAGATAATGACTCCAGAAGG + Intergenic
982600121 4:157438860-157438882 ATCTGGGTAATGACTCCAGAAGG - Intergenic
982635624 4:157893238-157893260 AAAAAGGTAAAGACTCCACAAGG + Intergenic
983235981 4:165179577-165179599 AAATAGGGAATGACTGCAGATGG - Intronic
983913168 4:173263006-173263028 ATCAAGGCAATGACACCAAATGG - Intronic
984247591 4:177294440-177294462 AACAAGGATGAGATTCCAGAAGG - Intergenic
984601514 4:181732278-181732300 AACTCAGAAATGACTCCAGGAGG + Intergenic
984893541 4:184515076-184515098 AAAAATGGAATGACTGCAGAAGG + Intergenic
986203337 5:5599621-5599643 AACAAGGAAAAGACTAGAAATGG - Intergenic
987692620 5:21286277-21286299 AACAAAGAATTGAATACAGAGGG + Intergenic
987826681 5:23038886-23038908 AACAAAGAAATGAGAGCAGAGGG + Intergenic
989853983 5:46255557-46255579 AACAAGGAAATATCTTCAGATGG - Intergenic
989855444 5:46282169-46282191 AACAAGGAAATATCTTCAGATGG - Intergenic
990268841 5:54112807-54112829 AACAAGAACATGACACCTGAAGG + Intronic
991747735 5:69763774-69763796 AACAAAGAATTGAATACAGAGGG - Intergenic
991749994 5:69791551-69791573 AACAAAGAATTGAATACAGAGGG + Intergenic
991799313 5:70343628-70343650 AACAAAGAATTGAATACAGAGGG - Intergenic
991801567 5:70371355-70371377 AACAAAGAATTGAATACAGAGGG + Intergenic
991827029 5:70638671-70638693 AACAAAGAATTGAATACAGAGGG - Intergenic
991829284 5:70666408-70666430 AACAAAGAATTGAATACAGAGGG + Intergenic
991891672 5:71343055-71343077 AACAAAGAATTGAATACAGAGGG - Intergenic
992273875 5:75094165-75094187 GCTAAGGAAATGACTCCACATGG + Intronic
993755169 5:91720140-91720162 ATCAAGGAAATGACTCTAAGTGG - Intergenic
994315991 5:98333826-98333848 CAGAAGGAAATGACTCTAGGTGG - Intergenic
994457833 5:100035027-100035049 AATCAGGAAATGACTGCAAATGG + Intergenic
995367592 5:111381088-111381110 AATAAGTAAATGACTTCAGAAGG + Intronic
995411673 5:111864658-111864680 AACAAAGAAATGAGTCCAAATGG + Intronic
996722503 5:126643848-126643870 ACTAAGGAAATGACTCCAGATGG - Intergenic
998128705 5:139640391-139640413 AGGAAGAAAATGTCTCCAGAGGG - Intergenic
998173775 5:139887641-139887663 AACTAGGAAATGACACTAGGAGG - Intronic
998351641 5:141505699-141505721 AACAAGGAAAAGACTCATGGAGG + Intronic
998376352 5:141693431-141693453 AACAAGGAAATGTATGCGGATGG + Intergenic
998769596 5:145526721-145526743 AGCATTGCAATGACTCCAGAAGG + Intronic
998863885 5:146475134-146475156 AACAAGGAAAAGAAGTCAGAAGG - Intronic
999309888 5:150545159-150545181 AACAAGGACTTGCCTCCAGTGGG - Intronic
1000749535 5:165076403-165076425 AACAAGAATATGACACCATATGG - Intergenic
1000901588 5:166917991-166918013 AACAAGGGAATGAATAGAGAGGG + Intergenic
1001132783 5:169078545-169078567 AACAAGGAAATGAGTGAAGTTGG - Intronic
1001616775 5:173049099-173049121 AACAAGGAAGTGGGGCCAGAGGG + Intergenic
1001909420 5:175503074-175503096 AGTGAGGAAATAACTCCAGAGGG + Intronic
1001997893 5:176176595-176176617 AACTAGGAGCTGGCTCCAGATGG - Intergenic
1002009476 5:176265606-176265628 AACTAGGAAATAACTCCAACAGG - Intronic
1002217251 5:177646689-177646711 AACTAGGAAATAACTCCAACAGG + Intergenic
1002554469 5:180024678-180024700 AAAAGGGAAATGACACCAAACGG + Intronic
1003111644 6:3256306-3256328 ACCAGGGAAATGACCCCTGATGG + Intronic
1003940003 6:11015328-11015350 CAAAGGGAAATGACTCCATATGG + Intronic
1004552291 6:16660362-16660384 AAAAAGGATCTCACTCCAGAGGG + Intronic
1004575818 6:16893079-16893101 GCTAAGGAAATGACTCCAGATGG - Intergenic
1004876964 6:19965750-19965772 AATAAGGAAATGTTTCCAAATGG + Intergenic
1005160192 6:22850835-22850857 CAGAAGAAAATGATTCCAGATGG + Intergenic
1006522720 6:34581333-34581355 AAACAGGAACTGACTCCAGCTGG - Intergenic
1007034311 6:38659076-38659098 AGAAAAGAAATGACACCAGAAGG + Intergenic
1008533720 6:52490107-52490129 AGGAAGGAAATGACTGCACATGG - Intronic
1010778644 6:79917204-79917226 CACTAGAAAATGACTCTAGAAGG + Intronic
1010823308 6:80442590-80442612 AAGAAGAAAATGATTACAGAGGG + Intergenic
1011884109 6:92071784-92071806 AAGAAGGAAATTCCACCAGATGG + Intergenic
1011921455 6:92581978-92582000 AACAAAAAAATAACTCAAGATGG + Intergenic
1012982390 6:105843998-105844020 AAAAAGGAAATGACACCAAGAGG + Intergenic
1014229245 6:118884083-118884105 ATTAAGGAAATGACTCCAGATGG + Intronic
1014494913 6:122109419-122109441 AACAAAGAAATGTATCTAGAAGG - Intergenic
1014684591 6:124480087-124480109 AAAAAGCAAATGACCTCAGAAGG - Intronic
1015615852 6:135074185-135074207 AACAAAGACATGCCTGCAGAAGG + Intronic
1015684855 6:135848523-135848545 ACCAAGGGAATGAATGCAGATGG - Intergenic
1015753712 6:136587127-136587149 AACCAGGAAAGGATTTCAGAAGG + Intronic
1016855136 6:148661261-148661283 ACTAAGGAAATGATGCCAGATGG + Intergenic
1018364919 6:163110146-163110168 AACATGGCAATGTCTCCTGAAGG + Intronic
1018791702 6:167153730-167153752 AATAAGGAAATGACTCAAAAGGG - Intronic
1019021404 6:168921475-168921497 GACAAGGAAAATACTCCACATGG - Intergenic
1019688067 7:2393179-2393201 AAGAAGGAAATGAGGTCAGAAGG + Intergenic
1020593725 7:10176549-10176571 AACAAGGAAGTAAATCGAGAAGG + Intergenic
1021083117 7:16386634-16386656 ATTAAGGAAATGACACCAGATGG + Intronic
1021113105 7:16718010-16718032 AAAAAAGAAATGATACCAGATGG - Intergenic
1021866296 7:24961788-24961810 AACAAGGAGATCTCTCTAGAAGG + Intronic
1022261507 7:28709597-28709619 AACAAGGCAAAGTCTCCAGCAGG + Intronic
1022271694 7:28814046-28814068 AGTAAGAAAATGCCTCCAGAAGG + Intronic
1022859047 7:34346803-34346825 AATATGGAAATGACTACACATGG - Intergenic
1022982648 7:35618883-35618905 AACAAGAAAATGACAGCAAAGGG + Intergenic
1023736809 7:43242694-43242716 AACTAGGAAAAGACGCAAGAAGG - Intronic
1024298767 7:47868445-47868467 AATAAAGAAATGACACTAGATGG + Intronic
1024360307 7:48461259-48461281 AACCAGGAAATGAGATCAGAGGG - Intronic
1025523504 7:61773427-61773449 AACAAGGAAATATCTTCAGATGG - Intergenic
1025716863 7:63965619-63965641 AAAAAAGACATGACTTCAGATGG - Intergenic
1026392752 7:69918420-69918442 AACAATGAAAAGACTCCAAAGGG - Intronic
1026528693 7:71178037-71178059 AGAAAGGAAATGACTCTAGATGG - Intronic
1026591328 7:71698291-71698313 AAAAGGAAAATGACTGCAGAAGG + Intronic
1027167789 7:75847911-75847933 AAAAAGGACAAGAATCCAGAAGG + Intronic
1027483858 7:78734509-78734531 GACAAAGGAATGACTACAGAGGG - Intronic
1027801757 7:82761433-82761455 AAGAAGGAAATGAAGACAGATGG - Exonic
1028567326 7:92246761-92246783 GACAAGGAGATGCATCCAGATGG - Intronic
1029351848 7:100018916-100018938 AAGGAGGAAATGAGTCCAGGGGG - Intronic
1029794159 7:102876091-102876113 AGCAAGAAAATGTCTCCAGCAGG + Intronic
1029956233 7:104643198-104643220 CAGAAGGAAATGAAACCAGAAGG - Intronic
1030779701 7:113584986-113585008 TACAGGGCAATGACTCCTGAAGG + Intergenic
1031805870 7:126305282-126305304 AACAAGGAAATTACCCTATATGG + Intergenic
1031889130 7:127273993-127274015 AAGAAGGAGATGACTCCAGAAGG - Intergenic
1033199519 7:139356855-139356877 AAAAAGGAAATGATCCCAGATGG + Intronic
1033728922 7:144153953-144153975 AACAGTGAAATATCTCCAGATGG + Intergenic
1034354648 7:150443014-150443036 GGAAAGGAAATGAGTCCAGAAGG - Intergenic
1034719510 7:153277078-153277100 AGTAAGAAAATGACACCAGATGG + Intergenic
1034747387 7:153535230-153535252 GAAAAGGTAATGACTCCAAATGG - Intergenic
1035052863 7:156012934-156012956 AATAAGCAAATAACACCAGATGG - Intergenic
1035300311 7:157893108-157893130 AACAAAGAAATGTCTGGAGAAGG + Intronic
1036023598 8:4877687-4877709 AATATGGAAATAATTCCAGATGG - Intronic
1036114428 8:5943443-5943465 AACAAGGATACAACTCCAGTTGG + Intergenic
1038252111 8:25914521-25914543 AAGAATGAAAAGACTCCAGGAGG + Intronic
1039175780 8:34804387-34804409 GCTGAGGAAATGACTCCAGATGG - Intergenic
1039428816 8:37509773-37509795 ATCAAGGAAGTGTCTCCAAAGGG - Intergenic
1040044893 8:42952595-42952617 GCTAAGGAGATGACTCCAGATGG - Intronic
1040450426 8:47540664-47540686 AAGAAGAAAATGACCACAGAGGG - Intronic
1040877979 8:52173305-52173327 AACAAGGAAATGAGACAAGGTGG + Intronic
1041007161 8:53506852-53506874 AACAAGGAAAGCATTCCAGGGGG - Intergenic
1041331911 8:56735830-56735852 AACAGGAAAGTGACTCCAGTAGG - Intergenic
1042417892 8:68545742-68545764 TAGAAGGAAATGATACCAGAGGG + Intronic
1042677503 8:71338237-71338259 AACTTGGAAATAACTCAAGAAGG + Intronic
1044776742 8:95697300-95697322 CAAAAGAAAATGACCCCAGAAGG + Intergenic
1045156291 8:99476835-99476857 TGAAAGGAAATGACACCAGATGG + Intronic
1045425164 8:102058937-102058959 TACAAGGAAAGGAATGCAGACGG + Intronic
1045739772 8:105343531-105343553 CAGAAGGAAATAATTCCAGAGGG + Intronic
1046892689 8:119440266-119440288 AACAAGGAAATTAGTATAGATGG + Intergenic
1047047288 8:121068745-121068767 AAAAAGGAAATGACTTAAGATGG + Intergenic
1047791417 8:128207409-128207431 AACAAGTAAGTGACTGCAGTAGG + Intergenic
1048793947 8:138131035-138131057 ACCATGGGAATGAGTCCAGATGG - Exonic
1049296018 8:141839231-141839253 AGGAAGAAAATGACACCAGATGG - Intergenic
1049871525 8:144982076-144982098 ACAAAGGAAATGACAGCAGATGG + Intergenic
1050254194 9:3777197-3777219 AACAATGAAATAAACCCAGAAGG + Intergenic
1051315617 9:15827524-15827546 AACAAGCAACAGACTCAAGAAGG - Intronic
1051435461 9:17026369-17026391 AACAAGGAAATTACTTCAAACGG + Intergenic
1051763465 9:20496160-20496182 AACAAGGCAATGATTGTAGAGGG - Intronic
1051799015 9:20910234-20910256 AACAAGATAAAGACTGCAGACGG - Intronic
1054948519 9:70823247-70823269 AACAAGGAAATGCCTTCAGGAGG - Intronic
1055040076 9:71860535-71860557 GCTAAGGAAATGACTACAGATGG + Intergenic
1057296387 9:93845890-93845912 AGTAAGGAAATGATCCCAGATGG - Intergenic
1058178736 9:101770115-101770137 AACTTGGTAATGACTACAGAGGG + Intergenic
1058577260 9:106417171-106417193 AACAAGGAAATGAAGGCTGAAGG - Intergenic
1059314922 9:113416055-113416077 AACAGGGAAATGACTAGAGGAGG - Intronic
1059421082 9:114192804-114192826 AACTAGAAAGTGCCTCCAGAAGG - Intronic
1060261379 9:122077155-122077177 AGAAAGGAAATGACCCCAGAAGG + Intronic
1061355421 9:130101072-130101094 AACAAGGAACAGACACCAGCAGG - Intronic
1187268697 X:17760508-17760530 AACAAGTAATTGATTCCTGATGG - Intergenic
1187320790 X:18235841-18235863 AACAAGTAATTGATTCCTGATGG + Intergenic
1187347300 X:18477935-18477957 AGTAAGGAAATGATACCAGATGG - Intronic
1187459394 X:19472535-19472557 AATAAGGAAATGACACCAAATGG + Intronic
1188320346 X:28728834-28728856 TGGAAGGACATGACTCCAGAGGG - Intronic
1188436579 X:30167060-30167082 AACAAGTAATAGTCTCCAGATGG + Intergenic
1189886583 X:45552192-45552214 GCTAAGGAAATGACTCCAGATGG - Intergenic
1190001094 X:46687822-46687844 AAGCAGGAAGTGACTGCAGATGG - Intronic
1190934605 X:54985561-54985583 AATAAGGAAATGATACCAGAAGG + Intronic
1191269075 X:58438854-58438876 AAAAAGGAAATATCTTCAGATGG - Intergenic
1191953013 X:66615009-66615031 AACAAGGAAAGGTCTCCCTAAGG - Intronic
1192297015 X:69861123-69861145 AAGAAGAAAATGATCCCAGAAGG + Intronic
1192540861 X:71971520-71971542 AATAAGGAAATGACACTAGATGG - Intergenic
1193349711 X:80447492-80447514 AAGAAAGAAATGTCTTCAGAGGG + Intergenic
1194947646 X:100088280-100088302 CACAAGGAAATGATCCCAAATGG + Intergenic
1195204995 X:102589534-102589556 AAAAAAGAAATGACACCAGATGG - Intergenic
1195284029 X:103365432-103365454 TCTAAGGAAATGACTGCAGAGGG - Intergenic
1195631942 X:107065701-107065723 ACTAAAGAACTGACTCCAGATGG - Intronic
1195861346 X:109386631-109386653 AACCAGGAAAACCCTCCAGATGG + Intronic
1196063340 X:111434708-111434730 AACAAGATAAAGGCTCCAGAAGG - Intergenic
1196629228 X:117916375-117916397 GACAATGAAATGAATACAGAAGG - Intronic
1197676173 X:129333202-129333224 AGCAAGAAAATGACACCAGGTGG - Intergenic
1197885946 X:131218549-131218571 ATAAATGAAATGACTCTAGATGG + Intergenic
1197930381 X:131688920-131688942 TAAAAGGAAATGACTCTATATGG - Intergenic
1199425673 X:147698359-147698381 TACAAAGGAATGACACCAGAGGG - Intergenic
1199900688 X:152169129-152169151 ACCCAAGAAATAACTCCAGAAGG + Intronic
1200359611 X:155590081-155590103 TGAAAGGAAATGACACCAGATGG + Intronic
1200360544 X:155601214-155601236 TAAAAGGAAATGACACCAGATGG + Intronic
1201604644 Y:15771587-15771609 AACAAGGAAATAAATCTCGAAGG + Intergenic